Staphylococcus epidermidis, Clonality and Accessory Gene Regulator Diversity in Clinical Isolates

Author(s):
Shahin Najar-PeerayehShahin Najar-Peerayeh1, Mehrdad  BehmaneshMehrdad BehmaneshMehrdad  Behmanesh ORCID2, Ali Jazayeri MoghadasAli Jazayeri Moghadas3,*
1Department of Bacteriology, Faculty of Medical Science, Tarbiat Modares University, Tehran, Iran
2Department of Genetic, Faculty of Biological Science, Tarbiat Modares University, Tehran, Iran
3Department of Bacteriology and Virology, Faculty of Medicine, Semnan University of Medical Sciences, Semnan , Iran
*Corresponding Author: Department of Bacteriology and Virology, Faculty of Medicine, Semnan University of Medical Sciences, Semnan, Iran. Tel: +98-9124388188, Email: [email protected]

Archives of Clinical Infectious Diseases:Vol. 13, issue 4; e62833
Published online:Aug 05, 2018
Article type:Research Article
Received:Oct 17, 2016
Accepted:Mar 10, 2018
How to Cite:Najar-Peerayeh S, Behmanesh M, Jazayeri Moghadas A. Staphylococcus epidermidis, Clonality and Accessory Gene Regulator Diversity in Clinical Isolates. Arch Clin Infect Dis. 2018;13(4):e62833. doi: https://doi.org/10.5812/archcid.62833

Abstract

Background:

Quorum-sensing systems are considered as important mechanisms for pathogenesis and bacterial communication. The accessory gene regulator (agr) is one of the quorum-sensing systems in staphylococci, which is generally conserved. It is believed that there is a correlation between agr groups and infection. Multiple-locus VNTR analysis is a method for bacterial typing, previously applied for several different species of bacteria. This study aimed at determining the diversity of Staphylococcus epidermidis accessory gene regulator and clonality in clinical isolates from intensive care unit patients, Tehran, Iran.

Methods:

A total of 59 Staphylococcus epidermidis isolates were obtained from intensive care unit patients. The MLVA was performed for S. epidermidis isolates, using seven VNTR loci, including SE2395, SE0331, SE 828, SE1632, SE0175, Se2, and Se4. Specific primers were used for agr diversity determination.

Results:

The agr type I was observed in 29 (49%), while each of the agr type II and agr type III were observed in 10 (17%). Furthermore, 10 (17%) isolates were untypeable with using primers. In total, 49 MLVA genotypes were discriminated. Isolates were classified to six clonal complexes. Of the 59 isolate, 33 were included in clonal complex 1 (CC1), the largest of which harbored 15 (45.4%) agr type I.

Conclusions:

Agr type I was observed in the majority of the isolates. The MLVA results of this study suggest that there was a clone with 33 samples, comprised of 56% of isolates; smaller clones each comprised of two to seven isolates, and four isolates in the form of singleton. It seems that big clone isolates were settled in the intensive care unit (ICU), and singleton isolates entered the ward by visitors or medical personnel and caused infection.

1. Background

Staphylococcus epidermidis is considered as part of the body’s normal flora for a long time without any pathogenic significance. Nowadays, S. epidermidis is identified as one of the bacterial causes of opportunistic pathogen in implant-associated and nosocomial infections and regarded as one of the top nosocomial infection causes (1, 2). Quorum-sensing systems are considered as important mechanisms for pathogenesis and bacterial communication (3, 4). The accessory gene regulator (agr) system is one of the best known quorum-sensing systems in staphylococci (4, 5). The agr quorum-sensing system regulates certain bacterial activities, such as biofilm formation, symbiosis, virulence, competence, conjugation, antibiotic production, motility, and sporulation (6-8). The agr system, which is generally conserved in staphylococci, encoded by agr locus, comprises of two transcripts, called RNAII and RNAIII (9-11). There are three different agr types in clinical isolates of S. epidermidis (6). Some reports have suggested a correlation between agr groups and infection (12).
The most fundamental concept of epidemiological typing is whether the isolates, which are isolated from infections, belong to a chain of transmissions and correlate with each other, in other words, whether they have a common ancestor (13). Genotypic and phenotypic diversity have been created due to point mutation, recombination or other addition methods as well as deletion of mobile genetic elements (14). Different methods of typing and criteria are used to determine the closeness of strains, although time and place should also be considered (13-16).
Staphylococcus epidermidis is one of the most important causes of catheter-related nosocomial infections. About 70% of strains isolated from the hospital environment are methicillin-resistant and most of them are resistant to almost all antibiotics. The ability of quick and accurate recognition of the relationships between clinical isolates is critical to study possible outbreaks and cross-transmission of bacteria. The results of different molecular methods on Staphylococcus epidermidis suggest a considerable genetic diversity. Despite the observable variability, these methods are able to differentiate the strains in different patients, wards, or hospitals, and are considered valuable tools for controlling infections caused by Staphylococcus epidermidis (17). Multiple-Locus VNTR analysis (MLVA) is designed based on the number of replicates of short repetitive sequences in the target locus of the bacterial genome and based on polymerase chain reaction by a simple method and at a low cost, and provides numerical data of the number of repetitions in a locus. The number of replicate copies varies among different strains. These sequences are known as VNTR, and the analysis of the number of VNTR is called Multiple-Locus VNTR analysis (MLVA). This method is reliable, rapid and low-cost, and can provide transferable information in the form of codes that can be saved in databases and exchanged between different laboratories. Working with the genetic material of bacteria does not have the risk of exposure to live microorganisms and is one of the advantages of this method (2). The MLVA is a method for typing bacteria, which has been applied to several different species of bacteria. This method has appropriate differentiation power, is low cost, does not take long to run, and can be performed for a large number of samples (18-25).

2. Objectives

This study aimed at determining the diversity of Staphylococcus epidermidis accessory gene regulator and clonality in clinical isolates from intensive care unit patients of Tehran, Iran.

3. Methods

3.1. Bacterial Isolates

A total of 59 Staphylococcus epidermidis isolates were obtained from intensive care unit patients of a teaching hospital, during year 2013, Tehran, Iran, in a cross-sectional study. Strains were isolated from blood (n = 50), urine (n = 4), tracheal (n = 4), and wound (n = 1) samples. In order to identify S.epidermidis, conventional bacteriological tests were performed. At first, the sample was cultured on sheep blood agar (Merck, Germany) under aerobic conditions and overnight at 37°C; suspected colonies were identified by performing Gram staining, catalase test, growth on mannitol salt agar (Merck, Germany), without mannitol fermentation, tube coagulase test with rabbit plasma, ability of urease production, D-manose and D-maltose fermentation, and no fermentation of D-trehalose (26, 27).

3.2. DNA Extraction

DNA of each S. epidermidis isolate was extracted from 1 mL of overnight bacterial culture. Extraction was performed by adding 10 mmol/L tris and 1 mmol/L ethylene diamine tetraacetic acid (pH = 8) buffer and lysostaphin, at 95°C for five minutes, then 0°C for five minutes, and centrifuged in 10000 r/minute for five minutes. The supernatant was used as the template DNA in polymerase chain reaction (PCR). DNA was measured using a BioPhotometer (Eppendorf, Germany) to determine the concentration and purity (2, 28, 29).

3.3. Multi Locus VNTR Analysis (MLVA) and agr Typing

The MLVA was performed for S. epidermidis isolates, using seven VNTR loci, including SE2395, SE0331, SE 828, SE1632, SE0175, Se2, and Se4, as previously described (16, 17). Polymerase chain reaction was performed for each locus in a 25-μL volume PCR reaction containing specific primers (Pishgam biotech, Iran). The loci, tandem repeat sizes, and primers are listed in Table 1.
Table 1.Loci, Tandem Repeat Sizes, and Primers for Multi Locus VNTR Analysis
VNTR LocusSequence (5→3)PCR ConditionLeft Flanking SequenceRight Flanking SequenceTandem SizeExpected Size of Strain ATCC 12228, bpReference
SE2395 (Fibrinogen binding protein)Forward: CAGGCCATATAGACCTGGCTTG2 min, 94°C; 35 cycles of: 15 s, 94°C; 20 s, 60°C; 70 s, 72°C; final extension, 10 min, 72°C140499181625(17)
Reverse: TGCTGATGGGGAAGATGTTCGTG
SE0331 (sdrG protein)Forward: ATGGGGAAGAAGTCCATGTA 2 min, 94°C; 35 cycles of: 15 s, 94°C; 20 s, 55°C; 60 s, 72°C; final extension, 10 min, 72°C725918671(17)
Reverse: CATTAGCTCCTGTATCCGGT
SE 828 (cell wall surface protein)Forward: TGCCACTGGTAATCAAAATG 2 min, 94°C; 35 cycles of: 15 s, 94°C; 20 s, 55°C; 60 s, 72°C; final extension, 10 min, 72°C13420273815(17)
Reverse: GCATCTTTATCTGTACCGCC
SE1632 (sdrH protein)Forward: ATGACACTAGTCGCACAGGA 2 min, 94°C; 35 cycles of: 15 s, 94°C; 20 s, 55°C; 60 s, 72°C; final extension, 10 min, 72°C943418468(17)
Reverse: CGGTATGTGAACCCTTACCT
SE0175 (aap)Forward: TGAAGCACCACAGATGTCTTCTAC 2 min, 94°C; 35 cycles of: 15 s, 94°C; 20 s, 55°C; 60 s, 72°C; final extension, 10 min, 72°C316148129(17)
Reverse: GGGCTTCTGAAAATTGTGTT
Se2Forward: AGGCCCAAATAAAAAGCAAA 10 min, 95°C; 30 cycles of: 1 min, 95°C; 1 min, 55°C; 1 min72°C; final extension, 5 min, 72°C2216158524(16)
Reverse: AACTGACGCTCCAGGAGAAG
Se4 (PTS enzyme II)Forward: TTCATTGTCCCCTGTCTTCT 10 min, 95°C; 30 cycles of: 1 min, 95°C; 1 min, 55°C; 1 min72°C; final extension, 5 min, 72°C718357381(16)
Reverse: TCGATCCTGGTAAAGCGATTA
Specific primers were used for agr diversity determination (30). DNA amplification was performed in a 25-μL PCR reaction. Multiplex PCR conditions were as follows: five minutes, 95°C; 30 cycles of one minute at 94°C; one minute at 55°C; one minute at 72°C; and final extension, 10 minutes at 72°C. Specific primers for different types of agr are shown in Table 2.
Table 2.Specific Primers for Different Types of agr
agr TypeSequence (5→3)Expected Size, bpReference
Type IForward: GGCATTAGTCGGATTAATTATTACG438(30)
Reverse: TGTAGGCCTGCAAACGG
Type IIForward: TTTACCATTTGCAGCTATACAAGTG575(30)
Reverse: ATAACAATAATATAACCAAACTCAAAAGTACAG
Type IIIForward: GAAAGAGTGTATTCAATGGATGAGC338(30)
Reverse: TAAATATTATGTATTATATCTTCAGTATATAAAGAGATGA
Amplification was performed in a MJ mini Gradient thermal cycler PTC-1148, USA. The amplified products were visualized by UV light after electrophoresis on 1% agarose gel. A positive control (S. epidermidis ATCC 12228) and negative control (reaction mixture without DNA) were included in each PCR run.

3.4. Data Analysis

The number of repeats and their length were calculated as follows: each amplicon was read, and the size of flanking regions was subtracted from the amplicon size, and then divided by Tandem size. The number of repetitions of each tandem was categorized and analyzed, unweighted pair group method with arithmetic averages (UPGMA) dendrogram, and minimum spanning tree (MST), were constructed as previously described (31-33). The MLVA plus online software was used for the MLVA typing data analysis.

4. Results

Of the 59 Staphylococcus epidermidis isolates obtained from intensive care unit patients, agr type I was observed in 29 (49%), while each of the agr type II and agr type III were observed in 10 (17%) cases. Ten (17%) of the isolates were untypeable with using primers.
The MLVA was performed for seven VNTR loci; a total of 49 MLVA genotypes were discriminated. Isolates were classified to six clonal complexes. Of the 59 isolates, 33 were included in clonal complex 1 (CC1), which was the largest, and among them, 15 (45.4%) harbored agr type I, five (15.2%) agr type II, five (15.2%) agr type III, and six (18.2%) were recognized as non-typeable. CC2, CC3, CC4, CC5, and CC6 included seven, five, five, three, and isolates, respectively. In CC3, all of isolates were categorized as agr type I, while all of isolates in CC5 were classified as non-typeable. Four isolates were classified as singleton, which were different in two or more loci and unrelated to other clonal complexes. The unweighted pair group method with arithmetic averages (UPGMA) dendrogram is shown in Figure 1, the minimum spanning tree (MST) is shown in Figure 2, and the correlation of clonal complexes and agr types is shown in Figure 3.
UPGMA dendrogram, B: blood, U: urine, T: tracheal, W: wound.
Figure 1.

UPGMA dendrogram, B: blood, U: urine, T: tracheal, W: wound.

Minimum spanning tree (MST) representation. Each MLVA profile is shown by a circle, small circle presents one, medium circle presents two, and large circle presents three isolates. The number of loci, which differed between two MLVA profiles is indicated on the lines connecting the MLVA profiles.
Figure 2.

Minimum spanning tree (MST) representation. Each MLVA profile is shown by a circle, small circle presents one, medium circle presents two, and large circle presents three isolates. The number of loci, which differed between two MLVA profiles is indicated on the lines connecting the MLVA profiles.

Correlation of clonal complexes and <i>agr</i> types. NT: nontypeable, 1: <i>agr</i> typeI, 2: <i>agr</i> typeII, 3: <i>agr</i> typeIII.
Figure 3.

Correlation of clonal complexes and agr types. NT: nontypeable, 1: agr typeI, 2: agr typeII, 3: agr typeIII.

5. Discussion

This research attempted to determine agr diversity and genetic relatedness of 59 Staphylococcus epidermidis isolates obtained from intensive care unit patients of Tehran, Iran. In this study, agr type I was the most frequent agr type (49%). This amount was reported in the United State of America (34) and China (35) as 89% and 68.2%, respectively, which was significantly higher than the present study. In France the frequency of type I agr in Staphylococcusepidermidis was reported as 48.5% by Lina et al. (30), which was not significantly different to the findings of the current study. agr type II was found in ten (17%) of the investigated isolates, and did not show significant differences with 11% and 19.3% reported in the United State of America (34) and China (35), respectively. However, it was significantly lower than 31.8% in France (30). agr type III was found in ten (17%) of this study isolates, which was significantly lower than 49% in France (30), higher than 0% reported in United State of America (34), and had no difference with 12.5% reported in China (35). In this study, ten isolates were not typeable using primers, which was significantly higher than 0% and 2% reported in United State of America (34) and France (30), respectively.
Using MLVA in 59 isolates, 49 different genotypes and six clonal complexes were identified. The CC1 included 33 isolates that comprised 56% of the isolates. This clonal complex may indicate the establishment of Staphylococcus epidermidis at the intensive care unit (ICU). Given that the samples were collected during the interval of about one year, a little variation in this clonal complex was not unexpected. Several other clonal complexes with a small number of isolates in each could indicate the entry of a new bacteria in the ward and its settlement. The isolates, identified as singleton, are possibly bacteria that have entered the ward by the patient, visitors or medical personnel. Four isolates were also identified as singleton. In Sweden, during years 2001 to 2002, MLVA was conducted for 30 clinical strains of Staphylococcus epidermidis, isolated from different nosocomial infections, and 16 different genotypes were identified. The strains were very close to each other and were disseminated in different hospital wards (16). A total of 96 strains of Staphylococcus epidermidis as part of three collections were studied, including 21 isolates collected from infants in Norway during years 2005 to 2007, 49 strains isolated from 13 patients in Switzerland during years 2002 to 2005, and 26 strains isolated from 12 patients in the USA during years 1990 to 1993. No close relationship was observed between different groups, and similar profiles were not observed in each group either, indicating genetic diversity of isolates in each group (17). In 89 isolates of Staphylococcus epidermidis isolated from nasal swabs of people in an almost separate region in France with an interval of 16 months in October 2006 and June 2008, 62 MLVA profiles were observed that were not associated with the sample isolation time and SCCmec type. Of 45 profiles, each was observed only in one sample (36). The MLVA revealed heterogeneous profiles and high variability in 58 strains of Staphylococcus epidermidis isolated from nasal samples of orthopedic surgery patients in a hospital in Paris, during year 2005. No relationship was observed between MLVA profile and the SCCmec type (37).
Given that the strains of the present study were collected from the ICU, the results of this study are similar to a study conducted in Sweden (16), while they are different from other studies (17, 36, 37), in which nasal isolates or isolates with different sources were investigated.

5.1. Conclusion

The MLVA results of this study suggest that big clone isolates were settled at the ICU, while small clone isolates were settled, and singleton isolates entered the ward by visitors or medical personnel and caused infection, also agr type I was observed in the majority of the isolates, which is in accordance with other similar studies.

Acknowledgments

Footnotes

  • Authors’ Contribution:All authors participated in the research design and contributed to different parts of the research.

  • Financial Disclosure:The authors declare that there was no conflict of interest.

  • Funding/Support:This study was performed with a grant from Tarbiat Modares University, faculty of medical sciences, Tehran, Iran.

References

  • 1.
    Mertens A, Ghebremedhin B. Genetic determinants and biofilm formation of clinical Staphylococcus epidermidis isolates from blood cultures and indwelling devises. Eur J Microbiol Immunol (Bp). 2013;3(2):111-9. [PubMed ID: 24265927]. [PubMed Central ID: PMC3832089]. https://doi.org/10.1556/EuJMI.3.2013.2.4.
  • 2.
    Najar-Peerayeh S, Jazayeri Moghadas A, Behmanesh M. Antibiotic Susceptibility and mecA Frequency in Staphylococcus epidermidis, Isolated From Intensive Care Unit Patients. Jundishapur J Microbiol. 2014;7(8). e11188. [PubMed ID: 25485050]. [PubMed Central ID: PMC4255212]. https://doi.org/10.5812/jjm.11188.
  • 3.
    Najar-Peerayeh S, Jazayeri Moghadas A, Bakhshi B. [Staphylococcus epidermidis virulence factor and ability of macroscopic biofilm production]. Koomesh. 2016;17(4):918-23. Persian.
  • 4.
    Cala C, Amodio E, Di Carlo E, Virruso R, Fasciana T, Giammanco A. Biofilm production in Staphylococcus epidermidis strains, isolated from the skin of hospitalized patients: genetic and phenotypic characteristics. New Microbiol. 2015;38(4):521-9. [PubMed ID: 26485010].
  • 5.
    Le KY, Otto M. Quorum-sensing regulation in staphylococci-an overview. Front Microbiol. 2015;6:1174. [PubMed ID: 26579084]. [PubMed Central ID: PMC4621875]. https://doi.org/10.3389/fmicb.2015.01174.
  • 6.
    Olson ME, Todd DA, Schaeffer CR, Paharik AE, Van Dyke MJ, Buttner H, et al. Staphylococcus epidermidis agr quorum-sensing system: signal identification, cross talk, and importance in colonization. J Bacteriol. 2014;196(19):3482-93. [PubMed ID: 25070736]. [PubMed Central ID: PMC4187671]. https://doi.org/10.1128/JB.01882-14.
  • 7.
    Wang R, Khan BA, Cheung GY, Bach TH, Jameson-Lee M, Kong KF, et al. Staphylococcus epidermidis surfactant peptides promote biofilm maturation and dissemination of biofilm-associated infection in mice. J Clin Invest. 2011;121(1):238-48. [PubMed ID: 21135501]. [PubMed Central ID: PMC3007140]. https://doi.org/10.1172/JCI42520.
  • 8.
    Zhang X, Crippen TL, Coates CJ, Wood TK, Tomberlin JK. Effect of Quorum Sensing by Staphylococcus epidermidis on the Attraction Response of Female Adult Yellow Fever Mosquitoes, Aedes aegypti aegypti (Linnaeus) (Diptera: Culicidae), to a Blood-Feeding Source. PLoS One. 2015;10(12). e0143950. [PubMed ID: 26674802]. [PubMed Central ID: PMC4682952]. https://doi.org/10.1371/journal.pone.0143950.
  • 9.
    Yang T, Tal-Gan Y, Paharik AE, Horswill AR, Blackwell HE. Structure-Function Analyses of a Staphylococcus epidermidis Autoinducing Peptide Reveals Motifs Critical for AgrC-type Receptor Modulation. ACS Chem Biol. 2016;11(7):1982-91. [PubMed ID: 27159024]. [PubMed Central ID: PMC4946969]. https://doi.org/10.1021/acschembio.6b00120.
  • 10.
    Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. Accessory gene regulator specificity groups among Staphylococcus aureus isolated from hospitalized children. Arch Pediatr Infect Dis. 2014;3(2). https://doi.org/10.5812/pedinfect.16096.
  • 11.
    Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. Detection of accessory gene regulator groups genes and cassette chromosome mec types among Staphylococcus aureus isolated from intensive care unit patients. Asian Pac J Trop Dis. 2015;5(2):153-7. https://doi.org/10.1016/s2222-1808(14)60643-5.
  • 12.
    Traber KE, Lee E, Benson S, Corrigan R, Cantera M, Shopsin B, et al. agr function in clinical Staphylococcus aureus isolates. Microbiology. 2008;154(Pt 8):2265-74. [PubMed ID: 18667559]. [PubMed Central ID: PMC4904715]. https://doi.org/10.1099/mic.0.2007/011874-0.
  • 13.
    Nadon CA, Trees E, Ng LK, Moller Nielsen E, Reimer A, Maxwell N, et al. Development and application of MLVA methods as a tool for inter-laboratory surveillance. Euro Surveill. 2013;18(35):20565. [PubMed ID: 24008231]. [PubMed Central ID: PMC5667538]. https://doi.org/10.2807/1560-7917.ES2013.18.35.20565.
  • 14.
    van Belkum A. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol Med Microbiol. 2007;49(1):22-7. [PubMed ID: 17266711]. https://doi.org/10.1111/j.1574-695X.2006.00173.x.
  • 15.
    Namvar AE, Bastarahang S, Abbasi N, Ghehi GS, Farhadbakhtiarian S, Arezi P, et al. Clinical characteristics of Staphylococcus epidermidis: a systematic review. GMS Hyg Infect Control. 2014;9(3):Doc23. [PubMed ID: 25285267]. [PubMed Central ID: PMC4184040]. https://doi.org/10.3205/dgkh000243.
  • 16.
    Johansson A, Koskiniemi S, Gottfridsson P, Wistrom J, Monsen T. Multiple-locus variable-number tandem repeat analysis for typing of Staphylococcus epidermidis. J Clin Microbiol. 2006;44(1):260-5. [PubMed ID: 16390986]. [PubMed Central ID: PMC1351942]. https://doi.org/10.1128/JCM.44.1.260-265.2006.
  • 17.
    Francois P, Hochmann A, Huyghe A, Bonetti EJ, Renzi G, Harbarth S, et al. Rapid and high-throughput genotyping of Staphylococcus epidermidis isolates by automated multilocus variable-number of tandem repeats: a tool for real-time epidemiology. J Microbiol Methods. 2008;72(3):296-305. [PubMed ID: 18237794]. https://doi.org/10.1016/j.mimet.2007.12.007.
  • 18.
    Diaz MH, Winchell JM. The Evolution of Advanced Molecular Diagnostics for the Detection and Characterization of Mycoplasma pneumoniae. Front Microbiol. 2016;7:232. [PubMed ID: 27014191]. [PubMed Central ID: PMC4781879]. https://doi.org/10.3389/fmicb.2016.00232.
  • 19.
    Knetsch CW, Lawley TD, Hensgens MP, Corver J, Wilcox MW, Kuijper EJ. Current application and future perspectives of molecular typing methods to study Clostridium difficile infections. Euro Surveill. 2013;18(4):20381. [PubMed ID: 23369393]. https://doi.org/10.2807/ese.18.04.20381-en.
  • 20.
    Heilbronn C, Munnoch S, Butler MT, Merritt TD, Durrheim DN. Timeliness of Salmonella Typhimurium notifications after the introduction of routine MLVA typing in NSW. N S W Public Health Bull. 2014;24(4):159-63. [PubMed ID: 24939225]. https://doi.org/10.1071/NB13010.
  • 21.
    Najar Peerayeh S, Karmostaji A. Molecular Identification of Resistance Determinants, Integrons and Genetic Relatedness of Extensively Drug Resistant Acinetobacter baumannii Isolated From Hospitals in Tehran, Iran. Jundishapur J Microbiol. 2015;8(7). e27021. [PubMed ID: 26421140]. [PubMed Central ID: PMC4584074]. https://doi.org/10.5812/jjm.27021v2.
  • 22.
    Ranjbar R, Memariani M, Memariani H. Diversity of Variable Number Tandem Repeat Loci in Shigella Species Isolated from Pediatric Patients. Int J Mol Cell Med. 2015;4(3):174-81. [PubMed ID: 26629486]. [PubMed Central ID: PMC4644529].
  • 23.
    Ranjbar R, Memariani M. Multilocus variable-number tandem-repeat analysis for genotyping of Shigella sonnei strains isolated from pediatric patients. Gastroenterol Hepatol Bed Bench. 2015;8(3):225-32. [PubMed ID: 26328045]. [PubMed Central ID: PMC4553163].
  • 24.
    Memariani M, Najar Peerayeh S, Zahraei Salehi T, Shokouhi Mostafavi SK. Occurrence of SHV, TEM and CTX-M beta-Lactamase Genes Among Enteropathogenic Escherichia coli Strains Isolated From Children With Diarrhea. Jundishapur J Microbiol. 2015;8(4). e15620. [PubMed ID: 26034531]. [PubMed Central ID: PMC4449847]. https://doi.org/10.5812/jjm.8(4)2015.15620.
  • 25.
    Ranjbar R, Sadeghy J, Shokri Moghadam M, Bakhshi B. Multi-locus variable number tandem repeat analysis of Vibrio cholerae isolates from 2012 to 2013 cholera outbreaks in Iran. Microb Pathog. 2016;97:84-8. [PubMed ID: 27247094]. https://doi.org/10.1016/j.micpath.2016.05.023.
  • 26.
    Forbes BA, Sahm DF, Weissfeld AS. Study Guide for Bailey and Scott's Diagnostic Microbiology. Maryland Heights, Missouri, USA: Mosby; 2007.
  • 27.
    Peacock SJ. Staphylococcus. In: Borriello SP, Murray PR, Funke G, editors. Topley wilson's Microbiology and Microbial Infections. 10th ed. London: Hodder Arnold; 2005. p. 771-816.
  • 28.
    Najar Peerayeh S, Jazayeri Moghadas A, Behmanesh M. Prevalence of Virulence-Related Determinants in Clinical Isolates of Staphylococcus epidermidis. Jundishapur J Microbiol. 2016;9(8). e30593. [PubMed ID: 27800129]. [PubMed Central ID: PMC5078722]. https://doi.org/10.5812/jjm.30593.
  • 29.
    Najar-Peerayeh S, Moghaddas AJ, Bakhshi B, Ghasemian A. Diversity of the SCCmec types among Staphylococcus epidermidis clinical isolates from intensive care unit patients. Asian Pac J Trop Dis. 2016;6(2):133-5. https://doi.org/10.1016/s2222-1808(15)60998-7.
  • 30.
    Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F. Bacterial competition for human nasal cavity colonization: role of Staphylococcal agr alleles. Appl Environ Microbiol. 2003;69(1):18-23. [PubMed ID: 12513972]. [PubMed Central ID: PMC152380]. https://doi.org/10.1128/AEM.69.1.18-23.2003.
  • 31.
    Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol. 1988;26(11):2465-6. [PubMed ID: 3069867]. [PubMed Central ID: PMC266921].
  • 32.
    Grundmann H, Hori S, Tanner G. Determining confidence intervals when measuring genetic diversity and the discriminatory abilities of typing methods for microorganisms. J Clin Microbiol. 2001;39(11):4190-2. [PubMed ID: 11682558]. [PubMed Central ID: PMC88515]. https://doi.org/10.1128/JCM.39.11.4190-4192.2001.
  • 33.
    Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999;27(2):573-80. [PubMed ID: 9862982]. [PubMed Central ID: PMC148217]. https://doi.org/10.1093/nar/27.2.573.
  • 34.
    Carmody AB, Otto M. Specificity grouping of the accessory gene regulator quorum-sensing system of Staphylococcus epidermidis is linked to infection. Arch Microbiol. 2004;181(3):250-3. [PubMed ID: 14714104]. https://doi.org/10.1007/s00203-003-0644-2.
  • 35.
    Li M, Guan M, Jiang XF, Yuan FY, Xu M, Zhang WZ, et al. Genetic polymorphism of the accessory gene regulator (agr) locus in Staphylococcus epidermidis and its association with pathogenicity. J Med Microbiol. 2004;53(Pt 6):545-9. [PubMed ID: 15150336]. https://doi.org/10.1099/jmm.0.05406-0.
  • 36.
    Lebeaux D, Barbier F, Angebault C, Benmahdi L, Ruppe E, Felix B, et al. Evolution of nasal carriage of methicillin-resistant coagulase-negative staphylococci in a remote population. Antimicrob Agents Chemother. 2012;56(1):315-23. [PubMed ID: 22064532]. [PubMed Central ID: PMC3256065]. https://doi.org/10.1128/AAC.00547-11.
  • 37.
    Barbier F, Ruppe E, Hernandez D, Lebeaux D, Francois P, Felix B, et al. Methicillin-resistant coagulase-negative staphylococci in the community: high homology of SCCmec IVa between Staphylococcus epidermidis and major clones of methicillin-resistant Staphylococcus aureus. J Infect Dis. 2010;202(2):270-81. [PubMed ID: 20550456]. https://doi.org/10.1086/653483.

Copyright

Copyright © 2018, Archives of Clinical Infectious Diseases. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

3
Oct
2016

Molecular Characterization of Staphylococcus epidermidis Isolates Collected From an Intensive Care Unit

Amirmorteza Ebrahimzadeh Namvar,
Seyed Asghar Havaei,
Leila Azimi,
Abdolaziz Rastegar Lari,
Ramazan Rajabnia

Ebrahimzadeh Namvar A, Havaei SA, Azimi L, Rastegar Lari A, Rajabnia R. Molecular Characterization of Staphylococcus epidermidis Isolates Collected From an Intensive Care Unit. Arch Pediatr Infect Dis. 2017;5(2):e36176. doi: https://doi.org/10.5812/pedinfect.36176

24
Apr
2018
Molecular Investigation of Methicillin-Resistant <i>Staphylococcus aureus</i> Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and <i>agr</i> Locus Type Analysis

Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis

Sara Nasirian,
Sara Saadatmand,
Hossein Goudarzi,
Mehdi Goudarzi,
Hadi Azimi

Nasirian S, Saadatmand S, Goudarzi H, Goudarzi M, Azimi H. Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis. Arch Clin Infect Dis. 2018;13(2):e14495. doi: https://doi.org/10.5812/archcid.14495

13
Feb
2016

Prevalence of Virulence-Related Determinants in Clinical Isolates of Staphylococcus epidermidis

Shahin Najar Peerayeh,
Ali Jazayeri Moghadas,
Mehrdad Behmanesh

Najar Peerayeh S, Jazayeri Moghadas A, Behmanesh M. Prevalence of Virulence-Related Determinants in Clinical Isolates of Staphylococcus epidermidis. Jundishapur J Microbiol. 2016;9(8):e30593. doi: https://doi.org/10.5812/jjm.30593

8
Jan
2017

Molecular Characterization of Staphylococcus epidermidis Isolates Recovered from Patients Admitted to a Referral Hospital in Iran

Amirmorteza Ebrahimzadeh Namvar,
Seyed Asghar Havaei,
Masoumeh Douraghi

Ebrahimzadeh Namvar A, Havaei SA, Douraghi M. Molecular Characterization of Staphylococcus epidermidis Isolates Recovered from Patients Admitted to a Referral Hospital in Iran. Arch Clin Infect Dis. 2017;12(2):e38675. doi: https://doi.org/10.5812/archcid.38675

20
Nov
2017

Distribution of Genes Encoding Toxin, Adhesion, and Antibacterial Resistance Among Various SCCmec Types of Methicillin-Resistant Staphylococcus aureus Isolated From Intensive Care Unit, Tehran, Iran

Parnaz Abiri,
Abbas Akhavan Sepahi,
Hossein Goudarzi,
Mehdi Goudarzi

Abiri P, Akhavan Sepahi A, Goudarzi H, Goudarzi M. Distribution of Genes Encoding Toxin, Adhesion, and Antibacterial Resistance Among Various SCCmec Types of Methicillin-Resistant Staphylococcus aureus Isolated From Intensive Care Unit, Tehran, Iran. Jundishapur J Microbiol. 2017;10(12):e14477. doi: https://doi.org/10.5812/jjm.14477

Download PDF1.70 MB
Indexed in

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles