Arch Clin Infect Dis

Image Credit:Arch Clin Infect Dis

Evaluation of β-lactamases and Molecular Typing of Pseudomonas aeruginosa Clinical Strains Isolated from Hospitalized Children in Tehran, Iran

Author(s):
Hossein  GoudarziHossein GoudarziHossein  Goudarzi ORCID1,*, Narjess BostanghadiriNarjess Bostanghadiri2, Zahra Riahi RadZahra Riahi Rad1, Zohreh Riahi RadZohreh Riahi Rad1, Javad Yasbolaghi SharahiJavad Yasbolaghi Sharahi1
1Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Microbiology, School of Medicine, Iran University of Medical Sciences, Tehran, Iran

Archives of Clinical Infectious Diseases:Vol. 18, issue 2; e134837
Published online:Jun 20, 2023
Article type:Research Article
Received:Jan 16, 2023
Accepted:May 14, 2023
How to Cite:Goudarzi H, Bostanghadiri N, Riahi Rad Z, Riahi Rad Z, Yasbolaghi Sharahi J. Evaluation of β-lactamases and Molecular Typing of Pseudomonas aeruginosa Clinical Strains Isolated from Hospitalized Children in Tehran, Iran. Arch Clin Infect Dis. 2023;18(2):e134837. doi: https://doi.org/10.5812/archcid-134837

Abstract

Background:

The opportunistic human pathogen, Pseudomonas aeruginosa, is a critical cause of nosocomial infection with high morbidity and mortality rate. Eradication of P. aeruginosa has been troublesome due to its high capacity to develop strong multidrug resistance (MDR) strians.

Objectives:

The purposes of this study were to define the pattern of antimicrobial sensitivity, typing, and prevalence of metallo-β-lactamase (MBL) and detect the oprD, blaCTX-M, blaSHV, blaTEM, blaIMP, blaNDM, and blaVIM genes among clinical isolates of P. aeruginosa collected from Tehran hospitals.

Methods:

Clinical isolates were collected from hospitalized children in selected hospitals in Tehran from March 2019 to February 2020. The antimicrobial susceptibility test (AST) was performed by the Kirby-Bauer disk diffusion method. Composed disc diffusion tests were performed to screen MBL production. MBLs and extended-spectrum β-lactamases (ESBLs) encoding genes were amplified by polymerase chain reaction (PCR). Amplification of the oprD gene were performed for carbapenem-resistant P. aeruginosa. Random amplified polymorphic DNA (RAPD-PCR) Fingerprinting was used for genotyping the isolates.

Results:

A total of 80 P. aeruginosa isolates were collected. Isolates were resistant to cefepime 35%, ceftazidime 20%, ciprofloxacin 22%, tazobactam 16%. Out of 80 isolates, 16 were carbapenems-resistant. Gentamicin, tobramycin, and amikacin had the highest susceptibilities of 85%,90%, and 90%, respectively. OprD, blaCTX-M, blaSHV, and blaTEM genes were detected in 80(100%), 36(45%), 22 (27.5%), 17 (21.25%), and 1 (1.25%) blaIMP and blaNDM genes, respectively. In this study, the blaVIM gene was not detected in the isolates, and no mutation was observed regarding the presence of an insertion element in the OprD gene. Isolates were divided into 13 and 14 common and single types, respectively.

Conclusions:

P. aeruginosa isolates showed a high rate of β- lactamases production, and the prevalence of carbapenem-resistant, which can be related to different mechanisms, was alarming. On the other hand, the results demonstrated that there was beta-lactam antibiotic resistance and clonal spread among the hospital population. This shows the necessity of molecular surveillance in tracking beta-lactamase-producing strains.

1. Background

Pseudomonas aeruginosa (P. aeruginosa) has long been recognized as an opportunistic bacteria and a leading cause of severe hospital-acquired infections such as endocarditis, septicemia, urinary tract infection (UTI), ventilator-associated pneumonia (VAP), skin, surgical-site infections and eye and ear infections (1, 2). P. aeruginosa inflicts high morbidity and mortality rates, especially among infected burn patients (3, 4).
Treating infections caused by P. aeruginosa has become a worldwide challenge due to the potential of this bacterium to develop resistance to almost all available therapeutic agents (5). Unfortunately, the improper and irrational use of antibiotics has increased the prevalence of third- and fourth-generation cephalosporins and carbapenems-resistant strains (6, 7). It was previously thought that carbapenems were the last-line therapeutic drugs against multidrug-resistant (MDR) P. aeruginosa infections (8, 9). Carbapenem-resistant P. aeruginosa has become a considerable threat to public health worldwide (10). The World Health Organization (WHO) and the Centers for Disease Control and Prevention (CDC) consider carbapenem-resistant P. aeruginosa as one of the strains that require novel therapeutic approaches (10, 11).
Generally, acquired, intrinsic and adaptive resistance are the main coping mechanisms of P. aeruginosa against antibiotics (12). Carbapenem resistance of P. aeruginosa is due to a combination of factors facilitating the production of carbapenemases enzymes such as serine, carbapenemases, and metallo-ß-lactamases (MBLs) (New Delhi metallo-β-lactamase [NDM], imipenemase [IMP], and Verona integrin-encoded metallo-β-lactamase [VIM]), and deficient outer membrane porin D (OprD) (13). blaIMP and blaVIM genes are the most clinically important beta-lactamase classes. blaNDM-1 producing strains are resistant to a wide range of antibiotics and are becoming the foremost threatening carbapenemase (14, 15). The specific porin OprD facilitates the diffusion of small peptides, basic amino acids, and carbapenems into the cell (16, 17). The absence of OprD in P. aeruginosa leads to moderate resistance to imipenem (17, 18). These bacteria also produce plasmid-mediated enzymes that hydrolyze the oxyimino β lactams and the monobactams called expanded spectrum beta-lactamases (ESBLs). ESBLs confer a powerful resistance against ß-lactam antibiotics and third-generation cephalosporins such as ceftazidime, ceftriaxone, and cefotaxime inactive (19).

2. Objectives

The purposes of this study were to determine the antimicrobial susceptibility patterns and prevalence of MBLs, typing the isolates, and detect the oprD, blaCTX-M, blaSHV, blaTEM, blaIMP, blaNDM, and blaVIM genes among clinical isolates of P. aeruginosa collected from several hospitals of Tehran.

3. Methods

3.1. Ethics Approval

This study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences “IR.SBMU.MSP.REC.1400.481.” The patients’ personal information was not collected or included to maintain confidentiality.

3.2. Clinical Samples and Bacterial Identification

Eighty non-duplicate clinical isolates of P. aeruginosa were collected from children hospitalized in Tehran Hospitals from March 2019 to February 2020. Laboratory identification of isolates was performed by standard biochemical tests. All isolates were preserved in trypticase soy broth (Merck) supplemented by 20% glycerol at –70°C. P. aeruginosa ATCC 27853 was used for quality control.

3.3. Antimicrobial Susceptibility Testing

Antibiotic susceptibility of each strain to ceftazidime (30 µg), cefepime (30 µg), imipenem (10 µg), ciprofloxacin (5 µg), piperacillin/tazobactam (100/10 µg), amikacin (30 µg), gentamicin (10 µg), tobramycin (30 µg), were determined by the Kirby-Bauer disk diffusion, following the recommendations of the Clinical and Laboratory Standard Institute (CLSI) (20).

3.4. Screening of Metallo-β-lactamase

All P. aeruginosa isolates were evaluated for production of metallo-β-lactamase (MBL) by the combined disc diffusion test (21, 22), which was performed by imipenem and meropenem alone and in combination with ethylenediaminetetraacetic acid (EDTA) 0.5 M. A difference in zone diameter between discs alone and disc + EDTA 0.5 M ≥ 7 mm was explicated as a positive result for MBL production.

3.5. DNA Extraction

P. aeruginosa isolates were cultivated on Mueller Hinton Broth (Merck, Darmstadt, Germany) for 18 h at 37°C, and genomic DNA was extracted using the boiling method (23). DNA Concentration was evaluated by the Nanodrop instrument (WPA Biowave II Nanospectrophotometer, USA).

3.6. PCR Technique

The presence of extended-spectrum β-lactamases and MBLs genes was examined using the primers presented in Table 1. PCR was executed in a final volume of 25 µL with 12.5 µL of Taq DNA Polymerase 2x Master Mix RED (Amplicon, Denmark; Cat. No.: A190303), including 1 × PCR buffer, three mmol/L MgCl2, 0.4 mmol/L dNTPs and 0.08 IU Taq DNA polymerase, one µL of 10 pmol of each primer and 7.5 µL of sterile distilled water. PCR program was set as follows: initial denaturation at 94°C for 5 min, followed by 36 cycles of 94°C for 1 min, and annealing at 54°C to 60°C, relevant to each primer for 45 s and final extension at 72°C for 5 min. The PCR products were electrophoresed on a 1% agarose gel.
Table 1.List of Primers Used in This Study
Primer’sSequences (5' - 3')Expected Size of Amplicon (bp)
blaIMP587
FGAAGGCGTTTATGTTCATAC
RGTAAGTTTCAAGAGTGATGC
blaVIM390
FGATGGTGTTTGGTCGCATA
RCGAATGCGCAGCACCAG
blaNDM621
FGGTTTGGCGATCTGGTTTTC
RCGGAATGGCTCATCACGATC
blaTEM972
FTCGGGGAAATGTGCGCG
RTGCTTAATCAGTGAGGCACC
blaSIHV861
FTTAGCGTTGCCAGTGCTC
RGGTTATGCGTTATATTCGCC
blaCTX-M544
FTTTGCGATGTGCAGTACCAGTAA
RCGCTATCGTTGGTGGTGCCATA
OprD1329
FATGAAAGTGATGAAGTGGAG
RCAGGATCGACAGCGGATAGT
RAPDCCGCAGCCAA

3.7. Random Amplified Polymorphic DNA Fingerprinting

Random amplified polymorphic DNA (RAPD-PCR) was conducted for all samples in accordance with Vanerkova described method (24). The total volume of the PCR reaction was 25 µL, which included 12.5 µL of 2x Master Mix, 5 µM of primer, and 1 µL of DNA extract. Thermal cycling was conducted with an initial denaturation at 94°C for 15 min, followed by 25 cycles of 94°C for 1 min, 55°C for 2 min, 63°C for 10 min, and concluded by a final extension of 65°C for 18 min. The PCR productions were loaded on the 1.5% agarose gel, and the results were analyzed.

4. Result

4.1. Patients and Bacterial Isolates

A total of 80 P. aeruginosa isolates were collected from hospitalized children in Tehran Hospitals. Among the 80 isolates obtained, 26 were from boys, 54 were from girls, and all were between 2 and 15 years old.

4.2. Antibiotic Susceptibility Profile

The resistance rate of P. aeruginosa isolates to the tested antibiotics was 28 (35%) to cefepime, 20 (25%) to ceftazidime, 18 (22%) to ciprofloxacin, 13 (16%) to tazobactam, 12 (15%) to gentamicin, 8 (10%) to tobramycin and amikacin. Out of 80 isolates, 16 (20%) were carbapenems-resistant.

4.3. Metallo-β-lactamase

Phenotypic and genotypic assessment of MBLs showed that among 16 isolates that were resistant to imipenem, four could produce MBL genes.

4.4. Prevalence of Resistance Genes

The existence of OprD, blaCTX-M, blaSHV, and blaTEM genes was detected in 80 (100%), 36 (45%), 22 (27.5%), 17 (21.25%), and 1 (1.25%) blaIMP, blaNDM genes, respectively. In this study, the blaVIM gene was not detected in the isolates, and no mutation was observed regarding the presence of an insertion element in the OprD gene (Table 2).
Table 2.Prevalence of Resistance Genes Among 80 P. aeruginosa Strains a
IMPVIMNDMTEMSHVOprDCTX-M
1 (1.25)01 (1.25)17 (21.25)22 (27.5)80 (100)36 (45)

a Values are expressed as No. (%).

4.5. Random Amplified Polymorphic DNA Fingerprinting

All 80 P. aeruginosa isolates were subjected to random amplified polymorphic DNA (RAPD-PCR) fingerprinting to appraise the genetic diversity. Isolates were partitioned into 13 common types (CT) and 14 single types (ST).

5. Discussion

P. aeruginosa is an opportunistic pathogen and one of the main causes of acquired and nosocomial infections with limited therapeutic options. Furthermore, treating infections caused by this bacterium is extremely difficult and challenging (25, 26).
Antibiotic susceptibility investigation in this study demonstrated that the resistance levels amongst P. aeruginosa isolates as follows: cefepime (35%), ceftazidime (25%), ciprofloxacin (22%), tazobactam (16%), gentamicin (15%), amikacin (10%), and tobramycin (10%). The high prevalence of resistance rate to beta-lactam agents in this study was related to the presence of ESBLs, such as blaTEM, blaSHV, and blaCTX-M. Results demonstrated that nine blaCTX-M and blaSHV-positive ones could be identified among ceftazidime-resistant strains. Nonetheless, 15/28 cefepime-resistance isolates were ESBL producers. Therefore, additional resistance mechanisms or enzymes such as ESBLs, AmpC, and MBLs may have played a role in the resistance. In the study conducted by Shahbazzadeh et al., approximately 50% of isolates were resistant to third-generation cephalosporins. Among 51 isolates resistant to ceftazidime, 5 were ESBL producers (27). Moreover, Ali et al. showed that in 23.91% and 6.52% of samples, ESBLs and MBLs were detected, respectively (28).
According to the obtained results, aminoglycosides demonstrated low rates of resistance. This is consistent with the findings by Ahmadian et al. (2021), who similarly reported low levels of P. aeruginosa resistance to amikacin (13%), gentamicin (32%), and tobramycin (33%) in various clinical cases in Iran (29). Khan and Faiz also reported that low proportions of P. aeruginosa isolates were resistant to gentamicin (11.6%) and amikacin (7.4%) in Saudi Arabia (30). These low resistances against amikacin and tobramycin may be due to their lower prescription in Iranian hospitals. Similarly, it was reported in Kashfi et al.'s study that amikacin was more effective than gentamicin against P. aeruginosa isolated in burn patients (31). In contrast, the resistance rate to aminoglycosides is high in some regions and countries, and some authors believe that P. aeruginosa tends to show intrinsic resistance to aminoglycosides (32). For instance, in India, the resistance rates to amikacin, gentamicin, and tobramycin were 50%, 67%, and 66%, respectively (33). Generally, based on antibiotic resistance studies, it can be concluded that the rates of resistance in P. aeruginosa isolates are higher than before, which may be due to different reasons such as the difference in resistance mechanism, the irresponsible use of antibiotics in prevention, the difference in sample type and the topographical locations, and hygienic condition and hospitals care‏ (34).
Carbapenems such as imipenem and meropenem are effective antimicrobial agents against P. aeruginosa infections. However, carbapenem resistance is emerging worldwide. Among the present study's 80 clinical isolates of P. aeruginosa, 20% were resistant to carbapenems. The resistance range of P. aeruginosa to imipenem in other studies in different regions was 5.5 to 62.5% (25, 35-38). Resistance to carbapenems in P. aeruginosa occurs via several mechanisms. Producing carbapenemase, the main mechanism of carbapenem resistance in Iran, is one of the main mechanisms (39).
Acquired MBLs such as IMP, NDM, and VIM are the most common, first detected in the early 1990s (40, 41). These genes are carried by genetic elements, including plasmids and integrons (42). PCR assays targeting carbapenemase and MBL encoding genes were negative in all 16 isolates. However, MBL was positive in 4 isolates’ phenotypic assay. Kalluf et al. reported 85.5% positive strains with phenotypic results for MBL (43). blaIMP and blaNDM were detected in one out of 28 cefepime-resistant strains. Our data support the findings of Shariati et al. from Iran, which demonstrated that MBL and carbapenemase were negative in carbapenem-resistant strains (4). It seems that the resistance to imipenem in these bacteria depends on mechanisms other than the production of carbapenemase enzyme. As reported in other studies, the frequency of MBLs was approximately 8.2 to 35.1% (44-46). Contrary to some reports, VIM was the predominant MBL gene associated with the outbreaks due to MBL-producing P. aeruginosa (47, 48).
The deficiency of OprD due to substitutions, deletions, insertions, or mutations have also been considered as another mechanism of carbapenem resistance (49). In the current study, PCR assay using the OprD - particular primers demonstrated that all isolates were positive for OprD amplification. Still, none of the imipenem-resistant P. aeruginosa isolates harbored an insertions element in the OprD gene. As shown by several studies, alteration of OprD increases the MIC for imipenem but not other carbapenems (38, 50). A different study by Wolter et al. showed the presence of IS elements within the OprD gene, which was not observed in this study (51). Kiani et al. reported one base IS element among five resistance strains (25). An investigation Performed by Shen et al. revealed that 136 out of 141 (96.5%) of the resistant isolates had mutations. Among them, only 6 strains had IS, and the remains had other types of alteration (50). These reports are contrary to our results. It is possible that mutations or deletions occurred in our strain. Various IS elements have been recognized worldwide that may inactivate the OprD gene, such as ISPpu21 and ISPa1328 in Iran, ISPa26 in South Africa, ISPa46 and ISPa1328 in France, ISRP10 in Croatia, ISPa133 in Spain, ISPa1328 and ISPre2 in China, ISPa150 in Russia, and ISPa8, ISPa1635, and ISPa1328 in the USA (4, 52-54). RAPD-PCR was performed for typing all P. aeruginosa isolates. In typing results, 13 CT and 14 different ST were detected. Notably, all carbapenems-resistant isolates were clonally related. Different distributions of genotypes have been shown in several studies. For example, Vaez et al. had 54 clinical isolates with 39 different groups, and Salimi et al. observed eight different groups from 29 isolates (55, 56). The difference in the obtained results may be due to the difference in the sources of P. aeruginosa that can lead to colonization of the host.

5.1. Conclusions

Resistance to most anti-pseudomonal antibiotics has become an emerging issue worldwide. Carbapenem resistance is a critical problem that develops due to several mechanisms. To sum up, we analyzed the MBLs and ESBLs production in P. aeruginosa strains. The findings of this study revealed that the prevalence of carbapenem-resistant strains among hospitalized children is increasing. We identified that most of the isolates were harboring ESBL genes. On the other hand, the results demonstrated that there was beta-lactam antibiotic resistance and clonal spread among hospitalized patients. This indicates the necessity of molecular surveillance in tracking beta-lactamase-producing strains.

Acknowledgments

Footnotes

References

  • 1.
    Cayci YT, Biyik I, Birinci A. VIM, NDM, IMP, GES, SPM, GIM, SIM Metallobetalactamases in Carbapenem-Resistant Pseudomonas Aeruginosa Isolates from a Turkish University Hospital. J Arch Mil Med. 2022;(In Press). https://doi.org/10.5812/jamm-118712.
  • 2.
    Rossi Goncalves I, Dantas RCC, Ferreira ML, Batistao D, Gontijo-Filho PP, Ribas RM. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation. Braz J Microbiol. 2017;48(2):211-7. [PubMed ID: 28034598]. [PubMed Central ID: PMC5470431]. https://doi.org/10.1016/j.bjm.2016.11.004.
  • 3.
    Mahar P, Padiglione AA, Cleland H, Paul E, Hinrichs M, Wasiak J. Pseudomonas aeruginosa bacteraemia in burns patients: Risk factors and outcomes. Burns. 2010;36(8):1228-33. [PubMed ID: 20965109]. https://doi.org/10.1016/j.burns.2010.05.009.
  • 4.
    Shariati A, Azimi T, Ardebili A, Chirani AS, Bahramian A, Pormohammad A, et al. Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran. New Microbes New Infect. 2018;21:75-80. [PubMed ID: 29234497]. [PubMed Central ID: PMC5722278]. https://doi.org/10.1016/j.nmni.2017.10.013.
  • 5.
    Ibrahim D, Jabbour JF, Kanj SS. Current choices of antibiotic treatment for Pseudomonas aeruginosa infections. Curr Opin Infect Dis. 2020;33(6):464-73. [PubMed ID: 33148986]. https://doi.org/10.1097/QCO.0000000000000677.
  • 6.
    Feng W, Huang Q, Wang Y, Yuan Q, Li X, Xia P, et al. Changes in the resistance and epidemiological characteristics of Pseudomonas aeruginosa during a ten-year period. J Microbiol Immunol Infect. 2021;54(2):261-6. [PubMed ID: 31628088]. https://doi.org/10.1016/j.jmii.2019.08.017.
  • 7.
    Laudy AE, Rog P, Smolinska-Krol K, Cmiel M, Sloczynska A, Patzer J, et al. Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods. PLoS One. 2017;12(6). e0180121. [PubMed ID: 28658322]. [PubMed Central ID: PMC5489192]. https://doi.org/10.1371/journal.pone.0180121.
  • 8.
    Kung VL, Ozer EA, Hauser AR. The accessory genome of Pseudomonas aeruginosa. Microbiol Mol Biol Rev. 2010;74(4):621-41. [PubMed ID: 21119020]. [PubMed Central ID: PMC3008168]. https://doi.org/10.1128/MMBR.00027-10.
  • 9.
    Khalili Y, Memar MY, Farajnia S, Adibkia K, Kafil HS, Ghotaslou R. Molecular epidemiology and carbapenem resistance of Pseudomonas aeruginosa isolated from patients with burns. J Wound Care. 2021;30(2):135-41. [PubMed ID: 33573489]. https://doi.org/10.12968/jowc.2021.30.2.135.
  • 10.
    Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis. 2018;18(3):318-27. [PubMed ID: 29276051]. https://doi.org/10.1016/S1473-3099(17)30753-3.
  • 11.
    Hu Y, Qing Y, Chen J, Liu C, Lu J, Wang Q, et al. Prevalence, Risk Factors, and Molecular Epidemiology of Intestinal Carbapenem-Resistant Pseudomonas aeruginosa. Microbiol Spectr. 2021;9(3). e0134421. [PubMed ID: 34817230]. [PubMed Central ID: PMC8612150]. https://doi.org/10.1128/Spectrum.01344-21.
  • 12.
    Pang Z, Raudonis R, Glick BR, Lin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv. 2019;37(1):177-92. [PubMed ID: 30500353]. https://doi.org/10.1016/j.biotechadv.2018.11.013.
  • 13.
    Hong DJ, Bae IK, Jang IH, Jeong SH, Kang HK, Lee K. Epidemiology and Characteristics of Metallo-beta-Lactamase-Producing Pseudomonas aeruginosa. Infect Chemother. 2015;47(2):81-97. [PubMed ID: 26157586]. [PubMed Central ID: PMC4495280]. https://doi.org/10.3947/ic.2015.47.2.81.
  • 14.
    Jamal WY, Albert MJ, Rotimi VO. High Prevalence of New Delhi Metallo-beta-Lactamase-1 (NDM-1) Producers among Carbapenem-Resistant Enterobacteriaceae in Kuwait. PLoS One. 2016;11(3). e0152638. [PubMed ID: 27031521]. [PubMed Central ID: PMC4816385]. https://doi.org/10.1371/journal.pone.0152638.
  • 15.
    Kashyap A, Gupta R, Sharma R, Verma VV, Gupta S, Goyal P. New Delhi Metallo Beta Lactamase: Menace and its Challenges. J Mol Gen Med. 2017;11(4). https://doi.org/10.4172/1747-0862.1000299.
  • 16.
    Ocampo-Sosa AA, Cabot G, Rodriguez C, Roman E, Tubau F, Macia MD, et al. Alterations of OprD in carbapenem-intermediate and -susceptible strains of Pseudomonas aeruginosa isolated from patients with bacteremia in a Spanish multicenter study. Antimicrob Agents Chemother. 2012;56(4):1703-13. [PubMed ID: 22290967]. [PubMed Central ID: PMC3318371]. https://doi.org/10.1128/AAC.05451-11.
  • 17.
    Li H, Luo YF, Williams BJ, Blackwell TS, Xie CM. Structure and function of OprD protein in Pseudomonas aeruginosa: from antibiotic resistance to novel therapies. Int J Med Microbiol. 2012;302(2):63-8. [PubMed ID: 22226846]. [PubMed Central ID: PMC3831278]. https://doi.org/10.1016/j.ijmm.2011.10.001.
  • 18.
    Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother. 2006;50(5):1633-41. [PubMed ID: 16641429]. [PubMed Central ID: PMC1472219]. https://doi.org/10.1128/AAC.50.5.1633-1641.2006.
  • 19.
    Omer THS, Mustafa SAM, Mohamed SOO. Extended Spectrum beta-Lactamase-Mediated Resistance and Antibiogram of Pseudomonas aeruginosa Isolates from Patients Attending Two Public Hospitals in Khartoum, Sudan. Int J Microbiol. 2020;2020:2313504. [PubMed ID: 33163076]. [PubMed Central ID: PMC7607279]. https://doi.org/10.1155/2020/2313504.
  • 20.
    Humphries R, Bobenchik AM, Hindler JA, Schuetz AN. Overview of Changes to the Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing, M100, 31st Edition. J Clin Microbiol. 2021;59(12). e0021321. [PubMed ID: 34550809]. [PubMed Central ID: PMC8601225]. https://doi.org/10.1128/JCM.00213-21.
  • 21.
    Sadek M, Poirel L, Nordmann P. Rapid detection of carbapenemase-producing Pseudomonas spp. using the NitroSpeed-Carba NP test. Diagn Microbiol Infect Dis. 2021;99(3):115280. [PubMed ID: 33321426]. https://doi.org/10.1016/j.diagmicrobio.2020.115280.
  • 22.
    Hakemi Vala M, Hallajzadeh M, Hashemi A, Goudarzi H, Tarhani M, Sattarzadeh Tabrizi M, et al. Detection of Ambler class A, B and D ss-lactamases among Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014;27(1):8-13. [PubMed ID: 25249841]. [PubMed Central ID: PMC4150481].
  • 23.
    Dimitrakopoulou M, Stavrou V, Kotsalou C, Vantarakis A. Boiling Extraction Method VS Commercial Kits for Bacterial DNA Isolation from Food Samples. J Food Sci Nutr Res. 2020;3(4):311-9. https://doi.org/10.26502/jfsnr.2642-11000057.
  • 24.
    Vanerkova M, Malisova B, Kotaskova I, Hola V, Ruzicka F, Freiberger T. Biofilm formation, antibiotic susceptibility and RAPD genotypes in Pseudomonas aeruginosa clinical strains isolated from single centre intensive care unit patients. Folia Microbiol (Praha). 2017;62(6):531-8. [PubMed ID: 28365878]. https://doi.org/10.1007/s12223-017-0526-7.
  • 25.
    Kiani M, Astani A, Eslami G, Khaledi M, Afkhami H, Rostami S, et al. Upstream region of OprD mutations in imipenem-resistant and imipenem-sensitive Pseudomonas isolates. AMB Express. 2021;11(1):82. [PubMed ID: 34089411]. [PubMed Central ID: PMC8179858]. https://doi.org/10.1186/s13568-021-01243-3.
  • 26.
    Rossi E, La Rosa R, Bartell JA, Marvig RL, Haagensen JAJ, Sommer LM, et al. Pseudomonas aeruginosa adaptation and evolution in patients with cystic fibrosis. Nat Rev Microbiol. 2021;19(5):331-42. [PubMed ID: 33214718]. https://doi.org/10.1038/s41579-020-00477-5.
  • 27.
    Shahbazzadeh M, Moazamian E, Rafati A, Fardin M. Antimicrobial resistance pattern, genetic distribution of ESBL genes, biofilm-forming potential, and virulence potential of Pseudomonas aeruginosa isolated from the burn patients in Tehran Hospitals, Iran. Pan Afr Med J. 2020;36:233. [PubMed ID: 33708324]. [PubMed Central ID: PMC7908313]. https://doi.org/10.11604/pamj.2020.36.233.21815.
  • 28.
    Ali F, Niaz Z, Shah PT, Shakeela Q, Uzma B, Ahmed S. Antibiogram of ESBL and MBL producing Pseudomonas aeruginosa among the population of Hazara division, KPK, Pakistan. J Pak Med Assoc. 2020;70(11):1979-84. [PubMed ID: 33341844]. https://doi.org/10.5455/JPMA.19089.
  • 29.
    Ahmadian L, Norouzi Bazgir Z, Ahanjan M, Valadan R, Goli HR. Role of Aminoglycoside-Modifying Enzymes (AMEs) in Resistance to Aminoglycosides among Clinical Isolates of Pseudomonas aeruginosa in the North of Iran. Biomed Res Int. 2021;2021:7077344. [PubMed ID: 34471641]. [PubMed Central ID: PMC8405309]. https://doi.org/10.1155/2021/7077344.
  • 30.
    Khan MA, Faiz A. Antimicrobial resistance patterns of Pseudomonas aeruginosa in tertiary care hospitals of Makkah and Jeddah. Ann Saudi Med. 2016;36(1):23-8. [PubMed ID: 26922684]. [PubMed Central ID: PMC6074268]. https://doi.org/10.5144/0256-4947.2016.23.
  • 31.
    Kashfi M, Hashemi A, Eslami G, Sadredin Amin M, Tarashi S, Taki E. The Prevalence of Aminoglycoside-Modifying Enzyme Genes Among Pseudomonas aeruginosa Strains Isolated From Burn Patients. Arch Clin Infect Dis. 2016;12(1). https://doi.org/10.5812/archcid.40896.
  • 32.
    Penna B, Thome S, Martins R, Martins G, Lilenbaum W. In vitro antimicrobial resistance of Pseudomonas aeruginosa isolated from canine otitis externa in Rio de Janeiro, Brazil. Braz J Microbiol. 2011;42(4):1434-6. [PubMed ID: 24031774]. [PubMed Central ID: PMC3768740]. https://doi.org/10.1590/S1517-838220110004000027.
  • 33.
    Javiya VA, Ghatak SB, Patel KR, Patel JA. Antibiotic susceptibility patterns of Pseudomonas aeruginosa at a tertiary care hospital in Gujarat, India. Indian J Pharmacol. 2008;40(5):230-4. [PubMed ID: 20040963]. [PubMed Central ID: PMC2792624]. https://doi.org/10.4103/0253-7613.44156.
  • 34.
    Teixeira B, Rodulfo H, Carreno N, Guzman M, Salazar E, De Donato M. Aminoglycoside resistance genes in Pseudomonas aeruginosa isolates from Cumana, Venezuela. Rev Inst Med Trop Sao Paulo. 2016;58:13. [PubMed ID: 27007556]. [PubMed Central ID: PMC4804550]. https://doi.org/10.1590/S1678-9946201658013.
  • 35.
    Dantas RCC, Silva RTE, Ferreira ML, Goncalves IR, Araujo BF, Campos PA, et al. Molecular epidemiological survey of bacteremia by multidrug resistant Pseudomonas aeruginosa: the relevance of intrinsic resistance mechanisms. PLoS One. 2017;12(5). e0176774. [PubMed ID: 28481953]. [PubMed Central ID: PMC5421754]. https://doi.org/10.1371/journal.pone.0176774.
  • 36.
    Dubois V, Arpin C, Dupart V, Scavelli A, Coulange L, Andre C, et al. Beta-lactam and aminoglycoside resistance rates and mechanisms among Pseudomonas aeruginosa in French general practice (community and private healthcare centres). J Antimicrob Chemother. 2008;62(2):316-23. [PubMed ID: 18467306]. https://doi.org/10.1093/jac/dkn174.
  • 37.
    Gill MM, Usman J, Kaleem F, Hassan A, Khalid A, Anjum R, et al. Frequency and antibiogram of multi-drug resistant Pseudomonas aeruginosa. J Coll Physicians Surg Pak. 2011;21(9):531-4. [PubMed ID: 21914408].
  • 38.
    Zarei-Yazdeli M, Eslami G, Zandi H, Mousavi SM, Kosha H, Akhavan F, et al. [Relationship between antimicrobial resistance and class I integron in Pseudomonas aeruginosa isolated from clinical specimens in Yazd during 2012-2013]. Feyz J Kashan Univ Med Sci. 2014;18(1). Persian.
  • 39.
    Azimi L, Fallah F, Karimi A, Shirdoust M, Azimi T, Sedighi I, et al. Survey of various carbapenem-resistant mechanisms of Acinetobacter baumannii and Pseudomonas aeruginosa isolated from clinical samples in Iran. Iran J Basic Med Sci. 2020;23(11):1396-400. [PubMed ID: 33235696]. [PubMed Central ID: PMC7671419]. https://doi.org/10.22038/IJBMS.2020.44853.10463.
  • 40.
    Belles A, Bueno J, Rojo-Bezares B, Torres C, Javier Castillo F, Saenz Y, et al. Characterisation of VIM-2-producing Pseudomonas aeruginosa isolates from lower tract respiratory infections in a Spanish hospital. Eur J Clin Microbiol Infect Dis. 2018;37(10):1847-56. [PubMed ID: 29978304]. https://doi.org/10.1007/s10096-018-3318-3.
  • 41.
    Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1991;35(1):147-51. [PubMed ID: 1901695]. [PubMed Central ID: PMC244956]. https://doi.org/10.1128/AAC.35.1.147.
  • 42.
    Cavalcanti FL, Mirones CR, Paucar ER, Montes LA, Leal-Balbino TC, Morais MM, et al. Mutational and acquired carbapenem resistance mechanisms in multidrug resistant Pseudomonas aeruginosa clinical isolates from Recife, Brazil. Mem Inst Oswaldo Cruz. 2015;110(8):1003-9. [PubMed ID: 26676375]. [PubMed Central ID: PMC4708020]. https://doi.org/10.1590/0074-02760150233.
  • 43.
    Kalluf KO, Arend LN, Wuicik TE, Pilonetto M, Tuon FF. Molecular epidemiology of SPM-1-producing Pseudomonas aeruginosa by rep-PCR in hospitals in Parana, Brazil. Infect Genet Evol. 2017;49:130-3. [PubMed ID: 27923770]. https://doi.org/10.1016/j.meegid.2016.11.025.
  • 44.
    Fan X, Wu Y, Xiao M, Xu ZP, Kudinha T, Bazaj A, et al. Diverse Genetic Background of Multidrug-Resistant Pseudomonas aeruginosa from Mainland China, and Emergence of an Extensively Drug-Resistant ST292 Clone in Kunming. Sci Rep. 2016;6:26522. [PubMed ID: 27198004]. [PubMed Central ID: PMC4873832]. https://doi.org/10.1038/srep26522.
  • 45.
    Li J, Zou M, Dou Q, Hu Y, Wang H, Yan Q, et al. Characterization of clinical extensively drug-resistant Pseudomonas aeruginosa in the Hunan province of China. Ann Clin Microbiol Antimicrob. 2016;15(1):35. [PubMed ID: 27215335]. [PubMed Central ID: PMC4877936]. https://doi.org/10.1186/s12941-016-0148-y.
  • 46.
    Li F, Chen D, Li L, Liang D, Wang F, Zhang B. Analysis of Metallo-beta-lactamases, oprD Mutation, and Multidrug Resistance of beta-lactam Antibiotic-Resistant Strains of Pseudomonas aeruginosa Isolated from Southern China. Curr Microbiol. 2020;77(11):3264-9. [PubMed ID: 32785753]. [PubMed Central ID: PMC7536146]. https://doi.org/10.1007/s00284-020-02148-3.
  • 47.
    Zafer MM, Al-Agamy MH, El-Mahallawy HA, Amin MA, Ashour MS. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. Biomed Res Int. 2014;2014:101635. [PubMed ID: 24707471]. [PubMed Central ID: PMC3953503]. https://doi.org/10.1155/2014/101635.
  • 48.
    Deshpande LM, Jones RN, Woosley LN, Castanheira M. Retrospective molecular analysis of DIM-1 metallo-beta-lactamase discovered in Pseudomonas stutzeri from India in 2000. Antimicrob Agents Chemother. 2014;58(1):596-8. [PubMed ID: 24145536]. [PubMed Central ID: PMC3910751]. https://doi.org/10.1128/AAC.01541-13.
  • 49.
    Sanbongi Y, Shimizu A, Suzuki T, Nagaso H, Ida T, Maebashi K, et al. Classification of OprD sequence and correlation with antimicrobial activity of carbapenem agents in Pseudomonas aeruginosa clinical isolates collected in Japan. Microbiol Immunol. 2009;53(7):361-7. [PubMed ID: 19563394]. https://doi.org/10.1111/j.1348-0421.2009.00137.x.
  • 50.
    Shen J, Pan Y, Fang Y. Role of the Outer Membrane Protein OprD2 in Carbapenem-Resistance Mechanisms of Pseudomonas aeruginosa. PLoS One. 2015;10(10). e0139995. [PubMed ID: 26440806]. [PubMed Central ID: PMC4595132]. https://doi.org/10.1371/journal.pone.0139995.
  • 51.
    Wolter DJ, Hanson ND, Lister PD. Insertional inactivation of oprD in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS Microbiol Lett. 2004;236(1):137-43. [PubMed ID: 15212803]. https://doi.org/10.1016/j.femsle.2004.05.039.
  • 52.
    Al-Bayssari C, Valentini C, Gomez C, Reynaud-Gaubert M, Rolain JM. First detection of insertion sequence element ISPa1328 in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from an idiopathic pulmonary fibrosis patient in Marseille, France. New Microbes New Infect. 2015;7:26-7. [PubMed ID: 26137309]. [PubMed Central ID: PMC4484542]. https://doi.org/10.1016/j.nmni.2015.05.004.
  • 53.
    Sadredinamin M, Hashemi A, Goudarzi H, Tarashi S, Yousefi Nojookambari N, Erfanimanesh S. Detection of ISPa1328 and ISPpu21, Two Novel Insertion Sequences in the OprD Porin and blaIMP-1 Gene Among Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa Isolated From Burn Patients. Archives of Trauma Research. 2016;6(1). https://doi.org/10.5812/atr.36239.
  • 54.
    Bocharova Y, Savinova T, Shagin DA, Shelenkov AA, Mayanskiy NA, Chebotar IV. Inactivation of the oprD porin gene by a novel insertion sequence ISPa195 associated with large deletion in a carbapenem-resistant Pseudomonas aeruginosa clinical isolate. J Glob Antimicrob Resist. 2019;17:309-11. [PubMed ID: 30684654]. https://doi.org/10.1016/j.jgar.2019.01.016.
  • 55.
    Vaez H, Faghri J, Nasr Esfahani B, Moghim S, Fazeli H, Sedighi M, et al. Antibiotic Resistance Patterns and Genetic Diversity in Clinical Isolates of Pseudomonas aeruginosa Isolated From Patients of a Referral Hospital, Isfahan, Iran. Jundishapur J Microbiol. 2015;8(8). e20130. [PubMed ID: 26468363]. [PubMed Central ID: PMC4600933]. https://doi.org/10.5812/jjm.20130v2.
  • 56.
    Salimi H, Owlia P, Yakhchali B, Rastegar L A. Drug Susceptibility and Molecular Epidemiology of Pseudomonas aeruginosa Isolated in a Burn Unit. Am J Infect Dis. 2009;5(4):301-6. https://doi.org/10.3844/ajidsp.2009.301.306.

Similar Articles

25
Jan
2015

The Frequency of imp and vim Genes Among Pseudomonas aeruginosa Isolates From Children’s Medical Center of Tehran

Fatemeh Bagheri Bejestani,
Mojdeh Hakemi-Vala,
Raheleh Momtaheni,
Ozra Bagheri Bejestani,
Mehrdad Gholami

Bagheri Bejestani F, Hakemi-Vala M, Momtaheni R, Bagheri Bejestani O, Gholami M. The Frequency of imp and vim Genes Among Pseudomonas aeruginosa Isolates From Children’s Medical Center of Tehran. Arch Clin Infect Dis. 2015;10(1):e60116. doi: https://doi.org/10.5812/archcid.20991

3
Jul
2021
Jundishapur J Microbiol

Prevalence and Characteristics of Metallo-beta-Lactamase-positive and High-risk Clone ST235 Pseudomonas aeruginosa at Ardabil Hospitals

Somayeh Safarirad,
Mohsen Arzanlou,
Jafar Mohammadshahi,
Hamid Vaez,
Amirhossein Sahebkar,
Farzad Khademi

Safarirad S, Arzanlou M, Mohammadshahi J, Vaez H, Sahebkar A, et al. Prevalence and Characteristics of Metallo-beta-Lactamase-positive and High-risk Clone ST235 Pseudomonas aeruginosa at Ardabil Hospitals. Jundishapur J Microbiol. 2021;14(3):e115819. doi: https://doi.org/10.5812/jjm.115819

13
Sep
2021
Jundishapur J Microbiol

Molecular Detection of Carbapenemases and Extended-Spectrum β-Lactamases-Encoding Genes in Clinical Isolates of Pseudomonas aeruginosa in Iran

Esmaeil Rahimi,
Ali Asgari,
Taher Azimi,
Saeed Soleiman-Meigooni

Rahimi E, Asgari A, Azimi T, Soleiman-Meigooni S. Molecular Detection of Carbapenemases and Extended-Spectrum β-Lactamases-Encoding Genes in Clinical Isolates of Pseudomonas aeruginosa in Iran. Jundishapur J Microbiol. 2021;14(7):e115977. doi: https://doi.org/10.5812/jjm.115977

1
Sep
2013

Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran

Mahnaz Sarhangi,
Mohammad Motamedifar,
Jamal Sarvari

Sarhangi M, Motamedifar M, Sarvari J. Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran. Jundishapur J Microbiol. 2013;6(7):e6920. doi: https://doi.org/10.5812/jjm.6920

22
Sep
2015

Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran

Ramin Abiri,
Pantea Mohammadi,
Navid Shavani,
Mansour Rezaei

Abiri R, Mohammadi P, Shavani N, Rezaei M. Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran. Jundishapur J Microbiol. 2015;8(9):e22582. doi: https://doi.org/10.5812/jjm.22582


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles