Detection of Noroviruses Isolated From Children With Acute Gastroenteritis by Rt-PCR in Iran

Author(s):
Sara Rahmati RoodsariSara Rahmati Roodsari1, Fatemeh BitajianFatemeh Bitajian2, Latif GachkarLatif Gachkar1, Farzaneh JadaliFarzaneh Jadali3, Saadat AdabianSaadat Adabian3, Raheleh Sadat Sajadi NiaRaheleh Sadat Sajadi Nia4, Saeid MahamSaeid Maham3,*
1Infectious Diseases and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2Semiology Departement, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
3Pediatric Infections Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
4Medical University, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran

Archives of Pediatric Infectious Diseases:Vol. 1, issue 2; 57-60
Published online:Jul 15, 2013
Article type:Research Article
Received:Aug 08, 2012
Accepted:Dec 29, 2012
How to Cite:Roodsari SR, Bitajian F, Gachkar L, Jadali F, Adabian S, et al. Detection of Noroviruses Isolated From Children With Acute Gastroenteritis by Rt-PCR in Iran. Arch Pediatr Infect Dis. 2013;1(2):57-60. doi: https://doi.org/10.5812/pedinfect.7619

Abstract

Background:

Noroviruses are one of the major viral pathogens responsible for gastroenteritis. Outbreaks of diarrhea due to Norovirus have been reported frequently. This study is performed to determine the prevalence of Norovirus in fecal specimens of children with gastroenteritis. Many viruses can cause gastroenteritis, including Rotaviruses; Adenoviruses types 40 and 41; Sapoviruses; and Noroviruses. Current techniques used for detection of Noroviruses in stool samples include multi-step viral RNA extraction and purification followed by reverse transcriptase-polymerase chain reaction (Rt-PCR).

Objectives:

The purpose of this study is to detect Norovirus in stool samples by Rt-PCR in 5 different centers in Iran.

Patients and Methods:

In this study, 2,170 stool samples were collected from children less than five years old from five different cities, all of whom had acute gastroenteritis. Detection of Noroviruses was performed through Rt-PCR. The mean age of the studied population was 48 months. Fecal specimens were collected within 24 hours of admission. The specimens were frozen, sent to the laboratory, and then stored at -70° C until being tested for Norovirus.

Results:

Rt-PCR was performed for 2,170 stool samples containing 90 (4.14%) Norovirus positive (0.97% Tehran, 0.64% Tabriz, 0.18% Mashhad, 1.57% Shiraz, 0.78% Bandar Abbas). The RT-PCR was validated with published primers for Norovirus (JV12/JV13). In both retrospective and prospective settings, the Rt-PCR was equally sensitive (95%) and specific (95%) in detecting Norovirus.

Conclusions:

Noroviruses, which are important human pathogens, may cause epidemic acute viral gastroenteritis which in turn can be easily detected by molecular methods.

1. Background

Acute gastroenteritis is an important cause of childhood morbidity and mortality, especially in children under 5 years old. Recently, it has been estimated that in developing countries, there are 450 million cases of diarrhea in children less than 5 years old annually and that 1-4% of them may die consequently. According to centers for disease control and prevention reports, Norovirus causes 23 million cases of acute gastroenteritis worldwide a year in all age groups (1). Norovirus can cause diarrhea in both adults and children (2). Noroviruses are most frequently recognized as a cause of gastrointestinal inflammation and causes more than 50% of all food borne disease in the US (3).
Among the viral infectious agents of acute gastroenteritis, Rotavirus, human Calicivirus, Astrovirus, and Adenovirus have been characterized (4, 5). The norwalk-like and sapporo-like viruses are recently renamed Norovirus and Sapoviruses, respectively. Norovirus is the one of the important triggers of febrile seizures (6). They are further divided into genogroups I and II, and which are responsible for approximately 179 million cases of acute gastroenteritis that occurs annually in the US (7). There are different methods to detect Norovirus such as ELISA (8), Real-Time (9), Rt-PCR (10), and cell culture (11). According to the varied etiology of Norovirus, they can be diagnosed by variety of diagnostic methods. In a study in Japan, the detection method of ELISA-kit is compared with RT-PCR . The ELISA method had a sensitivity of 76.3% and specificity of 94.9%. However because of the kit sensitivity to most Norovirus genotypes, it needs to be improved (8). In addition, according to a study on children under 12 years old with gastroenteritis during a 4 year period in Tunisia, it was shown that 64.8% were affected by Norovirus gastroenteritis (11).

2. Objectives

Considering the comparison of Norovirus diagnostic methods in different studies, we studied the prevalence of Norovirus which causes gastroenteritis in children under 5 years old suffering from diarrhea in 5 different cities of Iran by Rt-PCR in order to detect the number of positive samples.

3. Patients and Methods

In this study, 2170 samples of children with acute gastroenteritis, who were admitted to the pediatric hospitals in 5 cities of Iran (Tehran, Mashhad, Tabriz, Shiraz, Bandar Abbas) were collected. Written informed consent was obtained from all patients.
Fecal specimens were collected within 24 hours of admission. The specimens were frozen, sent to the laboratory, and subsequently stored at -70° C until Norovirus testing. Viral RNA was extracted from 30% stool suspensions in physiologic serum, then centrifuged at 6000 rpm for 20 minutes and filtered by 0.2 μm filter. Then 140 μL of the filtered samples was transferred to micro tubes and extracted by QIAamp viral RNA extraction mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The extracted samples were then stored at -20° C for a short time and further studied using Rt-PCR.
The cDNA synthesis was carried out using Rt-premix kit (Bioneer, U.S.A). The PCR products were analyzed by electrophoresis on a 1% agarose gel and visualized with UV light. TBE buffer was used as the electrophoresis gel (12). The PCR products obtained using the primer set JV12/ JV13 was 326 bp. The primer pair sequences used in the study has been shown in Table 1.
Table 1The Primer Pair Sequences Used in This Study
Primer Gene Location Polarity Sequence (5'-3')
JV 12 RdRp 4277–4297 + AATACCACTATGAT GCAGATTA
JV 13 RdRp 4583–4603 − T TCATCATCACCATAGAAAGAG

Abbreviation: RdRp, RNA-dependent RNA polymerase

4. Results

Detection of Norovirus in 2,170 stool samples was done using Rt-PCR which was authenticated with approved primers for Norovirus (JV12/JV13). The prevalence of Norovirus in 5 large cities of Iran was reported to be 4.14%. There was no significant relationship between the patients` age and their Norovirus-caused gastroenteritis (P value < 0.05). The prevalence of Norovirus in different cities is studied and is shown in Table 2. Gel electrophoresis results are shown in Figure 1.
Table 2Prevalence of Norovirus in the Different Cities of Iran
CitySamples PositiveNo. (%)
Tehran57021 (0.97)
Tabriz36014 (0.64)
Mashad2404 (0.18)
Shiraz69034 (1.50)
Bandarabbas31017 (0.78)
Total217090 (4.14)
PCR Products on Gel Electrophoresis (326 bp)
Figure 1

PCR Products on Gel Electrophoresis (326 bp)

5. Discussion

Noroviruses are one of the most important causes of acute non-bacterial gastroenteritis in children (1). This virus can be spread easily; however, there have been no reports of Norovirus prevalence in Iran during the last two decadesIn this study, Norovirus was responsible for 4.14% of all acute gastroenteritises and the prevalence rate varied in the 5 different cities. In another study in Iran by Romani et al. in which 4 of 93 (4.5%) samples were positive for Norovirus, 67 samples (61%) had been collected from inpatients and 26 (39%) from outpatients, all the positive samples belonged to the outpatients (13). In this study water resources for the patients were surveyed but no relationship between water and Norovirus infection was established. In countries with different dietary patterns, these statistics pattern may have some modifications. Norovirus outbreaks are reported to be 17.9% in Switzerland (14), 12% in Nicaragua (15), 21.9% in Taiwan (16), 9.9% in Pakistan (17), 11.9% in India (18), 48.4% in Italy (19), and 12% in Brazil (20). This virus causes about 40% to 50% of food-related diseases in the US (21). The high prevalence of gastroenteritis caused by Norovirus in these countries can be due to various factors different from the middle east. For example, the consumption of raw marine products such as oysters is one of the main causes of Norovirus spread in developed countries (22); however, this dietary pattern is rare in middle eastern countries (including Iran) (13). Therefore, the prevalence of Norovirus in these countries is less. Norovirus gastroenteritis is seen in all age groups and therefore there are not any age limitations for contracting of the virus (12). Although the risk of Norovirus gastroenteritis is all year-round, nevertheless the peak of Norovirus infection is in cold seasons (23) therefore this disease is frequently referred to as cold season diarrhea (24). Since Norovirus is an RNA virus, RNA instability in high temperatures can cause more outbreaks in the second half of the year. In this study, the relation between geographic distribution and Norovirus infection was also considered.
It was shown that patients referred to Shiraz hospital had a higher percentage of Norovirus infection and which would indicate a need to do a survey of Norovirus outbreak in this area.
To sum up, Norovirus should be considered as one of the prevalent causes of acute gastroenteritis in children less than 5 years of age in Iran as well as many other countries, however comprehensive research is needed to estimate the exact number of infected children using accurate molecular methods.

Acknowledgments

Footnotes

References

  • 1.
    Giordano MO, Ferreyra LJ, Isa MB, Martinez LC, Yudowsky SI, Nates SV. The epidemiology of acute viral gastroenteritis in hospitalized children in Cordoba City, Argentina: an insight of disease burden. Rev Inst Med Trop Sao Paulo. 2001;43(4):193-7. [PubMed ID: 11557997]. https://doi.org/10.1590/S0036-46652001000400003.
  • 2.
    Nordgren J. Norovirus Epidemiology: Prevalence, transmission, and determinants of disease susceptibility. 2009.
  • 3.
    Widdowson MA, Sulka A, Bulens SN, Beard RS, Chaves SS, Hammond R, et al. Norovirus and foodborne disease, United States, 1991-2000. Emerg Infect Dis. 2005;11(1):95-102. [PubMed ID: 15705329]. https://doi.org/10.3201/eid1101.040426.
  • 4.
    Basu G, Rossouw J, Sebunya TK, Gashe BA, de Beer M, Dewar JB, et al. Prevalence of rotavirus, adenovirus and astrovirus infection in young children with gastroenteritis in Gaborone, Botswana. East Afr Med J. 2003;80(12):652-5. [PubMed ID: 15018423].
  • 5.
    Minosse C, Zaniratti MS, Calcaterra S, Carletti F, Muscillo M, Pisciotta M, et al. Application of a molecular panel to demonstrate enterotropic virus shedding by healthy and human immunodeficiency virus-infected patients. J Clin Microbiol. 2005;43(4):1979-81. [PubMed ID: 15815037]. https://doi.org/10.1128/JCM.43.4.1979-1981.2005.
  • 6.
    Morooka K. [Convulsions and mild diarrhea]. Shonika (Tokyo). 1982;23:131-7.
  • 7.
    Hall AJ, Rosenthal M, Gregoricus N, Greene SA, Ferguson J, Henao OL, et al. Incidence of acute gastroenteritis and role of norovirus, Georgia, USA, 2004-2005. Emerg Infect Dis. 2011;17(8):1381-8. [PubMed ID: 21801613].
  • 8.
    Okitsu-Negishi S, Okame M, Shimizu Y, Phan TG, Tomaru T, Kamijo S, et al. Detection of norovirus antigens from recombinant virus-like particles and stool samples by a commercial norovirus enzyme-linked immunosorbent assay kit. J Clin Microbiol. 2006;44(10):3784-6. [PubMed ID: 17021111]. https://doi.org/10.1128/JCM.01373-06.
  • 9.
    Rutjes SA, van den Berg HH, Lodder WJ, de Roda Husman AM. Real-time detection of noroviruses in surface water by use of a broadly reactive nucleic acid sequence-based amplification assay. Appl Environ Microbiol. 2006;72(8):5349-58. [PubMed ID: 16885286]. https://doi.org/10.1128/AEM.00751-06.
  • 10.
    Nishimura N, Nakayama H, Yoshizumi S, Miyoshi M, Tonoike H, Shirasaki Y, et al. Detection of noroviruses in fecal specimens by direct RT-PCR without RNA purification. J Virol Methods. 2010;163(2):282-6. [PubMed ID: 19878699]. https://doi.org/10.1016/j.jviromet.2009.10.011.
  • 11.
    Straub TM, Honer zu Bentrup K, Orosz-Coghlan P, Dohnalkova A, Mayer BK, Bartholomew RA, et al. In vitro cell culture infectivity assay for human noroviruses. Emerg Infect Dis. 2007;13(3):396-403. [PubMed ID: 17552092]. https://doi.org/10.3201/eid1303.060549.
  • 12.
    Guix S, Caballero S, Villena C, Bartolome R, Latorre C, Rabella N, et al. Molecular epidemiology of astrovirus infection in Barcelona, Spain. J Clin Microbiol. 2002;40(1):133-9. [PubMed ID: 11773106]. https://doi.org/10.1128/JCM.40.1.133-139.2002.
  • 13.
    Romani S, Mohebbi SR, Hosseini SM, Azimzadeh P, Vahedi M, Derakhshan F, et al. Prevalence of norovirus infection in children and adults with acute gastroenteritis, Tehran, Iran, 2008–2009. Food Environ Virol. 2012:1-5.
  • 14.
    Fretz R, Herrmann L, Christen A, Svoboda P, Dubuis O, Viollier EH, et al. Frequency of Norovirus in stool samples from patients with gastrointestinal symptoms in Switzerland. Eur J Clin Microbiol Infect Dis. 2005;24(3):214-6. [PubMed ID: 15782276]. https://doi.org/10.1007/s10096-005-1300-3.
  • 15.
    Bucardo F, Nordgren J, Carlsson B, Paniagua M, Lindgren PE, Espinoza F, et al. Pediatric norovirus diarrhea in Nicaragua. J Clin Microbiol. 2008;46(8):2573-80. [PubMed ID: 18562593]. https://doi.org/10.1128/JCM.00505-08.
  • 16.
    Wu TC, Liu HH, Chen YJ, Tang RB, Hwang BT, Yuan HC. Comparison of clinical features of childhood norovirus and rotavirus gastroenteritis in Taiwan. J Chin Med Assoc. 2008;71(11):566-70. [PubMed ID: 19015054]. https://doi.org/10.1016/S1726-4901(08)70170-9.
  • 17.
    Phan TG, Okame M, Nguyen TA, Maneekarn N, Nishio O, Okitsu S, et al. Human astrovirus, norovirus (GI, GII), and sapovirus infections in Pakistani children with diarrhea. J Med Virol. 2004;73(2):256-61. [PubMed ID: 15122801]. https://doi.org/10.1002/jmv.20084.
  • 18.
    Chhabra P, Chitambar SD. Norovirus genotype IIb associated acute gastroenteritis in India. J Clin Virol. 2008;42(4):429-32. [PubMed ID: 18467163]. https://doi.org/10.1016/j.jcv.2008.03.014.
  • 19.
    Colomba C, Saporito L, Giammanco GM, De Grazia S, Ramirez S, Arista S, et al. Norovirus and gastroenteritis in hospitalized children, Italy. Emerg Infect Dis. 2007;13(9):1389-91. [PubMed ID: 18252118]. https://doi.org/10.3201/eid1309.061408.
  • 20.
    Nakagomi T, Correia JB, Nakagomi O, Montenegro FM, Cuevas LE, Cunliffe NA, et al. Norovirus infection among children with acute gastroenteritis in Recife, Brazil: disease severity is comparable to rotavirus gastroenteritis. Arch Virol. 2008;153(5):957-60. [PubMed ID: 18317870]. https://doi.org/10.1007/s00705-008-0060-7.
  • 21.
    Witlox KJ, Nguyen TN, Bruggink LD, Catton MG, Marshall JA. A comparative evaluation of the sensitivity of two automated and two manual nucleic acid extraction methods for the detection of norovirus by RT-PCR. J Virol Methods. 2008;150(1-2):70-2. [PubMed ID: 18400313]. https://doi.org/10.1016/j.jviromet.2008.02.010.
  • 22.
    Schneider KR, Schneider RG, Hubbard M, Shukla R. Preventing foodborne illness: Norovirus. FSHN. 2005;518:1-3.
  • 23.
    Hall AJ, Aron J. Updated norovirus outbreak management and disease prevention guidelines. US Department of Health and Human Services, Centers for Disease Control and Prevention. 2011.
  • 24.
    Soares CC, Santos N, Beard RS, Albuquerque MC, Maranhao AG, Rocha LN, et al. Norovirus detection and genotyping for children with gastroenteritis, Brazil. Emerg Infect Dis. 2007;13(8):1244-6. [PubMed ID: 17953103]. https://doi.org/10.3201/eid1308.070300.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles