Acinetobacter baumannii, Alamy

Image Credit:Acinetobacter baumannii, Alamy

Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii

Author(s):
Ehsan GhasemiEhsan Ghasemi1, 2, Zohreh GhalavandZohreh Ghalavand1, Hossein GoudarziHossein GoudarziHossein Goudarzi ORCID1,*, Farshid YeganehFarshid YeganehFarshid Yeganeh ORCID3, Ali HashemiAli HashemiAli Hashemi ORCID1, Hossein DabiriHossein Dabiri1, Elnaz Sadat MirsamadiElnaz Sadat Mirsamadi1, Masoumeh ForoumandMasoumeh Foroumand4
1Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2Abadan School of Medical Sciences, Abadan, Iran
3Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4Imam Hossein Hospital, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
*Corresponding Author: Corresponding author: Dr. Hossein Goudarzi, Department of Microbiology, Shahid Beheshti University of Medical Sciences, Koodakyar St., Tabnak Blv., Yaman Av.,Chamran Highway, P. Box: 19857-17443, Tehran, IR Iran. Tel: +98-2123872556, Fax: +98-2122439952, E-mail: Email: [email protected]

Archives of Clinical Infectious Diseases:Vol. 13, issue 4; e12914
Published online:Jun 24, 2018
Article type:Research Article
Received:Jan 23, 2017
Accepted:Sep 19, 2017
How to Cite:Ghasemi E, Ghalavand Z, Goudarzi H, Yeganeh F, Hashemi A, et al. Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii. Arch Clin Infect Dis. 2018;13(4):e12914. doi: https://doi.org/10.5812/archcid.12914

Abstract

Acinetobacter baumannii (A. baumannii) is an important opportunistic pathogen responsible for nosocomial infections worldwide at recent decades. Biofilm formation by A. baumannii leads to antibiotic resistance and survives on abiotic and biotic surfaces. In the present study we aimed to assess the ability of biofilm formation in clinical and environmental isolates of A. baumannii by phenotypic methods and to detect the presence of genes involving in the biofilm development; bap, ompA, csuE, abaI, and blaPER-1by PCR method. Totally 120 A. baumanniin isolates, 98 clinical, and 22 environmental were evaluated for biofilm formation using the modified Microtiter plate method, Congo red agar methods, and the existence of genes related to biofilm by standard PCR. The phenotypic results showed that the biofilm formation rate was 10.8% isolates that in environmental A. baumannii isolates were higher than clinical isolates. The abaI, csuE, and ompA genes were detected in all isolates with biofilm formation and the bap and blaPER-1genes were positive in 14.2% and 13.3% of A. baumannii isolates, respectively. The sequence of genes were submitted in NCBI. Based on our results, the Congo red agar method was significantly better than the Microtiter plate technique for phenotypic evaluation of biofilm formation in the A. baumannii. Our study indicates that abaI, csuE, and ompA genes were detected in all isolates unlike the bap and blaPER-1genes.

1. Background

Acinetobacter baumannii (A. baumannii) is a glucose non-fermentative, Gram-negative aerobic, non-motile coccobacillus, ubiquitous in nature, and persistent in hospital environment (1, 2). A. baumannii is also a nosocomial pathogen and accounts for almost 10% of hospital-acquired infections by 80% of all reported Acinetobacter infections, including bacteremia, ventilator-associated pneumonia, meningitis, wound, skin, soft-tissue infections, peritonitis, bloodstream, and urinary tract infections (2-8). In the past decade, A. baumannii strains resistant to all known antibiotics have now been emerged as a significant clinical problem worldwide (9-11). Ability of A. baumannii to persist and to survive for long periods of time on surfaces has made it as a frequentative cause of health-care associated infections. This bacteria can survive over long periods under dry conditions (7, 12). A. baumannii encodes multiple virulence factors; of them biofilm-forming ability is considered one of the key virulence attributes of this pathogen (5, 7).
A. baumannii biofilm associated protein (bap) is a cell surface protein and virulence factor. Bap protein in A. bumanii is a large protein (854-kDa) and homologous to staphylococcal protein and has been characterized in other bacteria genera typically in those are associated with nosocomial infection, such as Enterococcus spp. and Pseudomonas spp. The bap is significant for the formation of maturation biofilm on biotic and abiotic surfaces (4, 7). Quantitative comparison of biofilms formed by a wild-type and the bap-deficient mutant bacteria has been demonstrated that the mutant was unable to develop biofilm thickness, it has been shown that the bap gene is required for biofilm formation (13). A porin protein of A. baumannii, the 38-kDa outer membrane protein A (OmpA), plays an important role in the biofilm formation (3, 5, 7). The CsuA/BABCDE gene is required for formation of pili involved in adherence to abiotic surfaces. It has been demonstrated that inactivation of the csuE gene, as a part of the CsuA/BABCDE chaperone-usher complex, eliminates pili production and biofilm formation (14, 15). In A. baumannii autoinducer synthase (AbaI), part of the quorum sensing (QS) system is responsible for Acyl-homoserine lactones (AHL) production. The AHL is a major component of auto-inducer signals, which are used by gram negative bacteria for biofilm formation (5, 16).
Biofilm-forming ability in A. baumannii plays an important role in the pathogenesis and subsequently antibiotic resistance (17). Therefore, the purpose of the current study was to evaluate the biofilm formation status of A. baumannii isolated from wound, Lumbar Puncture, bloodstream, and urinary tract infections, and we also aimed to investigate the bap, ompA, csuE, and abaI genes involving in nosocomial infections pathogenesis in A. baumannii isolated from hospital environments and patients in Tehran, Iran.

2. Methods

2.1. Bacteria Isolates

The current descriptive study was performed on 120 non-duplicate isolates of A. baumannii who were isolated from UTI, bloodstream, catheter, wound, and sputum of hospitalized patients and as well as hospital environments from April to December 2014 in Imam Hossein teaching hospital in Tehran, Iran. Isolates were confirmed by conventional microbiological and biochemical tests such as oxidase test (Merck, Germany), motility, and growth at 44°C in the microbiology laboratory and then were confirmed by amplification of bla-oxa-51-like gene using PCR. Then the isolates were stored at -70°C for further investigated.

2.2. Biofilm Formation Analysis

2.2.1. Modified Congo Red Agar Tset (MCRA)

Phenotypic formation of biofilm in A. baumannii isolates was determine by culture on MCRA plates as formerly cleared by Arciola et al. (18). Briefly, Congo Red Agar (CRA) plates were collected with combining 36 gram of saccharose (Sigma, USA) and 0.8 gram of Congo red powder (Merck, Germany) to 1 liter of brain heart infusion (BHI) Agar (Merck, Germany). The plates were incubated at 37°C for 24 hours and subsequently at room temperature (20 - 25°C) for overnight. The colonies morphology was then explained based on colony color as red, almost black, black, and very black. Red colonies were considered unable to produce biofilm and almost black colors were classified as strains of a weak formation biofilm activity. Conversely, strains with black and very black colonies were indicative as intense biofilm producer strains.

2.2.2. Microtiter Plate Method

Biofilm formation was defined quantitatively using a modified microtiter plate assay as biofilm formation was measured quantitatively using a modified microtiter plate assay as described before (19). In summary, isolates were grown in Tripticase-Soy Broth (TSB, Merck, Germany) containing 0.5% glucose (Merck, Germany) and were incubated overnight at 37°C. Cultures were diluted 1:40 in TSB containing 0.5% glucose, afterwards from diluted solution, 200 μL was added to wells of a polystyrene plate and was incubated at 37°C for 48 hours. The wells that contained 200 μL of TSB containing 0.5% glucose were negative control. Wells were slowly washed three times with Phosphate Buffered Saline (PBS; pH 7.2; Invitrogen, USA), were fixed by methyl alcohol (Merck, Germany) for 20 minutes, were dried at 20 - 25°C (room temperature), and then were strained by 0.1% safranin (Merck, Germany). The safranin dye linked to the adherent cells was dissolved with 150 μL of 95% ethyl alohol (Merck, Germany) per well. Eventually, the optical density (OD) of each well was measured by using the ELISA reader (BioTek, USA) at 490 nm (A490). Optical density cut-off (ODc) was defined as 3 × standard deviation (SD) above mean OD of negative control. Biofilm formation with strains was analyzed and classified based on the absorbance of the safranin-stained attached cells (Table 1).
Table 1.Assortment of Biofilm Formation Abilities with Microtiter Plate Assay
Cut-Off Value CalculationMean of OD Values ResultsBiofilm Formation Abilities
OD ≤ 0.059OD ≤ 0.059None
ODc< OD ≤ 2 × ODc0.059 < OD ≤ 0.118Weak
2 × ODc < OD ≤ 4 × ODc0.118 < OD ≤ 0.236Moderate
OD > 4 × ODcOD > 0.236Strong

2.2.3. Gene Pattern Identification

DNA- Genomic was extracted from pure cultures using the high pure PCR Template Preparation Kit (Roche, Germany), according to the manufacturers instruction. The extracted DNA was used for polymerase chain reaction (PCR) test. In our study, A. baumannii isolates were screened for the presence of the bap, abaI, csuE, ompA, and blaPER-1genes using PCR. Sequences of the primers are defined in Table 2. PCR was managed on 25 μL of final volume using HotStarTaq Master Mix kit (SinaClon, Iran) containing 12.5 μL of 2x HotStarTaq Master Mix (containing 0.4 mM of each dNTP, 3 mM MgCl2, and 0.08 U/μLTaq DNA polymerase in reaction buffer) with 1 μL of each primer (20 pmol), 1 μL of the DNA template, and 9.5 μL of ddH2O. DNA amplification was accomplished in a thermocycler (Eppendorf, Germany) with a primary denaturation step at 94°C for 4 minutes, 30 amplification cycles for the bap, csuE, and ompA genes and 35 amplification cycles for the abaI gene, each with 45 seconds at 94°C, 45 seconds at various annealing temperatures for several genes (Table 2), and at 72°C for 45 seconds, followed with an extra extension step at 72°C for 5 minutes. The amplified products were electrophoresed on 1.5% agarose gel (Sigma, USA) and were visualized by ethidium bromide staining (Sigma, USA). Genes were sent for sequencing (Bioneer, Korea). A. baumannii ATCC 19606 was used as the producer of biofilm control strain due to the fact that it has been all genes of biofilm formation.
Table 2.Primers Were Used in This Study
PrimreSequence (5′ - 3′)Products Sizes, bpAnnealing, °CRef.
bapFw- ATAACTCGGCTGTTTACGG35849This study
Rv- ACTGATGGTGTTGGAAGTG
ompAFw- CTGGTGTTGGTGCTTTCTGG35249This study
Rv- GTGTGACCTTCGATACGTGC
abaIFw- CGCTACAGGGTATTTGTTGA37046This study
Rv- TCGTAATGAGTTGTTTTGCG
csuEFw- AGACATGAGTAGCTTTACG51652(17)
Rv- CTTCCCCATCGGTCATTC
blaPER-1Fw- GCAACTGCTGCAATACTCGG34055(20)
Rw- ATGTGCGACCACAGTACCAG

2.3. Statistical Analysis

The relationship between biofilm formation and the existence of biofilm related genes among A. baumannii isolates was appraisement by the Pearson Chi-Square test using SPSS version 21 (SPSS, Chicago, IL, USA) P values less than 0.05 were considered to be statically significant.

3. Results

Totally, 120 A. baumannii isolates, 98 clinical, and 22 environmental were evaluated for biofilm formation using Microtiter plate, Congo red agar methods, and the existence of genes related to biofilm by standard PCR. In this study, 13 (10.8%) isolates of A. baumannii showed biofilm formation, where 7 and 6 isolates were clinical and environmental, respectively. Biofilm formation was significantly more frequent in environmental (6 out of 22) samples than clinical (7 out of 98) ones (P = 0.014).
The GenBank provided accession number for bap (accession number KU1751177), ompA (accession number KU523791), csuE (accession number KY049981), abaI (accession number KU648404), and blaPER-1(accession number KU672727).
In term of the severity of biofilm formation, 9 isolates (7.5%) showed black/very black colonies considered as strong biofilm producers, while 4 isolates (3.3%) showed almost black colonies indicating weak biofilm producers (Table 3). In the MCRA method, relationship between the severity of biofilm formation in clinical and environmental isolates is considered to be not statistically significant (P values more than 0.05).
Table 3.Formation Biofilm of A. baumannii Isolates in Congo Red Agar Method and Microtiter Plate Assaya
Method/Biofilm FormationClinical Isolates (n = 98)Environmental Isolates (n = 22)Total (n = 120)
Modified Congo red agar
Very black4 (4.1)2 (9.1)6 (5)
Black3 (3.1)0 (0)3 (2.5)
Almost black0 (0)4 (18.2)4 (3.3)
Red91 (92.8)18 (81.8)107 (89.2)
Microtiter plate assay
Strong3 (3.1)2 (9.1)5 (4.15)
Moderate3 (3.1)0 (0)3 (2.5)
Weak1 (1)4 (18.2)5 (4.15)
None91 (92.8)18 (81.8)107 (89.2)

aValues are expressed as No. (%).

Moreover, in the Microtiter plate method, 5 isolates (4.2%) of the strains were strong biofilm producers, 3 clinical isolates, and 2 environmental isolates; in addition, 3 isolates (2.5%) were moderate biofilm producers that were all clinical, and 5 isolates (4.2%) were found to be weakly adherent, where 4 isolates were environmental. The relationship between severity of biofilm formation in clinical and environmental isolates by both methods were considered to be not statistically significant (P values more than 0.05).
Whereas among the clinical strains of A. baumannii, by culturing them on Modified Congo red agar (MCRA) and Microtiter plate method were 7.2% and 6.2% of the strains were found to be strong, respectively (Table 3).
Considering the environmental A. baumannii isolates in both methods, 18.2% of were strong and weak biofilm producers, respectively. Overall, by both methods, 89.2% of studied A. baumannii isolates were non-biofilm producers while 10.8% were biofilm producers. There were no differences in sensitivity or specificity by both methods. The biofilm formation abilities of clinical strains were found to be slightly less than those of environmental strains.

3.1. Biofilm Related Genes

All isolates were investigated for the bap, abaI, csuE, ompA, and blaPER-1genes. The abaI, csuE, and ompA genes were present in all (100%) A. baumannii isolates. The bap and blaPER-1genes were found in 17 (14.2%) and 16 (13.3%) isolates, respectively. Distribution of the bap gene in clinical and environmental isolates was 8.4% and 31.8%, respectively and all of the blaPER-1genes were clinical samples. Between biofilm formation and the bap gene have not relationship of the A. baumannii samples by biofilm phenotype were positive for the existence of the bap genes while 7 of the isolates was not showed the bap gene. Relationship between the bap and blaPER-1genes in clinical and environmental isolates was statistically significant (P values less than 0.05). The bap gene in environmental strains was found to be higher than those of clinical strains. The PCR product of the bap, abaI, ompA, and csuE genes from A. baumannii isolates is shown in Figure 1.
PCR-product of the <i>bap</i>, <i>abaI</i>, <i>csuE</i>, <i>ompA</i>, and <i>bla</i><sub><i>PER-1</i></sub>genes from <i>A. baumannii</i> isolates. A: positive control of <i>bap</i> gene; B: <i>bap</i> gene (358bp); C: positive control of <i>bla</i><sub><i>PER-1</i></sub>gene; D: <i>bla</i><sub><i>PER-1</i></sub>gene (340 bp); E: positive control of <i>ompA</i> gene; F: <i>ompA</i> gene (352 bp); G: positive control of <i>csuE</i> gene; H: <i>csuE</i> gene (516 bp); I: positive control of <i>abaI</i> gene; J: <i>abaI</i> gene (370 bp); K: negative control.
Figure 1.

PCR-product of the bap, abaI, csuE, ompA, and blaPER-1genes from A. baumannii isolates. A: positive control of bap gene; B: bap gene (358bp); C: positive control of blaPER-1gene; D: blaPER-1gene (340 bp); E: positive control of ompA gene; F: ompA gene (352 bp); G: positive control of csuE gene; H: csuE gene (516 bp); I: positive control of abaI gene; J: abaI gene (370 bp); K: negative control.

4. Discussion

The purpose of the current study was to evaluate the biofilm formation by A. baumannii obtained from wound, Lumbar Puncture, bloodstream, and urinary tract infections, and the investigation of the bap, abaI, csuE, ompA, and blaPER-1genes involving in nosocomial infection pathogenesis in A. baumannii isolated from environment and patients in Imam Hossein hospital in Tehran, Iran.
In this study we evaluated the biofilm formation and its severity status with Congo Red Agar (MCRA) and Microtiter plate method. MCRA technique was easy to perform and of course due to less washing steps, its result was more reliable. Several washing steps in Microtiter plate method may result in distrust. This difference may be due to several factors such as multiple washing steps in Microtiter plate method.
Our results with MCR agar and Microtiter plate methods showed that the biofilm formation rate was low (10.8%) and biofilm formation was significantly more frequent in environmental (6 out of 22) samples than clinical (7 out of 98) ones (P = 0.014). Kumari et al. (10) and Cevahir et al. (1) studies showed that biofilm formation was abundant in their studied samples.
Formation biofilm ability and adhesiveness in A. baumannii play a key role in the host pathogen interplay and in infections related with medical devices, involving a range of bacterial conditions, multiple environmental cues, and cell signals. Recently, adequately attention has been directed toward the correlation among the genetic factors involved in cohesion to eukaryotic cells and those signified in the initial step of biofilm production on abiotic surfaces (5). According to the condition of biofilm formation, many of the gene products have already been demonstrated to play key roles in the adhesiveness and biofilm production of A. baumannii on both biotic and abiotic surfaces. The biofilm-associated protein (bap), expressed on the cell surface of bacteria, first reported by Loehfelm and et al. (2008) in A. baumannii have a role in intercellular adhesion, thus, most probably biofilm maturity on distinct substrata (4, 5, 13). Other proteins seem to play an important role in biofilm formation on surfaces, of these, the outer membrane protein; ompA, the 38 kDa porin protein with pore size 1.3 nm, plays a major role in the attachment phase of an A. baumannii on abiotic surfaces, and also in the pathogen interaction (3, 5, 21).
Early studies on the A. baumannii ATCC 19606 T strain reported that pili formation is intermediated by the csuE, which is required for the first stages of bacterial adhesion on abiotic surfaces, resulting in biofilm formation and development (5). The A. baumannii M2 strain was demonstrated to produce an N-acyl-homoserine lactone (abaI), which as a Quorum Sensing molecule is significant for the production of biofilm on abiotic surfaces (5). The blaPER-1is an extended-spectrum-lactamase, which was found in Acinetobacter spp. and P. aeruginosa biofilm formation was markedly reduced. In this bacterium, biofilm formation is enhanced by the presence and expression of the blaPER-1gene. Other studies have been demonstrated that clinical isolates of MDR A. baumannii had a high ability to produce biofilm and adherence to respiratory epithelial cells (9, 22-24).
Our results showed that the csuE gene was 100% in all clinical and environmental isolates, which has also been shown in the previous studies (25, 26). The most probable explanation for existence of the csuE gene in all isolates is that all the isolates had pili. In this study 120 (100%) isolates have the ompA gene and abaI gene. We did not find a study based on quantitative assessment of clinical and environmental isolates related to the ompA gene and abaI gene. In this study 17 (14.2%) isolates were positive for the bap gene, of them 10 (8.4%) clinical isolates and 7 (31.8%) belonged to the environmental isolates. Relationship between biofilm formation and the bap gene was not statically significant. Our findings do not support the study of Goh et al. (4), in which they showed that the bap gene were very frequent in the studied isolates. One possible explanation for this discrepancy is that they studied on a smaller number of A. baumannii, all from clinical sources with resistant to carbapenem. The frequency of the blaPER-1gene varies based on different studies; i.e. Yong and et al. detected the blaPER-1genein 54.6% Acinetobacters in Korea, often in the patient sputum of intensive care unit (ICU) (27). Lee et al. showed the blaPER-1in all multidrug-resistant (MDR) clinical isolates of A. baumannii (28).
We found 13.3% studied isolates were positive for the blaPER-1gene. According to the results of the study, biofilm formation in environmental A. baumannii isolates was more than clinical isolates. One possible explanation for the betterment in the environmental isolates might be attributed to the increased gene exchanges between environmental A. baumannii isolates. Importantly our study revealed that the MCRA technique is significantly better than the Microtiter plate method for evaluation phenotypic biofilm formation.
Overall, the abaI, csuE, and ompA genes were detected in all isolates regardless the biofilm status, while the bap and blaPER-1genes was found in some of the A. baumannii isolates from patients and environmental; therefore, in the studied isolates, no relationship between biofilm formation and the presence of interested genes was found. For better understanding of the relationship among biofilms status and related genes in A. baumannii pathogenesis, further studies considering all other virulence markers genes in both genomic and proteomic level are recommended.

4.1. Conclusions

The Congo red agar method was better than the Microtiter plate technique for phenotypic evaluation of biofilm formation in the A.baumannii. According to the current study, the abaI, csuE, and ompA genes were detected in all isolates while the bap and blaPER-1genes was more frequent in clinical samples. No correlation was found among biofilm production severity and genes status. More studies are recommended for detection of biofilm related genes role on the host - pathogen interaction.

References

  • 1.
    Cevahir N, Demir M, Kaleli I, Gurbuz M, Tikvesli S. Evaluation of biofilm production, gelatinase activity, and mannose-resistant hemagglutination in Acinetobacter baumannii strains. J Microbiol Immunol Infect. 2008;41(6):513-8. [PubMed ID: 19255696].
  • 2.
    Rahbar MR, Rasooli I, Mousavi Gargari SL, Amani J, Fattahian Y. In silico analysis of antibody triggering biofilm associated protein in Acinetobacter baumannii. J Theor Biol. 2010;266(2):275-90. [PubMed ID: 20600143]. https://doi.org/10.1016/j.jtbi.2010.06.014.
  • 3.
    Gaddy JA, Tomaras AP, Actis LA. The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells. Infect Immun. 2009;77(8):3150-60. [PubMed ID: 19470746]. [PubMed Central ID: PMC2715673]. https://doi.org/10.1128/IAI.00096-09.
  • 4.
    Goh HM, Beatson SA, Totsika M, Moriel DG, Phan MD, Szubert J, et al. Molecular analysis of the Acinetobacter baumannii biofilm-associated protein. Appl Environ Microbiol. 2013;79(21):6535-43. [PubMed ID: 23956398]. [PubMed Central ID: PMC3811493]. https://doi.org/10.1128/AEM.01402-13.
  • 5.
    Longo F, Vuotto C, Donelli G. Biofilm formation in Acinetobacter baumannii. New Microbiol. 2014;37(2):119-27. [PubMed ID: 24858639].
  • 6.
    Pour NK, Dusane DH, Dhakephalkar PK, Zamin FR, Zinjarde SS, Chopade BA. Biofilm formation by Acinetobacter baumannii strains isolated from urinary tract infection and urinary catheters. FEMS Immunol Med Microbiol. 2011;62(3):328-38. [PubMed ID: 21569125]. https://doi.org/10.1111/j.1574-695X.2011.00818.x.
  • 7.
    Vijayakumar S, Rajenderan S, Laishram S, Anandan S, Balaji V, Biswas I. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates. Front Public Health. 2016;4:105. [PubMed ID: 27252939]. [PubMed Central ID: PMC4877508]. https://doi.org/10.3389/fpubh.2016.00105.
  • 8.
    Poorabbas B, Mardaneh J, Rezaei Z, Kalani M, Pouladfar G, Alami MH, et al. Nosocomial Infections: Multicenter surveillance of antimicrobial resistance profile of Staphylococcus aureus and Gram negative rods isolated from blood and other sterile body fluids in Iran. Iran J Microbiol. 2015;7(3):127-35. [PubMed ID: 26668699]. [PubMed Central ID: PMC4676981].
  • 9.
    Gordon NC, Wareham DW. Multidrug-resistant Acinetobacter baumannii: mechanisms of virulence and resistance. Int J Antimicrob Agents. 2010;35(3):219-26. [PubMed ID: 20047818]. https://doi.org/10.1016/j.ijantimicag.2009.10.024.
  • 10.
    Kumari AMS, Routray A, Yadav D, Madhavan R. Imipenem resistance and biofilm production in Acinetobacter. Drug Invent Today. 2013;5(3):256-8.
  • 11.
    Razavi Nikoo H, Ardebili A, Mardaneh J. Systematic Review of Antimicrobial Resistance of Clinical Acinetobacter baumannii Isolates in Iran: An Update. Microb Drug Resist. 2017;23(6):744-56. [PubMed ID: 28085571]. https://doi.org/10.1089/mdr.2016.0118.
  • 12.
    Wendt C, Dietze B, Dietz E, Ruden H. Survival of Acinetobacter baumannii on dry surfaces. J Clin Microbiol. 1997;35(6):1394-7. [PubMed ID: 9163451]. [PubMed Central ID: PMC229756].
  • 13.
    Loehfelm TW, Luke NR, Campagnari AA. Identification and characterization of an Acinetobacter baumannii biofilm-associated protein. J Bacteriol. 2008;190(3):1036-44. [PubMed ID: 18024522]. [PubMed Central ID: PMC2223572]. https://doi.org/10.1128/JB.01416-07.
  • 14.
    de Breij A, Gaddy J, van der Meer J, Koning R, Koster A, van den Broek P, et al. CsuA/BABCDE-dependent pili are not involved in the adherence of Acinetobacter baumannii ATCC19606(T) to human airway epithelial cells and their inflammatory response. Res Microbiol. 2009;160(3):213-8. [PubMed ID: 19530313]. https://doi.org/10.1016/j.resmic.2009.01.002.
  • 15.
    Tomaras AP, Flagler MJ, Dorsey CW, Gaddy JA, Actis LA. Characterization of a two-component regulatory system from Acinetobacter baumannii that controls biofilm formation and cellular morphology. Microbiology. 2008;154(Pt 11):3398-409. [PubMed ID: 18957593]. https://doi.org/10.1099/mic.0.2008/019471-0.
  • 16.
    Modarresi F, Azizi O, Shakibaie MR, Motamedifar M, Mansouri S. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii. Iran J Microbiol. 2016;8(2):139-46. [PubMed ID: 27307980]. [PubMed Central ID: PMC4906721].
  • 17.
    Seifi K, Kazemian H, Heidari H, Rezagholizadeh F, Saee Y, Shirvani F, et al. Evaluation of Biofilm Formation Among Klebsiella pneumoniae Isolates and Molecular Characterization by ERIC-PCR. Jundishapur J Microbiol. 2016;9(1). e30682. [PubMed ID: 27099694]. [PubMed Central ID: PMC4834130]. https://doi.org/10.5812/jjm.30682.
  • 18.
    Arciola CR, Campoccia D, Gamberini S, Cervellati M, Donati E, Montanaro L. Detection of slime production by means of an optimised Congo red agar plate test based on a colourimetric scale in Staphylococcus epidermidis clinical isolates genotyped for ica locus. Biomaterials. 2002;23(21):4233-9. [PubMed ID: 12194526].
  • 19.
    Yousefi M, Pourmand MR, Fallah F, Hashemi A, Mashhadi R, Nazari-Alam A. Characterization of Staphylococcus aureus Biofilm Formation in Urinary Tract Infection. Iran J Public Health. 2016;45(4):485-93. [PubMed ID: 27252918]. [PubMed Central ID: PMC4888176].
  • 20.
    Fallah F, Noori M, Hashemi A, Goudarzi H, Karimi A, Erfanimanesh S, et al. Prevalence of bla NDM, bla PER, bla VEB, bla IMP, and bla VIM Genes among Acinetobacter baumannii Isolated from Two Hospitals of Tehran, Iran. Scientifica (Cairo). 2014;2014:245162. [PubMed ID: 25133013]. [PubMed Central ID: PMC4123593]. https://doi.org/10.1155/2014/245162.
  • 21.
    Barrios AF, Zuo R, Ren D, Wood TK. Hha, YbaJ, and OmpA regulate Escherichia coli K12 biofilm formation and conjugation plasmids abolish motility. Biotechnol Bioeng. 2006;93(1):188-200. [PubMed ID: 16317765]. https://doi.org/10.1002/bit.20681.
  • 22.
    Rao RS, Karthika RU, Singh SP, Shashikala P, Kanungo R, Jayachandran S, et al. Correlation between biofilm production and multiple drug resistance in imipenem resistant clinical isolates of Acinetobacter baumannii. Indian J Med Microbiol. 2008;26(4):333-7. [PubMed ID: 18974485].
  • 23.
    Sechi LA, Karadenizli A, Deriu A, Zanetti S, Kolayli F, Balikci E, et al. PER-1 type beta-lactamase production in Acinetobacter baumannii is related to cell adhesion. Med Sci Monit. 2004;10(6):BR180-4. [PubMed ID: 15173664].
  • 24.
    Wroblewska MM, Sawicka-Grzelak A, Marchel H, Luczak M, Sivan A. Biofilm production by clinical strains of Acinetobacter baumannii isolated from patients hospitalized in two tertiary care hospitals. FEMS Immunol Med Microbiol. 2008;53(1):140-4. [PubMed ID: 18400015]. https://doi.org/10.1111/j.1574-695X.2008.00403.x.
  • 25.
    Adams MD, Goglin K, Molyneaux N, Hujer KM, Lavender H, Jamison JJ, et al. Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii. J Bacteriol. 2008;190(24):8053-64. [PubMed ID: 18931120]. [PubMed Central ID: PMC2593238]. https://doi.org/10.1128/JB.00834-08.
  • 26.
    McQueary CN, Actis LA. Acinetobacter baumannii biofilms: variations among strains and correlations with other cell properties. J Microbiol. 2011;49(2):243-50. [PubMed ID: 21538245]. https://doi.org/10.1007/s12275-011-0343-7.
  • 27.
    Yong D, Shin JH, Kim S, Lim Y, Yum JH, Lee K, et al. High prevalence of PER-1 extended-spectrum beta-lactamase-producing Acinetobacter spp. in Korea. Antimicrob Agents Chemother. 2003;47(5):1749-51. [PubMed ID: 12709353]. [PubMed Central ID: PMC153336].
  • 28.
    Lee HW, Koh YM, Kim J, Lee JC, Lee YC, Seol SY, et al. Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces. Clin Microbiol Infect. 2008;14(1):49-54. [PubMed ID: 18005176]. https://doi.org/10.1111/j.1469-0691.2007.01842.x.

Copyright

Copyright © 2018, Archives of Clinical Infectious Diseases. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

1
Jan
2014

Assessment of Biofilm Formation and Resistance to Imipenem and Ciprofloxacin among Clinical Isolates of Acinetobacter baumannii in Tehran

Ahya Abdi-Ali,
Saghar Hendiani,
Parisa Mohammadi,
Sara Gharavi

Abdi-Ali A, Hendiani S, Mohammadi P, Gharavi S. Assessment of Biofilm Formation and Resistance to Imipenem and Ciprofloxacin among Clinical Isolates of Acinetobacter baumannii in Tehran. Jundishapur J Microbiol. 2014;7(1):e8606. doi: https://doi.org/10.5812/jjm.8606

23
Apr
2019
85766

Detection of Genes Involved in Biofilm Formation in MDR and XDR Acinetobacter baumannii Isolated from Human Clinical Specimens in Isfahan, Iran

Ahad Mahmoudi Monfared,
Aliakbar Rezaei,
Farkhondeh Poursina,
Jamshid Faghri

Mahmoudi Monfared A, Rezaei A, Poursina F, Faghri J. Detection of Genes Involved in Biofilm Formation in MDR and XDR Acinetobacter baumannii Isolated from Human Clinical Specimens in Isfahan, Iran. Arch Clin Infect Dis. 2019;14(2):e85766. doi: https://doi.org/10.5812/archcid.85766

18
Jul
2018
The Relationship Between Antibiotic Resistance Phenotypes and Biofilm Formation Capacity in Clinical Isolates of <i>Acinetobacter baumannii</i>

The Relationship Between Antibiotic Resistance Phenotypes and Biofilm Formation Capacity in Clinical Isolates of Acinetobacter baumannii

Sara Rahimi,
Zahra Farshadzadeh,
Behrouz Taheri,
Mohsen Mohammadi,
Mohammad-Ali Haghighi,
Abbas Bahador

Rahimi S, Farshadzadeh Z, Taheri B, Mohammadi M, Haghighi M, et al. The Relationship Between Antibiotic Resistance Phenotypes and Biofilm Formation Capacity in Clinical Isolates of Acinetobacter baumannii. Jundishapur J Microbiol. 2018;11(8):e74315. doi: https://doi.org/10.5812/jjm.74315

3
Aug
2022
Gene Cell Tissue

Expression of bap Gene in Clinical Acinetobacter baumannii Isolates in Khorramabad, Iran

Pegah Shakib,
Shahnaz Halimi,
Faranak Rezaei,
Somayeh Delfani

Shakib P, Halimi S, Rezaei F, Delfani S. Expression of bap Gene in Clinical Acinetobacter baumannii Isolates in Khorramabad, Iran. Gene Cell Tissue. 2022;10(2):e124061. doi: https://doi.org/10.5812/gct-124061

13
Jun
2023

Expression of Biofilm-Related Genes in Extensively Drug-Resistant Acinetobacter baumannii

Maryam Khosravy,
Farzaneh Hosseini,
Mohamad Reza Razavi,
Ramazan Ali Khavari

Khosravy M, Hosseini F, Razavi MR, Khavari RA. Expression of Biofilm-Related Genes in Extensively Drug-Resistant Acinetobacter baumannii. Jundishapur J Microbiol. 2023;16(4):e133999. doi: https://doi.org/10.5812/jjm-133999

Download PDF213.51 KB
Indexed in

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles