Jundishapur Journal of Microbiology

Image Credit:Jundishapur Journal of Microbiology

Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran

Author(s):
Mehrandokht SirousMehrandokht SirousMehrandokht Sirous ORCID1, 2, 3, Mohammad  HashemzadehMohammad Hashemzadeh1, 2, Maryam  KeshtvarzMaryam Keshtvarz3, Mansour AminMansour Amin1, 2,*, Nasim ShamsNasim Shams2, Maryam DastoorpoorMaryam DastoorpoorMaryam Dastoorpoor ORCID4, Mojtaba  ShahinMojtaba Shahin2, 5, Dorsa KoraeiDorsa Koraei2
1Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3Department of Microbiology and Parasitology, Faculty of Medicine, Bushehr University of Medical Sciences, Bushehr, Iran
4Department of Epidemiology and Biostatistics, Menopause Andropause Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
5Department of Medical Laboratory Sciences, Faculty of Medical Sciences, Islamic Azad University, Arak Branch, Arak, Iran

Jundishapur Journal of Microbiology:Vol. 13, issue 7; e100877
Published online:Sep 28, 2020
Article type:Research Article
Received:Jan 12, 2020
Accepted:Aug 31, 2020
How to Cite:Sirous M, Hashemzadeh M, Keshtvarz M, Amin M, Shams N, et al. Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran. Jundishapur J Microbiol. 2020;13(7):e100877. doi: https://doi.org/10.5812/jjm.100877

Abstract

Background:

Enteropathogenic Escherichia coli (EPEC) is one of the most important pathogens among young children worldwide. Both eae and bfp genes have been used to identify EPEC strains and categorize them into typical and atypical strains. They may be an emerging pathogen in both developing and developed countries.

Objectives:

This study was primarily conducted to assess the epidemiology, drug resistance, and β-lactamase distribution of EPEC, as well as the detection of efa1/lifA in atypical strains.

Methods:

A total of 251 E. coli strains isolated from children with diarrhea were evaluated for their EPEC pathotype by PCR for the presence of eae, stx1, stx2, and bfp genes. Serogrouping with polyvalent antisera was performed to confirm EPEC strains. Atypical EPEC-containing samples were evaluated for the efa1/lifA gene. EPEC isolates were assessed to recognize the antibiotic resistance and screened to detect extended-spectrum β-lactamases (ESBLs).

Results:

Enteropathogenic E. coli strains were detected in 17 (6.78%) of E. coli isolates by PCR. The prevalence of typical and atypical strains was determined at 35.3% and 64.7%. All strains were completely susceptible to colistin, imipenem, and meropenem. The prevalence of blaCTX-M and blaTEM genes was calculated at 70.58% and 58.82%, respectively.

Conclusions:

Enteropathogenic E. coli isolates are completely sensitive to carbapenems, and precise therapeutic strategies are required to prevent the spread of these beta-lactamase genes among diarrheagenic E. coli.

1. Background

Globally, infectious diarrhea is the second common cause of mortality and morbidity in children aged below five years. It is also responsible for the annual death of 525,000 children (1, 2). Dehydration is mostly caused by the loss of an excessive amount of body fluids and electrolytes through prolonged diarrhea, which can lead to serious complications in young children and infants (3). Various types of bacteria, viruses, and parasites may cause prolonged or persistent diarrhea (4). Specifically, among young children in low-income countries, Enteropathogenic Escherichia coli (EPEC) is one of the most important causes of persistent diarrhea worldwide (5, 6). The EPEC pathogenesis depends on carrying the attaching-effacing (A/E) lesions, resulting in the destruction of brush-border microvilli, intimate attachment of bacteria to intestinal epithelial cells, and finally, formation of pedestal-like structures at the site of bacterial adherence (7).
All of the genes necessary for A/E lesion formation are located on a pathogenicity island called the locus of enterocyte effacement (LEE) that encodes the intimin adhesion, which is encoded by the eae gene and several effector molecules secreted by the type III system (8, 9). Moreover, EPEC contains a large plasmid, recognized as the EPEC adherence factor (EAF) plasmid with bfp encoding the type IV pilus (bundle-forming pilus [BFP]), which contributes to early localized adherence to epithelial cells and microcolony formation (10). Enteropathogenic Escherichia coli and Shiga-toxin producing E. coli (STEC) could produce A/E lesion by eaeA chromosomal gene, but shiga toxin encoding gene (stx-1, stx-2) only is present in STEC, which is used for distinguishing between these pathotypes.
In addition, the EPEC pathotype is divided into typical (tEPEC) and atypical (aEPEC) EPECs. However, just the tEPEC contains the EAF plasmid that encodes the bundle-forming pilus (BFP). The classification of EPEC isolates is based on the presence of EAF plasmid in typical EPEC (eae A+, bfp +, stx -), while the absence of this virulence factor in atypical EPEC (eae A+, bfp -, stx -) (5, 11, 12). In contrast to typical EPEC, which is accepted as a diarrhea pathogen, the pathogenic potential of a-EPEC is still controversial (13). Although many studies have reported a significant association between EPEC and diarrhea in children, the results of some of them indicated the presence of EPEC in asymptomatic cases (5, 14).
Atypical EPEC might possess potential virulence factors (e.g., efa1/lifA), which is outside the LEE and inside PAI O122 (15-17). The efa1/lifA gene has the product lymphostatin/Efa1, which inhibits the production of lymphokines and mitogen-activated proliferation of peripheral blood lymphocytes and gastrointestinal lymphocytes (18, 19). Normally, EPEC-induced diarrhea is a self-limiting disease and can be effectively treated with oral rehydration therapy. However, antimicrobial therapy might be necessary for severe persistent infections. It is notable that the use of antibiotics may be associated with complications, including drug toxicity and increased widespread antimicrobial resistance in patients (4, 20).
According to the literature, Enterobacteriaceae produce Extended-spectrum-β-lactamases (ESBL) enzymes that hydrolyze beta-lactam antibiotics. The prevalence of infections by these strains has been on the rise across the world. In addition, ESBL production is the main factor for the spread of MDR isolates and is classified into TEM, CTX, SHV, PER, and OXA types based on the sequence of amino acids. Currently, CTX-M group is the most frequently detected type of ESBL-related genes. Therefore, the detection of resistant isolates due to this mechanism is important within every area (21, 22).

2. Objectives

Considering this background, the present study aimed to assess the prevalence of atypical and typical EPEC among a collection of E. coli isolates obtained from children aged below 10 years applying PCR amplification of eae, bfp, and eaf genes in Ahvaz, Iran. In addition to determining the antibiotic susceptibility profiling and potential ESBL production of EPEC isolates, the researchers made efforts to the recognition of efa1/lifA gene as a virulence factor in atypical EPEC strains.

3. Methods

3.1. Bacterial Strains

Fecal samples of children below the age of ten years with diarrhea were collected during March 2015-February 2016 in two educational hospitals of Ahvaz, Iran. Samples were screened for E. coli strains using standard biochemical tests. Stool samples cultured on MacConkey agar and incubated at 37ºC for 24 hours. Identification of E. coli strains was performed based on the standard biochemical tests such as oxidase negative, catalase-positive, carbohydrate utilization on TSI agar, methyl red positive, Voges-Proskauer negative, indole positive, citrate negative, and urease negative (23).

3.2. PCR Methods

The genomic DNA was extracted from the bacterial culture using the boiling method as previously described (24). At least two colonies of EPEC isolates were suspended in one ml distilled water and incubated at 95ºC for 10 minutes. Then the suspension was centrifuged for 5 minutes at 1,000 rpm. Supernatants were transferred to new tubes and used for PCR reactions (25). The quality of extracted DNA was measured by biophotometry (Eppendorf, Hamburg, Germany) at OD260 and OD280 nm, and agarose gel electrophoresis, respectively. Primer sequences for the study assays eaeA, bfpA (26), stx1, stx2 (27), and efa1/lifA (this study) are shown in Table 1. The sequence of efa1/lifA primers was constructed using the oligo primer analysis software V. 7, and a suitable primer was selected on the basis of specificity and thermodynamic properties for good primer design. Primer specificity was checked using the basic local alignment search tool (BLAST).
Table 1.The Primer Sequences of the Research
PrimerPrimer: Sequences 5’ - 3’Product Size (bp)Annealing (°C)Reference
eaeA7905523
eaeA-FCATTATGGAACGGCAGAGGT
eaeA-RATCTTCTGCGTACTGCGTTCA
bfpA3266023
bfpA-FAATGGTGCTTGCGCTTGCTGC
bfpA-RGCCGCTTTATCCAACCTGGTA
stx-16145624
stx-1-FACACTGGATGATCTCAGTGG
stx1-RCTGAATCCCCCTCCATTATG
stx-27795624
stx2-FCCATGACAACGGACAGCAGTT
stx2-RCCTGTCAACTGAGCAGCACTTTG
efa1/lifa39259This study
efa1/lifa FCATTGTCGTAGCAACCCTG
efa1/lifa RGTGGCGAGAGGTAGAATCCG
blaCTX-M5505426
CTX-M-FCGCTTTGCGATGTGCAG
CTX-M-RACCGCGATATCGTTGGT
blaTEM8005226
TEM-AGAGTATTCAACATTTCCGTGTC
TEM-BTAATCAGTGAGGCACCTATCTC
blaPER9255626
PER-FAATTTGGGCTTAGGGCAGAA
PER-RATGAATGTCATTATAAAAGC
The eaeA and bfpA genes as control strains were prepared from the National E. coli Reference Laboratory (NERL), Pasteur Institute of Iran. In addition, E. coli ATCC 43894 and EPEC O127:H6 clinical isolate were used to (Stx-1 and Stx-2) and (efa1/lifA) genes as control strains, respectively. Escherichia coli isolates were examined for the presence of the eaeA, bfpA, and efa1/lifA virulence genes by PCR. The presence of stx-1 and stx-2 virulence factors were determined by multiplex PCR. PCR reaction contained 2.5 µL 10X PCR buffer, 1 mM mgcl2, 1 mM concentration of each deoxynucleoside triphosphate, 0.5 U of Taq DNA polymerase, 1 µL of primers 10 ng primer/µL, 5 µL of DNA template, and sterile distilled water to a total reaction volume of 25 µL.
Furthermore, a thermal cycler was applied to carry out the amplification conditions (Eppendorf Mastercycler, Germany). Amplification conditions for PCR were as follows: Initial denaturation at 94ºC for 3 minutes; 35 cycles of 94ºC for 45 seconds, annealing at 52 - 60ºC for 45 seconds, extension at 72ºC for 1 minute, and a final extension at 72ºC for 5 minutes. Primer sequences and PCR conditions are listed in Table 1. PCR products were loaded on a 1.5% (w:v) agarose gel with 0.5 μg/mL and visualized using ultraviolet light after staining with ethidium bromide (CinnaGen Co., Tehran, Iran). Samples were classified as containing EPEC in case of being eaeA-positive and stx-negative, and then as t-EPEC (bfp-positive) or a-EPEC (bfp-negative). A-EPEC samples were further classified as efa1/lifA-positive or negative.

3.3. Enteropathogenic Escherichia coli Serogrouping

Serogrouping with polyvalent antisera (Baharafshan Institute of Research and Development, Tehran, Iran) was performed to confirm EPEC strains according to the manufacturer’s instructions. The polyvalent antisera are composed of four separated pool sera, able to react with the following serogroups: polyvalent 1 (O26, O55, and O111), polyvalent 2 (O86 and O127), polyvalent 3 (O44, O125, and O128), and polyvalent 4 (O20 and O114).

3.4. Antibiotic Resistance Profiling of Escherichia coli Strains

In this research, a disk diffusion test was performed to determine the antibiotic resistance/susceptibility profiles of EPEC strains (28). Ten commercial antibiotic discs (Mast Diagnostics, Merseyside, UK) were performed for testing the susceptibility, including Amikacin (AN: 30 µg), Ampicillin (AM: 30 µg), gentamicin (GEN: 30 µg), ceftriaxone (CRO: 30 µg), ceftazidime (CAZ: 30 µg), cefotaxime (CTX: 30 µg), cefoxitin (FOX: 30 µg), imipenem (IPM: 10 µg), meropenem (MEM: 10 µg), ciprofloxacin (CIP: 5 µg), co-trimoxazole (SXT: 25 µg), tetracycline (TE: 30 µg) and colistin (CO, 10 µg). Moreover, the antibiotic susceptibility tests were performed using E. coli ATCC 25922 strain as a control.

3.5. Phenotypic and Genotypic Detection of ESBL Producers

The resistant isolates to at least one of the third-generation cephalosporins (i.e., ceftazidime and cefotaxime) were screened to detect ESBL producers by combined disk test (CDT). In this respect, ESBL was detected by a double-disk-diffusion test using cefotaxime, ceftazidime discs (30 mg) with and without of clavulanic acid (10 mg) according to CLSI (28). Isolates that increased by ≥ 5 mm in the zone diameter in the presence of clavulanate disk was confirmed as ESBL producers. Escherichia coli ATCC25922 and Klebsiella pneumoniae ATCC700603 were used as negative and positive controls for ESBL production, respectively. PCR was performed for the detection of blaCTX-M, blaTEM, and blaPER genes with specific primers as described previously, with the exception of the annealing temperatures (29) (Table 1). In addition, K. pneumonia strain 7881 and P. aeruginosa KOAS strains were used as the positive controls.

3.6. Statistical Analysis

Data were analyzed with SPSS version 16 using the chi-square test. Moreover, a P value of less than 0.05 was considered statistically significant.

4. Results

In the current study, 251 E. coli isolates were identified from children below the age of 10 years with acute diarrhea using culture and biochemical methods. In total, 64.70% of the subjects were male, and the rest (35.30%) were female, which was indicative of the higher number of males in the research. Most EPEC isolates (42.1%) were isolated from patients in spring, followed by summer (26.3%).

4.1. Enteropathogenic Escherichia coli Isolation

The amplified PCR products of EPEC virulence for eaeA and bfpA genes on 1.5% agarose gel are shown in Figure 1. This figure also reflects the multiplex PCR for stx-1 and stx-2 genes. Among the 251 E. coli isolates, 17 (6.78%) were identified as EPEC. All EPEC strains were positive for the eaeA gene and negative for stx-1 and stx-2 genes. In addition, typical EPEC [eaeA + bfpA] and atypical EPEC (eaeA) were found in 6 (35.3%) and 11 (64.7%) of EPEC isolates, respectively. In addition, the efa1/lifA gene was not observed in any of the a-EPEC samples (Data not shown).
PCR amplified products of virulence genes. Lane 1: 100 bp molecular weight marker; lane 2: control positive of <i>eaeA</i> (790bp); lane 3: control negative of <i>eaeA</i>; lane 4, 5, and 6: <i>eaeA</i> positive of clinical isolates; lane 7: control positive of <i>bfpA</i> (326 bp); lane 8: control negative of <i>bfpA</i>; lane 9, 10, 11: <i>bfpA</i> positive of clinical isolates
Figure 1.

PCR amplified products of virulence genes. Lane 1: 100 bp molecular weight marker; lane 2: control positive of eaeA (790bp); lane 3: control negative of eaeA; lane 4, 5, and 6: eaeA positive of clinical isolates; lane 7: control positive of bfpA (326 bp); lane 8: control negative of bfpA; lane 9, 10, 11: bfpA positive of clinical isolates

4.2. Serogrouping

The results of O serogrouping revealed that only 8 (4.7%) isolates of the 251 E. coli isolates were typeable with EPEC polyvalent antisera. These eight isolates belonged to eight serogroups, namely O26, O55, O111 (5 isolates), O44, O125, O128 (2 isolates), and O86, O127 (One isolate).

4.3. Antibiotic Susceptibilities of EPEC Isolates

The antibiotic susceptibility testing results of the confirmed EPEC strains are presented in Table 2. All of the isolates were susceptible to colistin, imipenem, and meropenem. In addition, the highest level resistance in these isolates was found against ampicillin (100%), followed by resistance to ceftriaxone and co-trimoxazole (76.47%). It is notable that children aged ≥ 2 years showed the highest resistance (72%) to tetracycline (P < 0.05), while only 28% of children aged < 2 years were resistant to this antibiotic. Antibiotic resistance patterns of EPEC isolates are shown in Table 3.
Table 2.The Antibiotic Susceptibility Testing Results of Enteropathogenic Escherichia coli Isolates
Antibiotics Resistant (%)Intermediate (%)Sensitive (%)
Amikacin1 (5.88)2 (11.76)14 (82.35)
Ampicillin17 (100)0 (0)0 (0)
Ceftazidime6 (35.29)4 (23.52)7 (41.17)
Cefotaxime11 (64.7)0 (0)6 (35.29)
Cefoxitin4 (23.52)0 (0)13 (76.47)
Ceftriaxone13 (76.47)0 (0)4 (23.52)
Ciprofloxacin6 (35.29)2 (11.76)9 (52.94)
Colistin0 (0)0 (0)17 (100)
Co-trimoxazole13(76.47)0 (0)4 (23.52)
Gentamicin2 (11.76)0 (0)15 (88.23)
Imipenem0 (0)0 (0)17 (100)
Meropenem0 (0)0 (0)17 (100)
Tetracycline6 (35.29)0 (0)11 (64.7)
Table 3.Antibiotic Resistance Phenotypic Profiles of EPEC Isolates
Resistance Pattern Phenotypic ResistanceNumber of Resistant Isolates (%)
1AMP2 (11.7)
2AMP-CRO1 (5.8)
3AMP-TET1 (5.8)
4AMP-FOX-SXT1 (5.8)
5AMP-CRO-SXT-TET1 (5.8)
6AMP-CRO-CTX-GEN1 (5.8)
7AMP-CAZ-CRO-CTX-SXT2 (11.7)
8AMP-CIP-CRO-CTX-SXT1 (5.8)
9AMP-CAZ-CIP-CRO-CTX-SXT1 (5.8)
10AMP-CAZ-CRO-CTX-SXT-TET2 (11.7)
11AMP-CAZ-CRO-CTX-FOX-SXT1 (5.8)
12AMP-AN-CAZ-CIP-CRO-CTX-SXT1 (5.8)
13AMP-CAZ-CIP-CRO-CTX-FOX-SXT-TET2 (11.7)

Abbreviations: AMP, ampicillin; AN, amikacin; CAZ, ceftazidime; CIP, ciprofloxacin; CRO, ceftriaxone; CTX, cefotaxime; EPEC, enteropathogenic Escherichia coli; FOX, cefoxitin; GEN, gentamicin; SXT, co-trimoxazole; TET, tetracycline.

4.4. Phenotypic ESBL Detection

Fourteen isolates resistant to cefotaxime and ceftazidime were assessed using the phenotypic combination disk test (CDT) for evaluation of ESBL production. In total, 13 (76.47%) of these isolates were found to be ESBL producers.

4.5. Detection of β-lactamase Genes

In this research, PCR was performed for all EPEC strains, where 12 (70.58%) out of 17 ESBL producers carried the blaCTX-M gene. Moreover, the rate of the blaTEM gene among these isolates was 10 (58.82%). In the positive isolates for these genes, five typic and seven atypic for the blaCTX-Mgene and five typic and five atypic for blaTEM gene were obtained. Interestingly, 𝑏𝑙𝑎PER genes were not detected in all isolates (Figure 2). According to the results, no significant relationship was observed between the frequencies of typical or atypical EPEC isolates and factors of age, gender, or antimicrobial resistance patterns (except for tetracycline). Moreover, no significant association was found between antibiotic resistance and variables of gender and age. However, children below two years were more susceptible to tetracycline. In total, susceptibility to tetracycline was found in 72% and 28% of children aged below two years and above this age, respectively. All of the children under the age of years were susceptible to this antibiotic, resistance to which was presented in children with mean age above two years (P < 0.05). On the other hand, no significant correlation was detected between drug resistance and the presence of bfpA gene. The detailed characteristics of all EPEC isolates, including typic and atypic EPEC, and phenotypic and genotypic ESBL production are summarized in Table 4.
PCR amplified products of β-lactamase genes in the study. Lane 1: 100 bp molecular weight marker; lane 2, 3, 4, 5, and 6: control positive, control negative, and three clinical isolates of <i>bla</i><sub><i>CTX</i><i>-M</i></sub> (550 bp); lane 7, 8, 9, 10, and 11: control positive, control negative, and three clinical isolates of <i>bla</i><sub><i>TEM</i></sub> (800 bp); lane 12, 13, 14, and 15: control positive, control negative, and two clinical isolates of <i>bla</i><sub><i>PER</i></sub>(925 bp).
Figure 2.

PCR amplified products of β-lactamase genes in the study. Lane 1: 100 bp molecular weight marker; lane 2, 3, 4, 5, and 6: control positive, control negative, and three clinical isolates of blaCTX-M (550 bp); lane 7, 8, 9, 10, and 11: control positive, control negative, and three clinical isolates of blaTEM (800 bp); lane 12, 13, 14, and 15: control positive, control negative, and two clinical isolates of blaPER(925 bp).

Table 4.The Detailed Results Typic/Atypic Isolates, ESBL Phenotype and Genotype Patterns in EPEC Isolates
EPEC No.Typic/Atypic IsolatesESBL PhenotypeESBL Gene Pattern
1AtypicNegNone
2TypicPosTEM, CTX-M
3AtypicPosTEM, CTX-M
4AtypicPosCTX-M
5AtypicPosCTX-M
6AtypicPosTEM
7AtypicNegNone
8AtypicPosTEM, CTX-M
9AtypicPosTEM, CTX-M
10TypicNegNone
11AtypicPosCTX-M
12AtypicNegCTX-M
13TypicPosTEM, CTX-M
14TypicPosTEM, CTX-M
15TypicPosTEM, CTX-M
16AtypicPosTEM
17TypicPosTEM, CTX-M

Abbreviations: EPEC, enteropathogenic Escherichia coli; ESBL, extended-spectrum β-lactamase

5. Discussion

According to the literature, EPEC is a significant cause of acute diarrhea, especially in developing countries. Owing to their high prevalence of this type of E. coli in both community and hospital settings, it is responsible for approximately 11% of all diarrhea mortalities in children aged below five years in the world (1, 2). Moreover, severe malabsorption of nutrients might be caused by EPEC, helping the nutritional aggravation and the persistence of diarrhea (5). In the present study, the results of PCR detection of eaeA gene were indicative of 6.78% frequency of EPEC in the E. coli isolates, which was higher, compared to the prevalence rate mentioned in two reports by Nakhjavani (5.6%), Asadi Karam (5.3%) and lower than report by Moshtagian (21.5%) in Iran (30-32), and also higher from some neighboring countries, including Iraq (3.4%) and Turkey (2.05%) (33, 34). This rate was also lower, compared to the reports from Kuwait (8.4%) and Pakistan (35, 36). The results of previous studies propose that differences in the type of samples, method for sampling, geographical area, antibiotic prescription are important criteria in epidemiology in children with diarrhea, which leads to different data between these investigations (37).
The presence of stx and/or eaeA genes can distinguish Shiga toxin-producing E. coli strains (STEC) from EPEC strains (38). Similar to numerous studies (33, 39), none of the E. coli isolates were positive for the stx gene in the present study, which resulted in a lack of their characterization as STEC. In clinical laboratories, serogrouping with O-type antisera is still a useful diagnostic method to determine a limited number of EPEC serogroups (40). In the current study, nearly half of EPEC strains were not typeable with diagnostic antisera and often belonged to the atypical group. In this regard, our findings are consistent with other studies (41), which demonstrated that serogrouping is a tedious, laborious, and time-consuming process and fails to identify some of the EPEC strains. Therefore, PCR methods can be a reliable, fast, and sensitive alternative applied to identify the EPEC strains that belong to serogroups not detected by commercially available antisera (39, 40).
Moreover, our findings revealed the role of EPEC strains, which belong to serogroups O26, 055, and O111, in the majority of EPEC diarrhea in the southwest of Iran, Ahvaz. In accordance with the present study, O55, O111, and O26 serogroups were responsible for 54.5% of diarrhea in children of Iraq (33). Meanwhile, the most prevalent serogroups in Iran are O127 and O128, respectively (26, 41). Depending on the presence or absence of the EPEC adherence factor plasmid (pEAF), EPEC may be subdivided into typical (tEPEC; eaeA+ and bfpA+) or atypical (aEPEC; eaeA+ bfpA–) EPEC (12). In the current research, approximately 65% of the 17 tested EPEC isolates were subdivided as atypical EPEC strains. These findings are in congruence with other reports, indicating the high prevalence of EPEC strains among young children in developing countries (5, 42, 43).
The exact mechanisms of aEPEC-induced diarrhea are still not completely understood (43, 44). Recently, Afset et al. detected a significant association between the prevalence of diarrhea and the presence of the O island 122 (OI-122), including efa1/lifA and several other genes (45). Moreover, there is the possibility of a correlation between the pathogenesis of aEPEC and its serogroups. In the present study, efa1/lifA genes were found in none of the aEPEC serogroups. In this respect, our findings are in line with the idea that EPEC strains from different serogroups may contain various pathogenic genes. EPEC diarrhea is often mild and self-limiting and effectively treated with oral rehydration therapy. Meanwhile, persistent infections may require the use of antimicrobial treatment (4, 20).
In the current study, antibiotic susceptibility testing was performed on the EPEC isolates. According to the results, the highest resistance rates were related to ampicillin (100%), ceftriaxone (76.5%), cotrimoxazole (70.6%), cefotaxime (64.7), and ceftazidime (52.9%), respectively. However, all EPEC isolates were sensitive to colistin, meropenem, and imipenem. Several studies have reported various levels of antibiotic resistance in EPEC isolates from developed and developing countries. Diversity in the time and region of these investigations might have led to these conflicting results. Compared to the present research, previous studies in Iran have reported a low prevalence of resistance to ampicillin, cotrimoxazole, cefotaxime, and ceftazidime (30, 41). In a study in India, a lower percentage of drug resistance to cotrimoxazole (35.49%), ceftriaxone (32.20%), and ciprofloxacin (25.42%) was described. In addition, while resistant to meropenem was reported at (25.42%), all EPEC isolates were susceptible to imipenem, which is in congruence with our findings (42). In Iraq, the high prevalence of resistance was related to ampicillin (97.4%), cotrimoxazole (82%), cefotaxime (89.7%), and ceftazidime (79.5%) (46).
Resistance to carbapenems is of significant importance in the treatment of patients infected with gram-negative bacteria. The carbapenemase enzymes can cause pan-drug resistant (PDR) strains since they regularly transport on plasmids in combination with other resistance genes, especially ESBL genes. According to the results of the present research, EPEC strains are highly susceptible to carbapenem antibiotics and have not yet gained the carbapenemase genes. Therefore, the clinicians should consider this issue in prescribing antibiotics to patients in this area. Conflicting reports have been reported by researchers in Iran, including Memariani et al., who showed a lack of ability to achieve any resistance to imipenem. On the other hand, Nakhjavani et al. marked that resistance to imipenem in the EPEC strain was 26% (30, 41). In a study in India, the prevalence of imipenem and meropenem resistance was 15% and 2.5%, respectively (47). Moreover, no resistance to imipenem was reported in Kuwait (38).
In susceptibility tests, multidrug-resistant strain (MDR) is used for isolates with resistance to three or more antibiotics. A total of 13 (76.47%) EPEC isolates were MDR, 53.3% of which were atypical, and 33.3% were typical strains. Some studies have reported fewer number of these strains. For instance, 45.83% of MDR strains were reported in India (47). A combined disk test (CDT) is performed for all the strains that are resistant to cephalosporine antibiotics, such as cefotaxime, ceftazidime, cepdotoxime, and ceftriaxone. Among these strains, a positive result was obtained in 13 (76.47%) of EPEC strains by CDT in the current investigation. Among the evaluated ESBL producer isolates, the prevalence of blaCTX-M and blaTEM was 12 (70.5%) and 10 (58.8%) in genotypic detection of beta-lactamase genes, respectively. Another research reported 21% ESBL-positive by CDT, 88.8% blaCTX-M, and 19% blaTEM found in these strains by genotypic test in Iran (41). Other data have revealed 45.83% positive isolates in CDT test. Moreover, blaTEM and blaCTX-M were displayed in 35.5% and 19.5% of EPEC isolates from India (47). In the case of phenotypic and genotypic ESBL tests, few studies have been carried out, yielding conflicting results.

5.1. Conclusions

In the current study, EPEC isolates had high resistance to third-generation cephalosporins and fluoroquinolones. Carbapenems are highly effective drugs for the treatment of such infections. The importance of MDR strains-producing β-lactamase enzymes is high-level drug resistance to main antibiotics, such as third-generation cephalosporins, fluoroquinolones. Regarding the frequency of β-lactamase genes in EPEC strains, treatment of these multidrug-resistant organisms remains a scientific concern; therefore, it is recommended that a sufficient amount of antibiotics should be carefully prescribed for the treatment of these bacteria.

Acknowledgments

Footnotes

References

  • 1.
    World Health Organization. Diarrhoeal disease. 2016, [cited Sept 28, 2016]. Available from: http://www.who.int/mediacentre/factsheets/fs330/en/.
  • 2.
    Lanata CF, Fischer-Walker CL, Olascoaga AC, Torres CX, Aryee MJ, Black RE, et al. Global causes of diarrheal disease mortality in children <5 years of age: a systematic review. PLoS One. 2013;8(9). e72788. [PubMed ID: 24023773]. [PubMed Central ID: PMC3762858]. https://doi.org/10.1371/journal.pone.0072788.
  • 3.
    Passariello A, Terrin G, Baldassarre ME, De Curtis M, Paludetto R, Berni Canani R. Diarrhea in neonatal intensive care unit. World J Gastroenterol. 2010;16(21):2664-8. [PubMed ID: 20518089]. [PubMed Central ID: PMC2880780]. https://doi.org/10.3748/wjg.v16.i21.2664.
  • 4.
    Pawlowski SW, Warren CA, Guerrant R. Diagnosis and treatment of acute or persistent diarrhea. Gastroenterology. 2009;136(6):1874-86. [PubMed ID: 19457416]. [PubMed Central ID: PMC2723735]. https://doi.org/10.1053/j.gastro.2009.02.072.
  • 5.
    Hu J, Torres AG. Enteropathogenic Escherichia coli: foe or innocent bystander? Clin Microbiol Infect. 2015;21(8):729-34. [PubMed ID: 25726041]. [PubMed Central ID: PMC4497942]. https://doi.org/10.1016/j.cmi.2015.01.015.
  • 6.
    Abba K, Sinfield R, Hart CA, Garner P. Pathogens associated with persistent diarrhoea in children in low and middle income countries: systematic review. BMC Infect Dis. 2009;9:88. [PubMed ID: 19515227]. [PubMed Central ID: PMC2709113]. https://doi.org/10.1186/1471-2334-9-88.
  • 7.
    Lai Y, Rosenshine I, Leong JM, Frankel G. Intimate host attachment: enteropathogenic and enterohaemorrhagic Escherichia coli. Cell Microbiol. 2013;15(11):1796-808. [PubMed ID: 23927593]. [PubMed Central ID: PMC4036124]. https://doi.org/10.1111/cmi.12179.
  • 8.
    Franzin FM, Sircili MP. Locus of enterocyte effacement: a pathogenicity island involved in the virulence of enteropathogenic and enterohemorragic Escherichia coli subjected to a complex network of gene regulation. Biomed Res Int. 2015;2015:534738. [PubMed ID: 25710006]. [PubMed Central ID: PMC4332760]. https://doi.org/10.1155/2015/534738.
  • 9.
    Cepeda-Molero M, Berger CN, Walsham ADS, Ellis SJ, Wemyss-Holden S, Schuller S, et al. Attaching and effacing (A/E) lesion formation by enteropathogenic E. coli on human intestinal mucosa is dependent on non-LEE effectors. PLoS Pathog. 2017;13(10). e1006706. [PubMed ID: 29084270]. [PubMed Central ID: PMC5685641]. https://doi.org/10.1371/journal.ppat.1006706.
  • 10.
    Teixeira NB, Rojas TC, da Silveira WD, Matheus-Guimaraes C, Silva NP, Scaletsky IC. Genetic analysis of enteropathogenic Escherichia coli (EPEC) adherence factor (EAF) plasmid reveals a new deletion within the EAF probe sequence among O119 typical EPEC strains. BMC Microbiol. 2015;15:200. [PubMed ID: 26438110]. [PubMed Central ID: PMC4594896]. https://doi.org/10.1186/s12866-015-0539-9.
  • 11.
    Abreu AG, Bueris V, Porangaba TM, Sircili MP, Navarro-Garcia F, Elias WP. Autotransporter protein-encoding genes of diarrheagenic Escherichia coli are found in both typical and atypical enteropathogenic E. coli strains. Appl Environ Microbiol. 2013;79(1):411-4. [PubMed ID: 23104414]. [PubMed Central ID: PMC3536084]. https://doi.org/10.1128/AEM.02635-12.
  • 12.
    Botkin DJ, Galli L, Sankarapani V, Soler M, Rivas M, Torres AG. Development of a multiplex PCR assay for detection of Shiga toxin-producing Escherichia coli, enterohemorrhagic E. coli, and enteropathogenic E. coli strains. Front Cell Infect Microbiol. 2012;2:8. [PubMed ID: 22919600]. [PubMed Central ID: PMC3417533]. https://doi.org/10.3389/fcimb.2012.00008.
  • 13.
    Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013;26(4):822-80. [PubMed ID: 24092857]. [PubMed Central ID: PMC3811233]. https://doi.org/10.1128/CMR.00022-13.
  • 14.
    Behiry IK, Abada EA, Ahmed EA, Labeeb RS. Enteropathogenic Escherichia coli associated with diarrhea in children in Cairo, Egypt. ScientificWorldJournal. 2011;11:2613-9. [PubMed ID: 22262949]. [PubMed Central ID: PMC3254012]. https://doi.org/10.1100/2011/485381.
  • 15.
    Vieira MA, Salvador FA, Silva RM, Irino K, Vaz TM, Rockstroh AC, et al. Prevalence and characteristics of the O122 pathogenicity island in typical and atypical enteropathogenic Escherichia coli strains. J Clin Microbiol. 2010;48(4):1452-5. [PubMed ID: 20181917]. [PubMed Central ID: PMC2849565]. https://doi.org/10.1128/JCM.01944-09.
  • 16.
    Mercado EH, Piscoche C, Contreras C, Durand D, Riveros M, Ruiz J, et al. Pathogenicity Island O-122 in enteropathogenic Escherichia coli strains is associated with diarrhea severity in children from Lima Peru. Int J Med Microbiol. 2016;306(4):231-6. [PubMed ID: 27236730]. [PubMed Central ID: PMC4900456]. https://doi.org/10.1016/j.ijmm.2016.05.005.
  • 17.
    Xu Y, Bai X, Jin Y, Hu B, Wang H, Sun H, et al. High Prevalence of virulence genes in specific genotypes of atypical enteropathogenic Escherichia coli. Front Cell Infect Microbiol. 2017;7. https://doi.org/10.3389/fcimb.2017.00109.
  • 18.
    Deacon V, Dziva F, van Diemen PM, Frankel G, Stevens MP. Efa-1/LifA mediates intestinal colonization of calves by enterohaemorrhagic Escherichia coli O26 : H- in a manner independent of glycosyltransferase and cysteine protease motifs or effects on type III secretion. Microbiology (Reading). 2010;156(Pt 8):2527-36. [PubMed ID: 20466763]. https://doi.org/10.1099/mic.0.039685-0.
  • 19.
    Cassady-Cain RL, Blackburn EA, Alsarraf H, Dedic E, Bease AG, Bottcher B, et al. Biophysical characterization and activity of lymphostatin, a multifunctional virulence factor of attaching and effacing Escherichia coli. J Biol Chem. 2016;291(11):5803-16. [PubMed ID: 26786100]. [PubMed Central ID: PMC4786716]. https://doi.org/10.1074/jbc.M115.709600.
  • 20.
    Ochoa TJ, Contreras CA. Enteropathogenic Escherichia coli infection in children. Curr Opin Infect Dis. 2011;24(5):478-83. [PubMed ID: 21857511]. [PubMed Central ID: PMC3277943]. https://doi.org/10.1097/QCO.0b013e32834a8b8b.
  • 21.
    Flokas ME, Karanika S, Alevizakos M, Mylonakis E. Prevalence of ESBL producing Enterobacteriaceae in pediatric bloodstream infections: a systematic review and meta-analysis. PLoS One. 2017;12(1). e0171216. [PubMed ID: 28141845]. [PubMed Central ID: PMC5283749]. https://doi.org/10.1371/journal.pone.0171216.
  • 22.
    Xu Y, Sun H, Bai X, Fu S, Fan R, Xiong Y. Occurrence of multidrug-resistant and ESBL-producing atypical enteropathogenic Escherichia coli in China. Gut Pathog. 2018;10:8. [PubMed ID: 30038667]. [PubMed Central ID: PMC6054294]. https://doi.org/10.1186/s13099-018-0234-0.
  • 23.
    Mahon CL, Manuselis G. Textbook of Diagnostic microbiology M. 5th ed. Pennsylvania: Elsevier Mosby; 2015. p. 484-5.
  • 24.
    Nobari S, Shahcheraghi F, Rahmati Ghezelgeh F, Valizadeh B. Molecular characterization of carbapenem-resistant strains of Klebsiella pneumoniae isolated from Iranian patients: first identification of blaKPC gene in Iran. Microb Drug Resist. 2014;20(4):285-93. [PubMed ID: 24428238]. https://doi.org/10.1089/mdr.2013.0074.
  • 25.
    Dashti AA, Jadaon MM, Abdulsamad AM, Dashti HM. Heat treatment of bacteria: a simple method of DNA extraction for molecular techniques. Kuwait Med J. 2009;41(2):117-22.
  • 26.
    Alikhani MY, Mirsalehian A, Aslani MM. Detection of typical and atypical enteropathogenic Escherichia coli (EPEC) in Iranian children with and without diarrhoea. J Med Microbiol. 2006;55(Pt 9):1159-63. [PubMed ID: 16914644]. https://doi.org/10.1099/jmm.0.46539-0.
  • 27.
    Holland JL, Louie L, Simor AE, Louie M. PCR detection of Escherichia coli O157:H7 directly from stools: evaluation of commercial extraction methods for purifying fecal DNA. J Clin Microbiol. 2000;38(11):4108-13. [PubMed ID: 11060076]. [PubMed Central ID: PMC87549]. https://doi.org/10.1128/JCM.38.11.4108-4113.2000.
  • 28.
    P W. Performance Standards for Antimicrobial Susceptibility Testing. Clinical and Laboratory Standards Institute (CLSI); 2016.
  • 29.
    Shahcheraghi F, Nobari S, Rahmati Ghezelgeh F, Nasiri S, Owlia P, Nikbin VS, et al. First report of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Iran. Microb Drug Resist. 2013;19(1):30-6. [PubMed ID: 22984942]. https://doi.org/10.1089/mdr.2012.0078.
  • 30.
    Nakhjavani FA, Emaneini M, Hosseini H, Iman-Eini H, Aligholi M, Jabalameli F, et al. Molecular analysis of typical and atypical enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea. J Med Microbiol. 2013;62(Pt 2):191-5. [PubMed ID: 23065543]. https://doi.org/10.1099/jmm.0.046516-0.
  • 31.
    Asadi Karam M, Bouzari S, Oloomi M, Aslani M, Jafari A. Phenotypic and genotypic characterization of Enteropathogenic Escherichia coli (EPEC) strains in Tehran, Iran. Iran J Microbiol. 2010;2(1):3-7. [PubMed ID: 22347543]. [PubMed Central ID: PMC3279762].
  • 32.
    Moshtagian F, Alipour M, Yahyapour Y. Prevalence of Escherichia coli Pathotypes Among Children With Diarrhea in Babol, Northern Iran. Int J Enteric Pathog. 2016;4(3):1-36326. https://doi.org/10.15171/ijep.2016.01.
  • 33.
    Al Hilali SA, Almohana AM. Occurrence and molecular characterization of enteropathogenic Escherichia coli serotypes isolated from children with diarrhoea in Najaf, Iraq. Indian J Med Microbiol. 2011;29(4):383-8. [PubMed ID: 22120799]. https://doi.org/10.4103/0255-0857.90171.
  • 34.
    Bozcal E, Yigitturk G, Uzel A, Aydemir SS. Investigation of enteropathogenic Escherichia coli and Shiga toxin-producingEscherichia coli associated with hemolytic uremic syndrome in Izmir Province, Turkey. Turk J Med Sci. 2016;46(3):733-41. [PubMed ID: 27513249]. https://doi.org/10.3906/sag-1501-60.
  • 35.
    Albert MJ, Rotimi VO, Dhar R, Silpikurian S, Pacsa AS, Molla AM, et al. Diarrhoeagenic Escherichia coli are not a significant cause of diarrhoea in hospitalised children in Kuwait. BMC Microbiol. 2009;9:62. [PubMed ID: 19331674]. [PubMed Central ID: PMC2678128]. https://doi.org/10.1186/1471-2180-9-62.
  • 36.
    Bokhari H, Shah MA, Asad S, Akhtar S, Akram M, Wren BW. Escherichia coli pathotypes in Pakistan from consecutive floods in 2010 and 2011. Am J Trop Med Hyg. 2013;88(3):519-25. [PubMed ID: 23358642]. [PubMed Central ID: PMC3592535]. https://doi.org/10.4269/ajtmh.12-0365.
  • 37.
    Momtaz H, Dehkordi FS, Hosseini MJ, Sarshar M, Heidari M. Serogroups, virulence genes and antibiotic resistance in Shiga toxin-producing Escherichia coli isolated from diarrheic and non-diarrheic pediatric patients in Iran. Gut Pathog. 2013;5(1):39. [PubMed ID: 24330673]. [PubMed Central ID: PMC3866933]. https://doi.org/10.1186/1757-4749-5-39.
  • 38.
    Abbasi P, Kargar M, Doosti A, Mardaneh J, Ghorbani-Dalini S, Dehyadegari MA. Characterization of Shiga-toxin producing E.coli (STEC) and enteropathogenic E.coli (EPEC) using multiplex Real-Time PCR assays for stx1 , stx2 , eaeA. Iran J Microbiol. 2014;6(3):169-74. [PubMed ID: 25870750]. [PubMed Central ID: PMC4393493].
  • 39.
    Slinger R, Lau K, Slinger M, Moldovan I, Chan F. Higher atypical enteropathogenic Escherichia coli (a-EPEC) bacterial loads in children with diarrhea are associated with PCR detection of the EHEC factor for adherence 1/lymphocyte inhibitory factor A (efa1/lifa) gene. Ann Clin Microbiol Antimicrob. 2017;16(1):16. [PubMed ID: 28330478]. [PubMed Central ID: PMC5363046]. https://doi.org/10.1186/s12941-017-0188-y.
  • 40.
    Bouzari S, Aslani MM, Oloomi M, Jafari A, Dashti A. Comparison of multiplex PCR with serogrouping and PCR-RFLP of fliC gene for the detection of enteropathogenic Escherichia coli (EPEC). Braz J Infect Dis. 2011;15(4):365-9. [PubMed ID: 21861008]. https://doi.org/10.1016/s1413-8670(11)70206-9.
  • 41.
    Memariani M, Najar Peerayeh S, Zahraei Salehi T, Shokouhi Mostafavi SK. Occurrence of SHV, TEM and CTX-M beta-lactamase genes among enteropathogenic Escherichia coli strains isolated from children with diarrhea. Jundishapur J Microbiol. 2015;8(4). e15620. [PubMed ID: 26034531]. [PubMed Central ID: PMC4449847]. https://doi.org/10.5812/jjm.8(4)2015.15620.
  • 42.
    Malvi S, Appannanavar S, Mohan B, Kaur H, Gautam N, Bharti B, et al. Comparative analysis of virulence determinants, antibiotic susceptibility patterns and serogrouping of atypical enteropathogenic Escherichia coli versus typical enteropathogenic E. coli in India. J Med Microbiol. 2015;64(10):1208-15. [PubMed ID: 26233663]. https://doi.org/10.1099/jmm.0.000131.
  • 43.
    Ifeanyi CIC, Ikeneche NF, Bassey BE, Morabito S, Graziani C, Caprioli A. Molecular and phenotypic typing of enteropathogenic Escherichia coli isolated in childhood acute diarrhea in Abuja, Nigeria. J Infect Dev Ctries. 2017;11(7):527-35. [PubMed ID: 31071061]. https://doi.org/10.3855/jidc.9338.
  • 44.
    Srikhanta YN, Hocking DM, Wakefield MJ, Higginson E, Robins-Browne RM, Yang J, et al. Control of bacterial virulence by the RalR regulator of the rabbit-specific enteropathogenic Escherichia coli strain E22. Infect Immun. 2013;81(11):4232-43. [PubMed ID: 24002063]. [PubMed Central ID: PMC3811808]. https://doi.org/10.1128/IAI.00710-13.
  • 45.
    Afset JE, Bruant G, Brousseau R, Harel J, Anderssen E, Bevanger L, et al. Identification of virulence genes linked with diarrhea due to atypical enteropathogenic Escherichia coli by DNA microarray analysis and PCR. J Clin Microbiol. 2006;44(10):3703-11. [PubMed ID: 17021100]. [PubMed Central ID: PMC1594803]. https://doi.org/10.1128/JCM.00429-06.
  • 46.
    Al-Dahmoshi HOM, Al-Yassari AKSS, Al-Saad NFN, Al-Dabagh NN, Al-Khafaji NSK, Mahdi RK, et al. Occurrence of AmpC, MBL, CRE and ESBLs among diarrheagenic Escherichia coli recovered from Infantile Diarrhea, Iraq. J Pharm Biomed Sci. 2015;5(3):189-95.
  • 47.
    Singh T, Das S, Ramachandran VG, Wani S, Shah D, Maroof KA, et al. Distribution of integrons and phylogenetic groups among enteropathogenic Escherichia coli isolates from children < 5 years of age in Delhi, India. Front Microbiol. 2017;8. https://doi.org/10.3389/fmicb.2017.00561.

Similar Articles

12
Mar
2018
Antimicrobial Susceptibility Patterns of Enteroaggregative <i>E. coli</i>, as the Most Common Diarrheagenic <i>E. coli</i>, Associated to Gastroenteritis Outbreaks in Iran

Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran

Mohammad Mehdi Soltan-Dallal,
Mohsen Karami-Talab,
Maneli Aminshahidi,
Amir Arastehfar,
Fereshteh Fani

Soltan-Dallal MM, Karami-Talab M, Aminshahidi M, Arastehfar A, Fani F. Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran. Arch Pediatr Infect Dis. 2018;6(2):e11917. doi: https://doi.org/10.5812/pedinfect.11917

18
Apr
2015

Occurrence of SHV, TEM and CTX-M β-Lactamase Genes Among Enteropathogenic Escherichia coli Strains Isolated From Children With Diarrhea

Mojtaba Memariani,
Shahin Najar Peerayeh,
Taghi Zahraei Salehi,
Seyyed Khalil Shokouhi Mostafavi

Memariani M, Najar Peerayeh S, Zahraei Salehi T, Shokouhi Mostafavi SK. Occurrence of SHV, TEM and CTX-M β-Lactamase Genes Among Enteropathogenic Escherichia coli Strains Isolated From Children With Diarrhea. Jundishapur J Microbiol. 2015;8(4):e15620. doi: https://doi.org/10.5812/jjm.8(4)2015.15620

17
Dec
2024
Jundishapur J Microbiol

The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran

Saba Farhadinia,
Shahin Najarpiraye,
Bita Bakhshi

Farhadinia S, Najarpiraye S, Bakhshi B. The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran. Jundishapur J Microbiol. 2024;17(12):e151793. doi: https://doi.org/10.5812/jjm-151793

18
Jul
2016

Characterization of Enteropathogenic Escherichia coli Associated with Diarrhea Among Iranian Infants

Mohammad Mohammadzadeh,
Hossein Goudarzi,
Hossein Dabiri,
Fatemeh Fallah

Mohammadzadeh M, Goudarzi H, Dabiri H, Fallah F. Characterization of Enteropathogenic Escherichia coli Associated with Diarrhea Among Iranian Infants. Arch Pediatr Infect Dis. 2017;5(1):e36920. doi: https://doi.org/10.5812/pedinfect.36920

31
Jan
2011

Frequency, antimicrobial susceptibility and plasmid profiles of Escherichia coli pathotypes obtained from children with acute diarrhea

Enayat Kalantar,
Fariborz Soheili,
Heiman Salimi,
Mohammad Mehdi Soltan Dallal

Kalantar E, Soheili F, Salimi H, Soltan Dallal MM. Frequency, antimicrobial susceptibility and plasmid profiles of Escherichia coli pathotypes obtained from children with acute diarrhea. Jundishapur J Microbiol. 2011;4(1):. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles