Emergence of NDM-1-Producing Escherichia coli in Iran

Author(s):
Shirin EyvaziShirin Eyvazi1, Mojdeh Hakemi-ValaMojdeh Hakemi-Vala2,*, Ali HashemiAli HashemiAli Hashemi ORCID2, Fatemeh Bagheri BejestaniFatemeh Bagheri Bejestani3, Negar ElahiNegar Elahi4
1Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Microbiology, Medical School, Shahid Beheshti University of Medical Sciences (SBMU), Tehran, Iran
3Department of Microbiology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran
4Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran

Archives of Clinical Infectious Diseases:Vol. 13, issue 4; e62029
Published online:Oct 31, 2017
Article type:Case Report
Received:Feb 08, 2017
Accepted:Aug 12, 2017
How to Cite:Eyvazi S, Hakemi-Vala M, Hashemi A, Bagheri Bejestani F, Elahi N. Emergence of NDM-1-Producing Escherichia coli in Iran. Arch Clin Infect Dis. 2018;13(4):e62029. doi: https://doi.org/10.5812/archcid.62029

Abstract

Introduction:

Carbapenems are a broad-spectrum class of beta-lactam antibiotics, which are used in treatment of multi-drug resistant infections. Unfortunately, global emerging and spreading of carbapenemase, especially New Delhi metallo β lactamase 1 (blaNDM-1), is a concern in the treatment of multi drug-resistant agents. Here, we report the appearance of blaNDM-1producing Escherichia coli (E. coli) in Iran for the first time.

Case Presentation:

In this study, 2 blaNDM-1producing E. coli strains were isolated from 2 burn wounds of patients in the Motahari hospital, Tehran. The isolates were resistant to carbapenems (imipenem, meropenem and ertapenem) and other common antibiotics except nitrofurantoin. Combined Disk Test showed that the isolates could not produce blaAmpC and blaKPC carbapenemase, whereas they can produce metallo-β-lactamases (MBL). However, genetic detection using Polymerase Chain Reaction amplification with specific primers for blaKPC, blaIMP, blaVIM-1, blaVIM-1blaVIM-37, and blaNDM-1genes showed that only the blaNDM-1gene is amplified from the resistant isolates. Further sequencing of PCR products confirmed the presence of the blaNDM-1gene in these isolates.

Conclusions:

The emerging of blaNDM-1producing E. coli is a new threat for to the health system in Iran, due to the spreading of the blaNDM-1gene among pathogenic bacteria, which resulted in the emergence of multi drug resistant photogenes. Therefore, early identification of these isolates is mandatory.

1. Introduction

Carbapenems, including imipenem (IMP), meropenem (MEM), and ertapenem (ERP) are the last resort for extended-spectrum β-lactamases (ESBLs) producing bacteria (1). Unfortunately, today, the emerging of Carbapenemase-Producing Enterobacteriaceae (CPE) or Carbapenem-Resistant Enterobacteriaceae (CRE) is a concern in the treatment of multidrug-resistant Gram-negative infections (2). CRE infections are associated with a high mortality rate (3).
One of the most important carbapenemases is recently known as New Delhi metallo-β-lactamase-1 (blaNDM-1), which belongs to class B β-lactamases or metallo-β-lactamases (MBL) (4). For the first time, blaNDM-1was detected from Klebsiella pneumonia isolated from a urinary tract sample from a Swedish patient who had been hospitalized in India (5). Today, blaNDM-1was detected in other bacterial species including Escherichia coli (E. coli) (6). The prevalence of carbapenem-resistant E. coli strains isolated from Iran is very low. In 2 recent studies, the susceptibility of E. coli isolates to imipenem was reported as 99.3% (7) and 100% (8). However, the appearance of carbapenemases gene, especially blaNDM-1, can be a serious risk factor in increasing carbapenem resistance rates among the E. coli strains or other bacteria.
Here, we report emergence of blaNDM-1- producing E. coli strains in Iran for the first time.

2. Case Presentation

In September 2015 and June 2016, 2 swab samples from burn wound infections of a 64 year old woman as well as a 54-yr-old woman, who had been hospitalized in Motahari hospital (Iran University of medical sciences, Tehran, Iran) for a third-degree burning, were taken. The 2 patients used silver sulfadiazine, trimethoprim sulfamethoxazole, TMP/SMX, and ceftazidime as medication. The swabs were transferred to transport medium and sent to the microbiology lab of Shahid Beheshti University of Medical Science for isolation of bacterial strains. Standard identification methods including phenotypic survey on MacConkey Agar (Merck, Germany), TSI (Merck, Germany), IMViC, motility, urea (Merck, Germany) mediums, and also oxidase test, confirmed the identity of isolates as E. coli strains.
Antibiotic susceptibility test of the isolates by disk diffusion method for carbapenems including imipenem, IMP (10 μg), meropenem, MEM (10 μg), and ertapenem, ERP (10 μg) showed that the isolates are resistant to the antibiotics. The minimum inhibitory concentrations (MICs) of imipenem and meropenem (Jaber Ebne Hayyan Pharmaceutical Company, Iran) were determined as 8 and 64 µg/mL, respectively, by the microdilution method. Furthermore, the isolates were resistant to several common antibiotics including, piperacillin, PIP (100 μg), amoxicillin clavulanate, AMC (20/10-μg), gentamicin, GEN (10 μg), amikacin, AMN (30 μg), cefepime, CEFp (30 μg), ciprofloxacin, CIP (5 μg), cefazolin, CEFz (30 μg), ceftriaxone, CEFx (30 μg), cefoxitin, CEFo (30 μg), TMP/SMX (25 μg), and aztreonam, AZT (30 μg). All antibiotic disks were purchased from Rosco Diagnostica Taastrup, Denmark. However, nitrofurantoin, NIT (300μg), is the only antibiotic, which the carbapenem resistant isolates are sensitive to it.
Phenotypic detection of β-lactamases was done by Combined Disk Test (CDT) using ceftazidime (CAZ; 30 μg), ceftazidime/clavulanic acid (CAZ30/CLAV10), and boronic acid (BA; 250 μg) disks for blaAmpC detection. Additionally, CDT test was used for blaMBL detection using 2 IPM (10 μg) disks and EDTA 0.5 M solution. Results showed that the strains do not produce blaAmpC, whereas they can produce blaMBL enzyme.
Genotypic detection of blaKPC, blaIMP, blaVIM-1 (Verona integron-encoded metallo-β-lactamase), blaVIM-1blaVIM-37, blaDIM-1(Dutch imipenemase), and blaNDM-1 genes was done by polymerase chain reaction (PCR) amplification method and further sequencing of PCR products. All primer sequences are shown in Table 1. The presence of the mentioned genes in carbapenem-resistant isolates were not confirmed by PCR. However, a 621-bp band was amplified by blaNDM-1 primers and further DNA sequencing confirmed the presence of blaNDM-1gene in these 2 E. coli isolates (Figure 1). E. coli ATCC 25922 was considered as a control in all tests.
Table 1.Primer Sequences Used in This Study
Gene NamePrimer SequenceProduct SizeReference
blaKPCForward: 5′- ATG TCT GTA TCG CCG TCT -3′989-bp(9)
Reverse: 5′-TTTTCAGAGCCTTACTGCCC-3′
blaIMP-1Forward:5′- -GAAGGCGTTTATGTTCATAC -3′587-bp(10)
Reverse: 5′- GTACGTTTCAAGAGTGATGC -3′
blaVIM-1Forward: 5′-AGTGGTGAGTATCCGACAG-3′836-bp(11)
Reverse: 5′-ATGAAAGTGCGTGGAGAC-3′
blaVIM-1– VIM-37Forward: 5′-GATGGTGTTTGGTCGCATA -3′390-bp(12)
Reverse: 5′-CGAATGCGCAGCACCAG -3′
blaDIMForward: 5′- GCTTGTCTTCGCTTGCTAACG -3′699-bp(13)
Reverse: 5′- CGTTCGGCTGGATTGATTTG -3′
blaNDM-1Forward: 5′- GGTTTGGCGATCTGGTTTTC -3′621-bp(14)
Reverse: 5′- CGGAATGGCTCATCACGATC -3′
1: negative control, 2: positive control, 3: marker 50 bp 4: strain 1 and 5: strain 2.
Figure 1.

1: negative control, 2: positive control, 3: marker 50 bp 4: strain 1 and 5: strain 2.

3. Discussion

This is a first report on emerging of blaNDM-1producing E. coli in Iran. Earlier, Shahcheraghi et.al reported the first blaNDM-1producing K. pneumonia in Iran (15). Furthermore, recently, Fazeli et.al presented the 2nd report on the detection of blaNDM-1gene among K. pneumonia isolates from Iran (16). Approximately, the emergence of blaNDM-1producing Enterobacteriaceae is reported in all neighboring countries including; Turkey (17), Iraq (18), Pakistan (19), and Afghanistan (20). The prevalence of blaNDM-1producing Enterobacteriaceae was reported from different countries as follows: 2.7 % in Kuwait (6), 1.2 % in India, Pakistan, and the United Kingdom (19), as well as 1.1 % in Vietnam (21). Among these blaNDM-1producing Enterobacteriaceae, the prevalence of E. coli was very significant: 19 % in Kuwait (6), 20 % in India, Pakistan, and the United Kingdom (19), as well as 12.26 % in Vietnam (21). The blaNDM-1gene is placed near various insertion elements on transferrable plasmids (22). Medical tourisms has a considerable role in wide spreading of resistant genes e.g. blaNDM-1gene (19). In addition, the presence of blaNDM-1producing bacteria in environmental samples such as drinking-water samples could be involved in spreading of the resistant gene (23). Spreading of blaNDM-1gene is a global concern. Isolates harboring blaNDM-1gene are resistant to almost all β-lactam antibiotics, fluoroquinolones, and aminoglycosides (19). These isolates can be eradicated by aztreonam, colistin, and tigecycline (24). However, resistance to these antibiotics may be developed as the blaNDM-1harboring E. coli strains in our study were also resistant to aztreonam.
In conclusion, our results show the emerging of carbapenem-resistant genes, especially blaNDM-1, is an alarm to our health system, due to the spreading of transferable blaNDM-1gene among pathogenic bacteria, which resulted in the emergence of multi drug resistant photogenes, which are resistant to all available antibiotics. Therefore, early identification of blaNDM-1harboring bacteria and prevention of their spreading must be performed in any region.

Acknowledgments

Footnotes

References

  • 1.
    Hawkey PM, Livermore DM. Carbapenem antibiotics for serious infections. BMJ. 2012;344:3236. [PubMed ID: 22654063]. https://doi.org/10.1136/bmj.e3236.
  • 2.
    Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009;9(4):228-36. [PubMed ID: 19324295]. https://doi.org/10.1016/S1473-3099(09)70054-4.
  • 3.
    Gupta N, Limbago BM, Patel JB, Kallen AJ. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin Infect Dis. 2011;53(1):60-7. [PubMed ID: 21653305]. https://doi.org/10.1093/cid/cir202.
  • 4.
    Khan AU, Maryam L, Zarrilli R. Structure, Genetics and Worldwide Spread of New Delhi Metallo-beta-lactamase (NDM): a threat to public health. BMC Microbiol. 2017;17(1):101. [PubMed ID: 28449650]. https://doi.org/10.1186/s12866-017-1012-8.
  • 5.
    Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046-54. [PubMed ID: 19770275]. https://doi.org/10.1128/AAC.00774-09.
  • 6.
    Jamal WY, Albert MJ, Rotimi VO. High Prevalence of New Delhi Metallo-beta-Lactamase-1 (NDM-1) Producers among Carbapenem-Resistant Enterobacteriaceae in Kuwait. PLoS One. 2016;11(3):152638. [PubMed ID: 27031521]. https://doi.org/10.1371/journal.pone.0152638.
  • 7.
    Poorabbas B, Mardaneh J, Rezaei Z, Kalani M, Pouladfar G, Alami MH, et al. Nosocomial Infections: Multicenter surveillance of antimicrobial resistance profile of Staphylococcus aureus and Gram negative rods isolated from blood and other sterile body fluids in Iran. Iran J Microbiol. 2015;7(3):127-35. [PubMed ID: 26668699].
  • 8.
    Soltani J, Poorabbas B, Miri N, Mardaneh J. Health care associated infections, antibiotic resistance and clinical outcome: A surveillance study from Sanandaj, Iran. World J Clin Cases. 2016;4(3):63-70. [PubMed ID: 26989670]. https://doi.org/10.12998/wjcc.v4.i3.63.
  • 9.
    Marchaim D, Navon-Venezia S, Schwaber MJ, Carmeli Y. Isolation of imipenem-resistant Enterobacter species: emergence of KPC-2 carbapenemase, molecular characterization, epidemiology, and outcomes. Antimicrob Agents Chemother. 2008;52(4):1413-8. [PubMed ID: 18227191]. https://doi.org/10.1128/AAC.01103-07.
  • 10.
    Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-beta-lactamases in a large centralized laboratory. J Clin Microbiol. 2005;43(7):3129-35. [PubMed ID: 16000424]. https://doi.org/10.1128/JCM.43.7.3129-3135.2005.
  • 11.
    Juan C, Beceiro A, Gutierrez O, Alberti S, Garau M, Perez JL, et al. Characterization of the new metallo-beta-lactamase VIM-13 and its integron-borne gene from a Pseudomonas aeruginosa clinical isolate in Spain. Antimicrob Agents Chemother. 2008;52(10):3589-96. [PubMed ID: 18644957]. https://doi.org/10.1128/AAC.00465-08.
  • 12.
    Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J Antimicrob Chemother. 2007;59(2):321-2. [PubMed ID: 17185300]. https://doi.org/10.1093/jac/dkl481.
  • 13.
    Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119-23. [PubMed ID: 21398074]. https://doi.org/10.1016/j.diagmicrobio.2010.12.002.
  • 14.
    Nordmann P, Poirel L, Carrer A, Toleman MA, Walsh TR. How to detect NDM-1 producers. J Clin Microbiol. 2011;49(2):718-21. [PubMed ID: 21123531]. https://doi.org/10.1128/JCM.01773-10.
  • 15.
    Shahcheraghi F, Nobari S, Rahmati Ghezelgeh F, Nasiri S, Owlia P, Nikbin VS, et al. First report of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Iran. Microb Drug Resist. 2013;19(1):30-6. [PubMed ID: 22984942]. https://doi.org/10.1089/mdr.2012.0078.
  • 16.
    Fazeli H, Norouzi-Barough M, Ahadi AM, Shokri D, Solgi H. Detection of New Delhi Metallo-Beta-Lactamase-1 (NDM-1) in carbapenem- resistant Klebsiella pneumoniae isolated from a university hospital in Iran. Hippokratia. 2015;19(3):205-9. [PubMed ID: 27418777].
  • 17.
    Poirel L, Ozdamar M, Ocampo-Sosa AA, Turkoglu S, Ozer UG, Nordmann P. NDM-1-producing Klebsiella pneumoniae now in Turkey. Antimicrob Agents Chemother. 2012;56(5):2784-5. [PubMed ID: 22391536]. https://doi.org/10.1128/AAC.00150-12.
  • 18.
    Poirel L, Fortineau N, Nordmann P. International transfer of NDM-1-producing Klebsiella pneumoniae from Iraq to France. Antimicrob Agents Chemother. 2011;55(4):1821-2. [PubMed ID: 21245442]. https://doi.org/10.1128/AAC.01761-10.
  • 19.
    Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK, a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597-602. https://doi.org/10.1016/s1473-3099(10)70143-2.
  • 20.
    McGann P, Hang J, Clifford RJ, Yang Y, Kwak YI, Kuschner RA, et al. Complete sequence of a novel 178-kilobase plasmid carrying bla(NDM-1) in a Providencia stuartii strain isolated in Afghanistan. Antimicrob Agents Chemother. 2012;56(4):1673-9. [PubMed ID: 22290972]. https://doi.org/10.1128/AAC.05604-11.
  • 21.
    Tran HH, Ehsani S, Shibayama K, Matsui M, Suzuki S, Nguyen MB, et al. Common isolation of New Delhi metallo-beta-lactamase 1-producing Enterobacteriaceae in a large surgical hospital in Vietnam. Eur J Clin Microbiol Infect Dis. 2015;34(6):1247-54. [PubMed ID: 25732142]. https://doi.org/10.1007/s10096-015-2345-6.
  • 22.
    Hu H, Hu Y, Pan Y, Liang H, Wang H, Wang X. Novel plasmid and its variant harboring both a blaNDM-1 gene and type IV secretion system in clinical isolates of Acinetobacter lwoffii. Antimicrob Agents Chemother. 2012;56(4):1698-702. [PubMed ID: 22290961]. https://doi.org/10.1128/AAC.06199-11.
  • 23.
    Walsh TR, Weeks J, Livermore DM, Toleman MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis. 2011;11(5):355-62. [PubMed ID: 21478057]. https://doi.org/10.1016/S1473-3099(11)70059-7.
  • 24.
    Barantsevich EP, Churkina IV, Barantsevich NE, Pelkonen J, Schlyakhto EV, Woodford N. Emergence of Klebsiella pneumoniae producing NDM-1 carbapenemase in Saint Petersburg, Russia. J Antimicrob Chemother. 2013;68(5):1204-6. [PubMed ID: 23315490]. https://doi.org/10.1093/jac/dks503.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles