Oropharyngeal Colonization of Haemophilus influenzae Type b and Serologic Response After Administration of Third Dose of Pentavalent Vaccine to 12-Month-Old Children in Karaj, Iran, 2016

Author(s):
Fariba ShirvaniFariba ShirvaniFariba Shirvani ORCID1, Reza ArjmandReza ArjmandReza Arjmand ORCID2,*, Mehri GolamiMehri Golami3, Esfandiar  Najafi TavanaEsfandiar Najafi Tavana2, Samira Saee RadSamira Saee Rad4, Kumars  PourrostamiKumars Pourrostami2, Omid SafariOmid Safari2, Saeed   NikkhahSaeed Nikkhah2, Mostafa QorbaniMostafa QorbaniMostafa Qorbani ORCID5, Nasrin ElahimehrNasrin Elahimehr2, Ehsan ZahmatkeshEhsan Zahmatkesh2, Kimia SeifiKimia Seifi6
1Pediatric Infections Research Center, Research Institute for Children Health, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Pediatric, Emam Ali Hospital, Alborz University of Medical Sciences, Karaj, Iran
3Alborz University of Medical Sciences, Karaj, Iran
4Medical Genetic Laboratory, Karaj, Iran
5Endocrinology and Metabolism Research Center, Endocrinology and Metabolism Clinical Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran
6Young Researchers and Elite Club, Roudehen Branch, Islamic Azad University, Roudehen, Iran

Archives of Pediatric Infectious Diseases:Vol. 7, issue 1; e82238
Published online:Jan 13, 2019
Article type:Research Article
Received:Aug 18, 2018
Accepted:Nov 10, 2018
How to Cite:Shirvani F, Arjmand R, Golami M, Najafi Tavana E, Saee Rad S, et al. Oropharyngeal Colonization of Haemophilus influenzae Type b and Serologic Response After Administration of Third Dose of Pentavalent Vaccine to 12-Month-Old Children in Karaj, Iran, 2016. Arch Pediatr Infect Dis. 2019;7(1):e82238. doi: https://doi.org/10.5812/pedinfect.82238

Abstract

Background:

The administration of Haemophilus influenzae type b (Hib) conjugate vaccine led to a decrease of over 90% in the prevalence of severe Hib diseases in the countries with universal coverage vaccine. After addition of Hib vaccine to the national vaccination program and since no study has yet investigated this subject.

Objectives:

The current study aimed at investigating the serologic response and assessing oropharyngeal colonization with Hib after the last dose of vaccine.

Methods:

A total of 500 blood and oropharyngeal samples were collected from one-year-old children referred to Karaj health care centers, Iran. Demographic information and risk factors of the children were collected. Oropharyngeal and blood samples were transferred to the laboratory to determine antibody titer by the enzyme-linked immunosorbent assay (ELISA) technique, culture testing, and polymerase chain reaction (PCR).

Results:

In the current study, 11.8% of children (95% confidence interval (CI): 8.97 - 14.63) had an anti-Hib IgG titer of ≥ 5 µg/mL. Geometric mean titer (GMT) of vaccine antibody was 6.92 µg/mL (95% CI: 6.76 - 7.08); 9% of oropharyngeal culture results were positive for H. influaenzae (non-type b) and 8.2% were confirmed by PCR. Prevalence of oropheryngeal Hib colonization was 0.02%. There was no significant correlation between the titer of H. influaenzae antibody and positive culture of H. influaenzae and the other studied variables (P > 0.05).

Conclusions:

In Iran, similar to most countries, pentavalent vaccine in national vaccination program decreased the prevalence of Hib colonization. Prevalence of Hib colonization is an important factor in invasive diseases incidence. It is suggested that further studies asses the prevalence of invasive Hib diseases after national vaccination.

1. Background

Haemophilus influenzae, a pleomorphic Gram-negative microorganism, can remain as an asymptomatic carrier, but become invasive leading to pneumonia, septic arthritis, or meningitis (1). In 2000, the two leading causes of vaccine preventable diseases in children under five years old were H. influenzae type b (Hib) and Streptococcus pneumonia. Hib is the cause of three million serious disease cases and 386,000 deaths every year (the World Health Organization (WHO) report). The mean global case fatality rate (CFR) of Hib invasive disease is reported 43% (ranging 23% - 55%) and 44% (ranging 26% - 62%) in Eastern Mediterranean region (EMRO 2000) (2). The WHO recommended pneumococcal conjugate vaccine (PCV) and Hib conjugate vaccine (HibCV) to be incorporated into routine vaccination in all countries, especially those with high children mortality rates (3).
In the developed countries, 92% of the people are vaccinated against Hib since 2003 (4-6). In 2008, 136 out of 194 member states of the WHO started Hib vaccination, when 203,000 deaths were attributed to Hib disease in the children under five years old (7). PCV and HibCV played special roles in reducing children mortality rate by two-thirds from 1990 to 2015, after the implementation of the Millennium Development Goal (MDG) (8).
The incidence and severity of pneumonia and meningitis were reduced by Hib vaccination (9-13). Hib vaccination coverage increased in recent years. Since 2013, about 98% of the WHO member states and 52% of infants across the world received Hib vaccine through their immunization programs (14).
There are inconsistent results regarding serologic response to Hib vaccination (15, 16). The rate of nasopharyngeal Hib colonization is 1% - 10% in different populations of regions without routine Hib vaccination. Vaccination may change the subpopulation of colonization in pharyngeal regions from capsulated to non-capsulated, and therefore, change the disease behavior (17). The Hib carriage prevalence was reported 7.6% by culture from oropharyngeal swabs in 1000 children from 2005 to 2006 in Tehran, Iran. The study suggested implementation of Hib vaccination in Iran (1). Indian pentavalent vaccine was introduced into Iran vaccination program in 18 November 2014 and was replaced with DTWP vaccine in routine vaccinations of two, four, and six months (18).

2. Objectives

After introduction of Hib vaccination in Iran, estimation of serologic response to Hib and pharyngeal colonization seems necessary; therefore, the current study aimed at estimating the post-vaccination polymerase chain reaction (PCR) and throat culture for H. influenzae, and investigating its serologic response in one-year-old children in Karaj, Iran.

3. Methods

The current cross sectional study was conducted on healthy children attending Karaj health care centers in Alborz province, Iran for routine vaccination. Based on the estimated prevalence of 17% colonization rate (19), and estimation of the prevalence (P) that is clinically worthwhile to detect (d) as 4%, the sample size was 500. The vaccine used from 2014 in Iran is Pentavac (DTP/HB/Hib) in which SiiHibPRO (Haemophilus type b conjugate vaccine (intraperitoneally; I.P.) is reconstructed with diphtheria, tetanus, pertussis, and hepatitis B vaccine adsorbed (SII Q-VAC) (DTP-HB vaccine), supplied by Serum Institute of India Ltd. (Serum Institute of India Vaccination Brochure). Inclusion criteria were being one year old (between 11 months and 0 day, and 11 months and 29 days), history of complete vaccination confirmed by vaccination card, and normal growth based on the growth chart. Exclusion criteria were lack of parents’ consent to allow their child participation in the study, lack of child’s cooperation with the study, history of congenital or acquired immunodeficiency, history of transfusion of blood and blood products, malignancy and consumption of immunomodulators, and receiving intravenous immunoglobulin (IVIG) three months before sampling.
Sampling was performed by multistage cluster method. Birth weight, weight, height, breast feeding status, duration of breast feeding, the number of siblings, parents’ educational level, child maintenance status, history of parental cigarette smoking, and history of respiratory tract infections were recorded by a trained person. After obtaining informed consent from the parents, the oropharyngeal swab was obtained from tonsillar area and posterior throat, with a sterile cotton-tipped swab applicator. The swab was directly introduced into the oropharyngeal region and rotated for 1 - 2 seconds. All samples were cultured on chocolate agar and transferred to a referral laboratory. The culture media were incubated at 35°C - 37°C for 24 hours in a candle jar to produce CO2. Bacteria were diagnosed based on colony morphology and Gram stain; polymorph Gram-negative microorganisms were confirmed by microscope. Colonies were transferred from chocolate agar to blood agar and Mueller-Hinton agar and factors needed for growth of H. influenzae, such as X and V factors, were added. After a further incubation for over 24 hours and detection of growth on plates, colonies were utilized for species isolation by PCR (1).
The DNA extraction method of bacterial nucleic acids was based on the DNA Mini Kit protocol (Qiagen, Hilden, Germany). DNA from bacteria, Omp, Bex, and B.Omp genes were included during PCR, to confirm species identification and differentiate true non-typable H. influenzae strains from genetically cap locus-positive strains, respectively. One primer set was used to detect encapsulated Hib. All primer sequences with their amplicon size are listed in Table 1. For routine screening, PCR was performed with Taq polymerase (New England BioLabs, Ipswich, MA) (20, 21).
Table 1.Primers Sequences
PrimerPrimer Sequence (5’ to 3’)Amplicon Size (bp)Reference
Omp6351(20)
FAACTTTTGGCGGTTACTCTG
RCTAACACTGCACGACGGTTT
BexA343(21)
FCGTTTGTATGATGTTGATCCAGAC
RTGTCCATGTCTTCAAAATGATG
B480(21)
FGCGAAAGTGAACTCTTATCTCTC
RGCTTACGCTTCTATCTCGGTGAA
‏Blood sampling was performed on each child once. Blood samples were obtained from wrist and forearm veins by educated health workers, considering hand hygiene with an antiseptic other than chlorhexidine. Two milliliters of blood was drawn slowly and steadily to prevent hemolysis. Blood samples were maintained in a sterile, capped test tube and transferred to the main laboratory up to four hours after sampling for serum separation. Serum samples were stored at -70°C until the enzyme-linked immunosorbent assay (ELISA) was performed.
Antipolyribosyl ribitol-phosphate (PRP) exists in the capsule of the bacteria measured by ELISA [IBL international kit, Germany (catalogue reference No.: RE56351)]. The patients’ serum specific antibodies were banded to antigen coated wells and detected by a secondary enzyme conjugated antibody (E-Ab) (enzyme antibody) specific for human IgG. The color developed after the substrate reaction with Ag-Ab complex was detected. The results of optic density of samples were determined directly according to the standard curve. The results were reported as IU/mL; the lowest detectable level was 1 IU/mL.
The study protocol was approved by Research Council and Ethics Committee of Karaj University, and the permission of health officials was also obtained to enter the studied health centers (ethical approval code: Abzums.rec.1394.70). After explanation of the study purposes to the parents, all individuals that allowed the participation of their children in the study signed the informed consent forms, and then sampling was performed on their children. Quantitative variables were expressed as mean (standard deviation (SD)). The significance of difference between the studied variables and dependent qualitative and quantitative ones were investigated using both logistic and linear regression analyses. The data were analyzed at 95% confidence interval (CI) using logistic regression and P < 0.05 was considered the level of significance. Univariate analyses were included in a multivariate model to identify independent factors associated with carriage of H. influenzae.

4. Results

A total of 500 children were enrolled in the study, 255 were female (51%) and 119 passive smoker (23.8%); 113 (31%) mothers and 115 (23%) fathers had academic education; seven (1.4%) cases received kindergarten care, 78 (15%) were exclusively breastfed, 364 (72%) had a history of frequent upper respiratory tract infection (URTI), 462 (84.4%) had a history of breastfeeding in the first six months of age, 432 (86.4%) had less than two siblings. GMT of antibody response was 6.92 (95% CI: 6.76 - 7.08). IgG antibody in 59 children (11.8%) was equal or higher than 5 µg/mL (95% CI: 8.97 - 14.63) and antibody level in 441 cases (88.2%) was less than 5 µg/mL (95% CI: 85.37 - 91.03) (Table 2). Of the 500 cases, 45 (9%) (95% CI: 6.49 - 11.51) had positive culture for H. influenzae, 41 (8.2%) of which (95% CI: 5.8 - 10.6%) were confirmed by PCR. Protective level of antibody and culture results had no significant difference with respect to weight, birth weight, height, breastfeeding duration, gender, parents’ educational level, maintenance status, parental smoking, exclusive breastfeeding, and frequent URTI analyzed by multivariate analysis (Tables 3 and 4). Typing was performed on PCR positive cases, showing that all cases were of non-typable and one case was positive for Hib (0.02%).
Table 2.Anti-Haemophilus influenzae Titer (IgG) and the Result of Nasopharngeal Culture in One-Year-Old Children
Variables, TiterCultureTotal
NegativePositive
Hib IgG, µg/mL
≤ 0.15617a
0.15 - 119018208
1 - 520621227
> 553558
Total45545500

a Only one of 45 culture positive cases was positive with PCR for Haemophilus influenzae type b, and their serologic titer was 0.61 µg/mL.

Table 3.Variables and Protective Anti-Haemophilus influenzae Titer in One-Year-Old Children
VariablesNot Protective < 5Protective ≥ 5TotalP Value
Weight, ga9600 (1132)9.74 (875.08)-0.35
Height, cma75.99 (3.55)76.46 (3.22)-0.34
Breastfeeding duration, mina10.25 (3.74)10.70 (3.06)-0.37
Genderb0.25
Male212 (86.5)33 (13.5)245
Female229 (89.8)26 (10.2)255
Siblings numberb0.99
< 2381 (88.2)51 (11.8)432
≥ 260 (88.2)8 (11.8)68
Mother educationb0.37
Non academic344 (88.9)43 (11.1)241
Academic97 (85.8)16 (14.2)113
Father educationb0.88
Non academic340 (88.3)45 (11.7)385
Academic101 (87.8)14 (12.2)115
Maintenance statusb0.15
House437 (88.6)56 (11.4)493
Kindergarten5 (71.4)2 (28.6)7
Parent smokingb0.75
Yes104 (87.4)15 (12.6)119
No337 (88.5)44 (11.5)381
Exclusive breastfeedingb0.4
Yes370 (87.7)52 (12.3)422
No71 (91.0)7 (9.0)78
Brestfeedingb0.8
Yes407 (88.1)55 (11.9)462
No34 (89.5)4 (10.5)38
Frequent upper respiratory tract infectionb0.23
Yes124 (91.2)12 (8.8)136
No318 (87.4)46 (12.6)364
Birthweight, gb0.44
≤ 250035 (94.6)2 (5.4)37
2500 - 4000397 (87.6)56 (12.4)453
≥ 40009 (90.0)1 (10.0)10

a Values are expressed as mean (SD).

b Values are expressed as mean (%).

Table 4.Variables and Haemophilus influenzae Culture Results in One-Year-Old Children
VariablesNegativePositiveTotalP Value
Weight, ga9604 (1108)9759 (1077)-0.38
Height, cma76.007 (3.50)76.53 (3.62)-0.35
Genderb0.76
Male224 (91.4)21 (8.6)245
Female235 (92.2)20 (7.8)255
Siblings numberb0.22
< 2394 (91.2)38 (8.8)432
≥ 265 (95.6)3 (4.4)68
Mother educationb0.49
Non academic357 (92.2)30 (7.8)384
Academic102 (90.3)11 (9.7)113
Father educationb0.54
Non academic355 (92.2)30 (7.8)385
Academic104 (90.4)11 (9.6)115
Maintenance statusb0.42
House452 (91.7)41 (8.3)493
Kindergarten7 (100.0)07
Parent smokingb0.29
Yes112 (94.1)7 (5.9)119
No347 (91.1)34 (8.9)381
Exclusive breastfeedingb0.85
Yes387 (91.7)35 (8.3)422
No72 (92.3)6 (7.7)78
Breast feedingb0.05
Yes421 (91.1)41 (8.9)462
No38 (100.0)038
Frequent URIb0.75
Yes124 (91.2)12 (8.8)136
No335 (92.0)29 (8.0)364
Birthweight, gb0.38
≤ 250034 (91.1)3 (8.1)37
2500 - 4000417 (92.1)36 (7.9)453
≥ 40008 (80.0)2 (20.0)10

a Values are expressed as mean (SD).

b Values are expressed as mean (%).

5. Discussion

Oropharyngeal colonization with Hib may be a cause of bacteremia and invasive diseases. Increased antibody may occur at two years of age. Recurrent episodes of colonization may increase serum anti-PRP level (22). The rate of nasophayngeal colonization is affected by Hib vaccination. This effect may change the type and distribution of subtypes in vaccinated children by decreasing colonization of Hib suggested by many studies across the world. Before vaccination program, the prevalence of H. influenzae carriage in Thailand was 44.2% (23), in France 40.9% (24) and in Poland 49.9% (25). Nasopharyngeal colonization with H. influenzae in Scandinavian children in 1995 decreased from 13% in under seven-year-old children before mass vaccination to 6% in 7- to 14-year-old children and 3% in the ones over 16 years old (26). After the mass vaccination, nasopharyngeal colonization was 45% in French children aged 0 - 24 months (1993), and none of them were of serotype b (27). After Hib vaccination with coverage of > 90% in Brazilian children in 2002, nasopharyngeal coverage of Hib in 2006 was 1% for type b (28). After beginning mass Hib vaccination since 2001 in Kenya, Hib colonization under five-year-old children was 1.7% and coryza was the risk factor for its colonization (2007) (29). A study in Brazil on 6- to 24-month-old children reported Hib point prevalence of oropharyngeal colonization before vaccination as 1.2% vs. 4.8% after vaccination (30). Nasopharyngeal colonization in Iranian children in 2011 was investigated by Mousavi on one- to six-year-old children 17% of whom were positive for Hib (19). Jalali et al., reported nasopharyngeal colonization with Hib in 25- to 48-month-old children attending day care centers in Tehran 33%, and 28% were confirmed by PCR (31). These studies did not address Hib colonization. In a study conducted on 1000 oropharyngeal cultures obtained from 25 day care centers (2005 - 2006) in Tehran, the prevalence of Hib carriage was 7.6% (1). This result was an important estimation of Hib colonization in Iranian children. In comparison with Karimi et al.’s (1) results before mass Hib vaccination in Iran, the current study results indicated that oropharyngeal colonization decreased by 0.02% after mass vaccination.
The current study also highlighted on antibody response to H. influenzae and its relationship with oropharyngeal colonization. Due to higher sensitivity of oropharyngeal colonization, this method was preferred to nasopharyngeal colonization to obtain the organism (32).
Antibody-mediated response prevents pharyngeal colonization, confirmed by a study in BALB/c mice whose natural serum immunoglobulin could exhibit complement-dependent bactericidal activity by binding to bacterial surface (33). In a study conducted on the Hib carriers in infant rats, human secretory anti-Hib PS IgA inhibited nasopharyngeal colonization by inhibiting the mucosal growth and adherence (34).
Anti-Hib capsular polysaccharide antibodies of ≥ 0.15 µg/mL and ≥ 1 µg/mL were used to confirm short- and long-term protection against invasive disease. The relationship between anti-capsular polysaccharide and protection against immunization was studied in Dominican Republic in 1999. The prevalence of Hib colonization was significantly lower in vaccinated infants after administration of three doses at two, four, and six months than in the unvaccinated group (0.9% vs. 2.3%), which was directly related to anti-Hib CPS ≥ 5 µg/mL concentrations. Results showed that serum antibody level of ≥ 5 µg/mL could prevent pharyngeal colonization in vaccinated children (35). The current study used the ≥ 5 µg/mL cut-off point to investigate antibody level to prevent pharyngeal colonization in Iranian children. The results revealed that of the 500 vaccinated children, 58 had such antibody level. The important point about the current study was that only one child colonized with Hib in spite of ≤ 5 µg/mL antibody level in 227 out of 500 cases.
These results showed that there may be other mechanisms, promoted by vaccination, which may contribute to decreasing the rate of Hib colonization in Iranian vaccinated children.
Since Hib vaccination is becoming widespread, an increase in resistant and virulent non-typable H. influenzae may occur and the importance of its pathogenicity may increase, a new problem, namely, decrease in Hib and increase in non-typable H. influenzae, may be faced in the future. In the current study, approximately 10% of children were colonized with H. influenzae and only one case was of type b.

5.1. Conclusions

Results of the current study showed that in spite of low antibody level in approximately 50% of one-year-old Iranian children, nasopharyngeal colonization was observed in one child. This indicated that Hib vaccine, as a constituent of pentavalent vaccine successfully reduced Hib nasopharyngeal colonization. It is recommended that future studies investigate colonization and antibody status in Iranian children.

Acknowledgments

Footnotes

References

  • 1.
    Karimi A, Alborzi A, Fahimzad A, Gooya M, Esteghamati A, Armin SH, et al. Prevalence of oropharyngeal colonization by Haemophilus influenzae type b in Iranian children. East Mediterr Health J. 2009;15(3):544-8. [PubMed ID: 19731770].
  • 2.
    Watt JP, Wolfson LJ, O'Brien KL, Henkle E, Deloria-Knoll M, McCall N, et al. Burden of disease caused by Haemophilus influenzae type b in children younger than 5 years: Global estimates. Lancet. 2009;374(9693):903-11. [PubMed ID: 19748399]. https://doi.org/10.1016/S0140-6736(09)61203-4.
  • 3.
    World Health Organization. Pneumococcal conjugate vaccine for childhood immunization-WHO position paper. Week Epidemiol Rec. 2007;82(12):93-104.
  • 4.
    Factor SH, LaClaire L, Bronsdon M, Suleymanova F, Altynbaeva G, Kadirov BA, et al. Streptococcus pneumoniae and Haemophilus influenzae type b Carriage, Central Asia. Emerg Infect Dis. 2005;11(9):1476-9. [PubMed ID: 16229788]. [PubMed Central ID: PMC3310603]. https://doi.org/10.3201/eid1109.040798.
  • 5.
    Minz S, Balraj V, Lalitha MK, Murali N, Cherian T, Manoharan G, et al. Incidence of Haemophilus influenzae type b meningitis in India. Indian J Med Res. 2008;128(1):57-64. [PubMed ID: 18820360].
  • 6.
    Rubach MP, Bender JM, Mottice S, Hanson K, Weng HY, Korgenski K, et al. Increasing incidence of invasive Haemophilus influenzae disease in adults, Utah, USA. Emerg Infect Dis. 2011;17(9):1645-50. [PubMed ID: 21888789]. [PubMed Central ID: PMC3322072]. https://doi.org/10.3201/eid1709.101991.
  • 7.
    Expanded Programme on Immunization (EPI). The Department of Immunization, Vaccines and Biologicals Measuring impact of Streptococcus pneumoniae and Haemophilus influenzae type b conjugate vaccination. 2017. Available from: www.who.int/vaccines-documents/.
  • 8.
    United Nations Millennium Development Goals. Reduce child mortality. 2019. Available from: http://www.un.org/millenniumgoals/childhealth.shtml.
  • 9.
    Levine OS, Lagos R, Munoz A, Villaroel J, Alvarez AM, Abrego P, et al. Defining the burden of pneumonia in children preventable by vaccination against Haemophilus influenzae type b. Pediatr Infect Dis J. 1999;18(12):1060-4. [PubMed ID: 10608624].
  • 10.
    Gessner BD, Sutanto A, Linehan M, Djelantik IG, Fletcher T, Gerudug IK, et al. Incidences of vaccine-preventable Haemophilus influenzae type b pneumonia and meningitis in Indonesian children: Hamlet-randomised vaccine-probe trial. Lancet. 2005;365(9453):43-52. [PubMed ID: 15643700].
  • 11.
    Gessner BD, Sedyaningsih ER, Griffiths UK, Sutanto A, Linehan M, Mercer D, et al. Vaccine-preventable Haemophilus influenza type b disease burden and cost-effectiveness of infant vaccination in Indonesia. Pediatr Infect Dis J. 2008;27(5):438-43. [PubMed ID: 18398383]. https://doi.org/10.1097/INF.0b013e318165f1ba.
  • 12.
    Batuwanthudawe R, Rajapakse L, Somaratne P, Dassanayake M, Abeysinghe N. Incidence of childhood Haemophilus influenzae type b meningitis in Sri Lanka. Int J Infect Dis. 2010;14(5):e372-6. [PubMed ID: 19736031]. https://doi.org/10.1016/j.ijid.2009.06.018.
  • 13.
    Cisse MF, Breugelmans JG, Ba M, Diop MB, Faye PC, Mhlanga B, et al. The elimination of Haemophilus influenzae type b meningitis following conjugate vaccine introduction in Senegal. Pediatr Infect Dis J. 2010;29(6):499-503. [PubMed ID: 20042917]. https://doi.org/10.1097/INF.0b013e3181ccb0a0.
  • 14.
    Centers for Disease Control and Prevention; Immunization Week in the Western Pacific; World Health Organization. Epidemiology and prevention of vaccine-preventable diseases: Haemophilus influenzae type b. 2019. Available from: HTTP://www.cdc.gov/vaccines/pubs/pinkbook/downloads/hib.pdf.
  • 15.
    Rodriguez RS, Mascarenas C, Conde-Glez CJ, Inostroza J, Villanueva S, Velazquez ME, et al. Serological protection induced by Haemophilus influenzae type b conjugate vaccine in Mexican children: Is a booster dose of the vaccine needed? Clin Vaccine Immunol. 2010;17(10):1639-41. [PubMed ID: 20719986]. [PubMed Central ID: PMC2953005]. https://doi.org/10.1128/CVI.00249-10.
  • 16.
    Lee YC, Kelly DF, Yu LM, Slack MP, Booy R, Heath PT, et al. Haemophilus influenzae type b vaccine failure in children is associated with inadequate production of high-quality antibody. Clin Infect Dis. 2008;46(2):186-92. [PubMed ID: 18171249]. https://doi.org/10.1086/524668.
  • 17.
    Brueggemann AB, Griffiths DT, Meats E, Peto T, Crook DW, Spratt BG. Clonal relationships between invasive and carriage Streptococcus pneumoniae and serotype- and clone-specific differences in invasive disease potential. J Infect Dis. 2003;187(9):1424-32. [PubMed ID: 12717624]. https://doi.org/10.1086/374624.
  • 18.
    Fars News. Pentavalent VA, A strategy to promote children health. 2017. Available from: HTTP://www.farsnews.COM/PRINTABLE.PHP?NN=13930828000405.
  • 19.
    Mousavi SF, Jalali P, Siadat SD, Rezaei N, Zahraei SM, Parsa H. Prevalence of Haemophilus influenza and Streptococcus pneumonia carriers in nasopharyngeal in children under 6 years old in Tehran. 13th Iranian and 2nd International Congress of Microbiology Ardebil. 2012.
  • 20.
    Ueyama T, Kurono Y, Shirabe K, Takeshita M, Mogi G. High incidence of Haemophilus influenzae in nasopharyngeal secretions and middle ear effusions as detected by PCR. J Clin Microbiol. 1995;33(7):1835-8. [PubMed ID: 7665655]. [PubMed Central ID: PMC228280].
  • 21.
    Falla TJ, Crook DW, Brophy LN, Maskell D, Kroll JS, Moxon ER. PCR for capsular typing of Haemophilus influenzae. J Clin Microbiol. 1994;32(10):2382-6.
  • 22.
    Barbour ML. Conjugate vaccines and the carriage of Haemophilus influenzae type b. Emerg Infect Dis. 1996;2(3):176-82. [PubMed ID: 8903227]. [PubMed Central ID: PMC2626802]. https://doi.org/10.3201/eid0203.960303.
  • 23.
    Talon D, Leroy J, Dupont MJ, Bertrand X, Mermet F, Thouverez M, et al. Antibiotic susceptibility and genotypic characterization of Haemophilus influenzae strains isolated from nasopharyngeal specimens from children in day-care centers in eastern France. Clin Microbiol Infect. 2000;6(10):519-24. [PubMed ID: 11168045].
  • 24.
    Sulikowska A, Grzesiowski P, Sadowy E, Fiett J, Hryniewicz W. Characteristics of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis isolated from the nasopharynges of asymptomatic children and molecular analysis of S. pneumoniae and H. influenzae strain replacement in the nasopharynx. J Clin Microbiol. 2004;42(9):3942-9. [PubMed ID: 15364973]. [PubMed Central ID: PMC516321]. https://doi.org/10.1128/JCM.42.9.3942-3949.2004.
  • 25.
    Bakir M, Yagci A, Ulger N, Akbenlioglu C, Ilki A, Soyletir G, et al. Pharyngeal colonization with Haemophilus influenzae type b among healthy Turkish infants and children. Pediatr Int. 2002;44(4):381-6. [PubMed ID: 12139561].
  • 26.
    Gunnarsson RK, Holm SE, Soderstrom M. The prevalence of potential pathogenic bacteria in nasopharyngeal samples from healthy children and adults. Scand J Prim Health Care. 1998;16(1):13-7. [PubMed ID: 9612873].
  • 27.
    Raymond J, Armand-Lefevre L, Moulin F, Dabernat H, Commeau A, Gendrel D, et al. Nasopharyngeal colonization by Haemophilus influenzae in children living in an orphanage. Pediatr Infect Dis J. 2001;20(8):779-84. [PubMed ID: 11734741].
  • 28.
    Silva MENB, Silva P, Medeiros MIC, Neme SN, Macedo C, Marin JM. Nasopharyngeal colonization by Haemophilus influenzae in children attending day-care centers, in Ribeirão Preto, State of São Paulo, Brazil. Braz J Microbiol. 2006;37(1):33-8. https://doi.org/10.1590/s1517-83822006000100006.
  • 29.
    Abdullahi O, Nyiro J, Lewa P, Slack M, Scott JA. The descriptive epidemiology of Streptococcus pneumoniae and Haemophilus influenzae nasopharyngeal carriage in children and adults in Kilifi district, Kenya. Pediatr Infect Dis J. 2008;27(1):59-64. [PubMed ID: 18162940]. [PubMed Central ID: PMC2382474]. https://doi.org/10.1097/INF.0b013e31814da70c.
  • 30.
    Forleo-Neto E, de Oliveira CF, Maluf EM, Bataglin C, Araujo JM, Kunz LF Jr, et al. Decreased point prevalence of Haemophilus influenzae type b (Hib) oropharyngeal colonization by mass immunization of Brazilian children less than 5 years old with hib polyribosylribitol phosphate polysaccharide-tetanus toxoid conjugate vaccine in combination with diphtheria-tetanus toxoids-pertussis vaccine. J Infect Dis. 1999;180(4):1153-8. [PubMed ID: 10479142]. https://doi.org/10.1086/315018.
  • 31.
    Jalali P, Mousavi SF, Rezaei N. Carriage rate of nasopharyngeal Haemophilus influenzae among children under 6 years old in Tehran, Iran. J Med Microbiol Infec Dis. 2014;2(1):23-7.
  • 32.
    Coen PG, Heath PT, Garnett GP. The Hib immunization programme in the Oxford region: An analysis of the impact of vaccine administration on the incidence of disease. Epidemiol Infect. 1999;123(3):389-402. [PubMed ID: 10694149]. [PubMed Central ID: PMC2810772].
  • 33.
    Zola TA, Lysenko ES, Weiser JN. Natural antibody to conserved targets of Haemophilus influenzae limits colonization of the murine nasopharynx. Infect Immun. 2009;77(8):3458-65. [PubMed ID: 19451240]. [PubMed Central ID: PMC2715656]. https://doi.org/10.1128/IAI.01564-08.
  • 34.
    Kauppi-Korkeila M, van Alphen L, Madore D, Saarinen L, Kayhty H. Mechanism of antibody-mediated reduction of nasopharyngeal colonization by Haemophilus influenzae type b studied in an infant rat model. J Infect Dis. 1996;174(6):1337-40. [PubMed ID: 8940229].
  • 35.
    Fernandez J, Levine OS, Sanchez J, Balter S, LaClaire L, Feris J, et al. Prevention of Haemophilus influenzae type b colonization by vaccination: Correlation with serum anti-capsular IgG concentration. J Infect Dis. 2000;182(5):1553-6. [PubMed ID: 11023481]. https://doi.org/10.1086/315870.

Similar Articles

20
Aug
2018
Study of Serologic Response Rate to <i>Haemophilus influenzae</i> Type B After Administration of the Third Dose of Pentavalent Vaccine in Children Aged 12 Months in Karaj City in 2016

Study of Serologic Response Rate to Haemophilus influenzae Type B After Administration of the Third Dose of Pentavalent Vaccine in Children Aged 12 Months in Karaj City in 2016

Reza Arjmand,
Mehri Gholami,
Fariba Shirvani,
Omid Safari,
Mostafa Qorbani,
Mohammad Javad Gharavi

Arjmand R, Gholami M, Shirvani F, Safari O, Qorbani M, et al. Study of Serologic Response Rate to Haemophilus influenzae Type B After Administration of the Third Dose of Pentavalent Vaccine in Children Aged 12 Months in Karaj City in 2016. Arch Clin Infect Dis. 2018;13(5):e59344. doi: https://doi.org/10.5812/archcid.59344

19
May
2026

Haemophilus influenzae Type b Immunity After Hib Vaccination and Its Association with Serum Iron, Zinc, and Copper in Southwest Iran: Is a Vaccine Booster Needed?

Masihollah Shakeri,
Armin Hashemi,
Karamatollah Rahmanian,
Vahid Rahmanian,
Fatemeh Sotoodeh Jahromi,
Mehran Mohseni
,et al.

Shakeri M, Hashemi A, Rahmanian K, Rahmanian V, Sotoodeh Jahromi F, et al. Haemophilus influenzae Type b Immunity After Hib Vaccination and Its Association with Serum Iron, Zinc, and Copper in Southwest Iran: Is a Vaccine Booster Needed?. Health Scope. 2026;15(2):e169270. doi: https://doi.org/10.5812/healthscope-169270

13
Apr
2019
83565

Hepatitis B Seroconversion Rate After Primary Immunization Series with Newly Introduced Pentavalent Vaccine: A Report of Local Study in Alborz Province, Iran, 2016

Reza Arjmand,
Mehri Gholami,
Fariba Shirvani,
Kumars Pourrostami,
Omid Safari,
Nasrin Elahimehr
,et al.

Arjmand R, Gholami M, Shirvani F, Pourrostami K, Safari O, et al. Hepatitis B Seroconversion Rate After Primary Immunization Series with Newly Introduced Pentavalent Vaccine: A Report of Local Study in Alborz Province, Iran, 2016. Arch Pediatr Infect Dis. 2019;7(2):e83565. doi: https://doi.org/10.5812/pedinfect.83565

12
Jan
2014

Serum Levels of Anti-Hepatitis B Surface Antibody Among Vaccinated Population Aged 1 to 18 Years in Ahvaz City Southwest of Iran

Reza Norouzirad,
Abdol Hussein Shakurnia,
Mohammad-Ali Assarehzadegan,
Amirarsalan Serajian,
Mehdi Khabazkhoob

Norouzirad R, Shakurnia AH, Assarehzadegan M, Serajian A, Khabazkhoob M. Serum Levels of Anti-Hepatitis B Surface Antibody Among Vaccinated Population Aged 1 to 18 Years in Ahvaz City Southwest of Iran. Hepat Mon. 2014;14(1):e13625. doi: https://doi.org/10.5812/hepatmon.13625

30
Jun
2009

Evaluation of the Level of HBV Antibody Titer after HBV Vaccination among Children in Tehran, Iran

Reza Ranjbar,
Hassan Abolghasemi,
Mohammad Turkaman,
Reza Ranjbar

Ranjbar R, Abolghasemi H, Turkaman M, Ranjbar R. Evaluation of the Level of HBV Antibody Titer after HBV Vaccination among Children in Tehran, Iran. Hepat Mon. 2009;9(2):. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles