Loop-Mediated Isothermal Amplification Assay for Identification of Clinical Enterococcus Species

Author(s):
Masoud YousefiMasoud Yousefi1, Fatemeh  FallahFatemeh FallahFatemeh  Fallah ORCID2, Ali HashemiAli HashemiAli Hashemi ORCID2, Ali Nazari-alamAli Nazari-alam3, Mohammad Reza PourmandMohammad Reza Pourmand4,*
1Infectious Diseases Research Center, Birjand University of Medical Sciences, Birjand, Iran
2Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3Department of Microbiology, School of Medicine, Kashan University of Medical Sciences, Kashan, Iran
4Department of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran

Archives of Clinical Infectious Diseases:Vol. 14, issue 3; e82602
Published online:Jun 12, 2019
Article type:Research Article
Received:Jul 25, 2018
Accepted:May 05, 2019
How to Cite:Yousefi M, Fallah F, Hashemi A, Nazari-alam A, Pourmand MR. Loop-Mediated Isothermal Amplification Assay for Identification of Clinical Enterococcus Species. Arch Clin Infect Dis. 2019;14(3):e82602. doi: https://doi.org/10.5812/archcid.82602

Abstract

Background:

Enterococci are recognized as a cause of nosocomial infections and a major public health problem. The reliable identification to the species level of enterococci should be considered.

Objectives:

The study aimed to develop a LAMP assay for the rapid and accurate detection of Enterococcus faecalis and E. faecium.

Methods:

In total, 57 enterococcal isolates from UTI patients were identified using conventional microbiological methods. Two sets of specific primers were designed for E. faecalis and E. faecium targeting the mtlf and efmC genes, respectively. The LAMP assays were conducted using specific primers, dNTPs, MgSO4, Bst DNA polymerase, and templates.

Results:

The results of phenotypic testing indicated that of the 57 enterococcal isolates, 49 (85.9%) were identified as E. faecalis and eight (14.1%) as E. faecium. The optimal reaction temperatures in the LAMP assays were 60 and 61ºC for the detection of E. faecalis and E. faecium, respectively. All the 57 enterococcal isolates were identified as E. faecalis by the LAMP assay.

Conclusions:

The present study highlights the importance of the LAMP assay as a rapid and confirmatory tool for the identification of clinical Enterococcus spp.

1. Background

Enterococci are Gram-positive bacteria with low GC content, belonging to the Enterococcaceae family. They have emerged as one of the leading causes of serious nosocomial infections in recent years. Although many species have been identified in the Enterococcus genus, the most common agents associated with clinical complications are E. faecalis and E. faecium (1-3). The emergence of multidrug-resistant enterococci as one of the most frequently encountered nosocomial bacteria has created an increasing health concern worldwide. Therefore, the reliable identification of these pathogens using an easy, fast method is important (4, 5).
Although the traditional culture methods are mostly used for the detection of clinical enterococcal isolates, these methods are time-consuming and dependent on the presence of live organisms in the specimen. As more rapid and sensitive methods, several polymerase chain reaction (PCR)-based procedures have been developed for the detection of Enterococcus spp. The molecular approaches are dependent upon the amplification of DNA and are not affected by low microbial loads (6-8).
Loop-mediated isothermal amplification (LAMP) assay has been recently introduced as a rapid, accurate, and cost-effective diagnostic method for infectious diseases with the potential to overcome the limitations of culture and PCR methods (9, 10). In this technique, the target DNA is amplified under isothermal conditions and four specific primers (F3, B3, FIP, and BIP) are annealed to six separate regions within the target sequence. The use of these primers is associated with high efficiency and specificity (11, 12). Moreover, by using additional loop primers (LF and LB) designed to anneal the loop structure in LAMP, the LAMP reaction can be accelerated, resulting in the reduced amplification time. In the LAMP assay, the white precipitate of magnesium pyrophosphate produced during the reaction can be detected by the naked eye without any additional processing (10, 13).

2. Objectives

The identification methods for classical Enterococcus species by phenotypic methods are often time-consuming; thus, it seems to be a need for developing rapid and specific assays to overcome the problem. In the present study, the LAMP assay was developed as a confirmatory tool for the identification of clinical E. faecalis and E. faecium isolates.

3. Methods

3.1. Bacterial Isolates and Phenotypic Identification

This cross-sectional study was conducted on 57 non-repetitive clinical enterococcal isolates from UTI (urinary tract infection) patients (with urine culture yield of ≥ 105 CFU/mL) in the Department of Urology, Sina Hospital, Tehran University of Medical Sciences, Tehran, Iran. All the isolates were presumptively identified as enterococci by primary phenotypic identification methods and then included in the study. Duplicate isolates from the same patients were excluded (only the first isolate from each patient was included). The isolates were collected over a period of nine months from May 2015 to January 2016. The Review Board and Ethics Committee of Tehran University of Medical Sciences approved the study.
Enterococcus spp. were identified using the standard biochemical and microbiological methods including Gram’s staining, catalase test, motility test, pigment test, Enterococcus selective media (Bile-esculin-azide agar and Slanetz and Bartley agar (Merck, Germany)), salt tolerance test (6.5% NaCl (Merck, Germany)), and acid production from 1% (w/v) sorbitol, sorbose, L-arabinose, D-ribose, sucrose, and raffinose (Merck, Germany) (3).

3.2. Primer Design and DNA Extraction

The LAMP primers for the detection of E. faecium were designed by targeting the efmC gene using Primer explorer V4 software (https://primerexplorer.jp/lamp4). The sequences are shown in Table 1. PCR was performed with the F3 and B3 primers as forward and reverse primers, to confirm their specificity. Moreover, the E. faecalis mtlf gene was used as the target for the LAMP primer design according to a previous study (14). It is worthy of note that the genomic DNA was extracted from pure cultures using a High-Pure PCR Template Preparation Kit (Roche, Germany) according to the manufacturer’s instruction.
Table 1.Primers Used for LAMP Assay in the Present Study
BacteriaPrimerSequencing (5’–3’)Target GeneAmplicon Size with F3 + B3Ref.
E. faecalisF3GCCATTCCTCATGGAACAGmtlf gene205 bp(14)
B3CCACGTTATCCATATCACTACA
FIPCGGTGCCAAAATTAACACCCT-
TTAGTGAAAAAATCAGGAATCTGTG
BIPTGCTACCGTATTATTTGGGATTGC
AAAGTGCAATTTGTTGGACTA
E. faeciumF3ACATGGCAAAAGAAGTAGGTefmC gene208 bpThis study
B3ACTGCAAAATAATCTTTCCCT
FIPCCTTTTTGATGTCTTCTGGTAAT-
GGAAACAATAGATATCCACAGTATCCCG
BIPTACAACGGTTTGAATCTTGAAACAG
AAATCTTTTTTAGCCGTTTCCATC
LFATATTCATGCGGATCTGTTCC-
LBGTAACAGCTGGTTCGATAACT

3.3. LAMP Reaction

The LAMP reaction for the detection of E. faecalis was carried out according to the method described by Xu et al. (14) with slight modifications. The optimized LAMP reaction mixture (25 μL) consisted of 1X Bst buffer (New England Biolabs, UK), 8 mmol/L of MgSO4 (Sigma-Aldrich, USA), 8 mmol/L of each deoxynucleoside triphosphate (dNTP), 0.6 μmol/L of each outer primer (F3 and B3), 1.8 μmol/L of each inner primer (FIP and BIP), and 2 μL of DNA template. The reaction mixture was heated at 94 °C for 5 min in a Thermoblock heat system, and then cooled on ice. Finally, 8 U Bst DNA polymerase (New England Biolabs, UK) was added. Subsequently, the mixture was incubated at 60ºC for 60 min and then, heated at 80ºC for 3 min to terminate the reaction.
To optimize the LAMP conditions for E. faecium, the reaction mixture was prepared using a total volume of 25 µL containing 1X Bst Buffer (New England Biolabs, UK), different ratios of outer, inner, and loop primers, different concentrations of dNTPs (4, 6, 8, and 10 mM), different concentrations of MgSO4 (2, 4, 6, 8, 10, and 12 mM) , 8 U Bst DNA polymerase large fragments (New England Biolabs, UK), and 2 μL of DNA template. The reaction mixture was incubated in a Thermoblock system at various temperatures (63ºC and 65ºC) for various durations (30, 60, 90, and 120 min).
The final amplification LAMP products were visualized by using 3% agarose gel electrophoresis (Merck, Germany) or observing turbidity derived from magnesium pyrophosphate formed during the amplification process (Figure 1). It is worthy of note that the LAMP assays for the efmC and mtlf genes were optimized using E. faecium (ATCC® 19434TM) and E. faecalis (ATCC® 29212TM), respectively, which were later applied to screen the clinical isolates of enterococci.
Positive (left) and negative (right) reactions of LAMP assay based on the presence of turbidity
Figure 1.

Positive (left) and negative (right) reactions of LAMP assay based on the presence of turbidity

4. Results

4.1. Phenotypic Identification

In the present study, we investigated 57 clinical enterococcal isolates from UTI patients. The results of phenotypic testing indicated that of the 57 enterococcal isolates, 85.9% (49 isolates) were E. faecalis and 14.1% (eight isolates) were recognized as E. faecium.

4.2. LAMP Assay

To optimize the LAMP conditions for the detection of E. faecium, we used the pure DNA of E. faecium (ATCC® 19434TM). The ideal ratio of the outer, inner, and loop primers was 1:3:1 (corresponding to 0.6 μmol/L each of F3 and B3, 1.8 μmol/L each of FIP and BIP, and 0.6 μmol/L each of LF and LB). The extracted DNA from E. faecium was achieved optimally at 61ºC. Therefore, the best temperature for the LAMP assay was established at 61ºC, which was used for all subsequent applications. The best time for the amplification of genes in the LAMP reaction was 60 min. Different MgSO4 and dNTPs concentrations were evaluated and the best results were obtained at 6 mmol/L and 8 mmol/L, respectively.
In our study, the LAMP assay was applied for the detection of clinical enterococcal isolates (Figure 2). The results showed that all the 57 enterococcal isolates were identified as E. faecalis (Figure 3).
Electrophoretic analysis of LAMP products. (A) LAMP detection of <i>E. faecalis</i> isolates by targeting the <i>mtlf</i> gene. Lane M, DNA ladder (100 bp); lane 1, negative control (no template); lane 2 - 6, clinical <i>E. faecalis</i> isolates. (B) LAMP detection of <i>E. faecium</i> isolates by targeting the <i>efmC</i> gene. Lane M, DNA ladder (100 bp); lane 1, negative control, lane 2 and 3, <i>E. faecium</i> (ATCC<sup>®</sup> 19434<sup>TM</sup>).
Figure 2.

Electrophoretic analysis of LAMP products. (A) LAMP detection of E. faecalis isolates by targeting the mtlf gene. Lane M, DNA ladder (100 bp); lane 1, negative control (no template); lane 2 - 6, clinical E. faecalis isolates. (B) LAMP detection of E. faecium isolates by targeting the efmC gene. Lane M, DNA ladder (100 bp); lane 1, negative control, lane 2 and 3, E. faecium (ATCC® 19434TM).

Comparison of phenotypic and LAMP assay results in the detection of clinical <i>Enterococcus</i> species
Figure 3.

Comparison of phenotypic and LAMP assay results in the detection of clinical Enterococcus species

5. Discussion

Accuracy in the identification of enterococci to the species level is important for adequate treatment, surveillance, and infection control. Phenotype testing that involves bacterial growth in selective media has been widely used to diagnose enterococcal isolates (15, 16). However, these methods are time-consuming and failure in the identification of some Enterococcus species may have implications in clinical practices. Despite great sensitivity, PCR-based methods are not widely used as routine diagnostic tools due to the need for thermal cyclers and highly skilled operators. Therefore, the development of a more simple, rapid, and sensitive diagnostic method is important for the detection of enterococcal isolates (14, 15).
Since its advent in 2000, the LAMP assay has been frequently used for the detection of many organisms such as bacteria because it is user-friendly and has high sensitivity and specificity (17, 18). In the present study, we developed a LAMP assay for the detection of E. faecium and E. faecalis as two important Enterococcus spp. There are some publications about the LAMP assay and its use in the detection of enterococci, but different results have been obtained about LAMP conditions such as reaction temperature, MgSO4, dNTPs, and primers concentrations. In our study, the optimal temperatures were 60 and 61ºC for the detection of E. faecalis and E. faecium, respectively, in the LAMP assay. However, a recent study showed no difference in gene amplification conditions between Gram-negative and Gram-positive bacteria in the LAMP assay (19). In another study, the optimum temperature was 65ºC for gene amplification in the LAMP test for the detection of E. faecalis (6). The optimum conditions for gene amplification in the LAMP assay seem to be associated with polymerase enzymes used in reactions so that the best temperature is dependent upon the activity of Bsm and Bst polymerases as the two enzymes used in LAMP reactions.
In the current study, 57 clinical enterococcal isolates were recognized by phenotypic methods as E. faecalis (49 isolates) and E. faecium (eight isolates). The phenotypic prevalence of enterococci in this study is consistent with reports from many studies indicating Enterococcus faecalis as the most common cause of enterococcal infections (20, 21).
Furthermore, in this study, the LAMP assays targeting the mtlf and efmC genes were used to confirm E. faecalis and E. faecium, respectively. The results from the blasting of sequences showed that the selected sequences for the specific detection of the abovementioned species were highly specific. Moreover, conventional PCR was performed using external primers F3 and B3 to confirm the validity of the LAMP assay results. The LAMP assays showed that all the 57 enterococcal isolates were identified as E. faecalis. Therefore, the results indicated the importance of using the LAMP assay for the rapid and reliable identification of infectious agents. The results of the current study are in line with the results of other studies. Velasco et al. showed no correlation between phenotypic techniques and PCR-based genotypic methods for the identification of Enterococcus spp. In this study, up to 15.8% of the strains of E. faecium were misidentified based on phenotypic methods (15). Another study indicated that PCR-based techniques are more effective than biochemical methods for the complete identification of enterococcal isolates (22). Overall, the studies emphasize the inadequacy of phenotypic methods alone for the correct identification of Enterococcus species, particularly E. faecium. It is noteworthy that although the LAMP assay is a more rapid and simpler method than conventional PCR, the feasibility and cost-effectiveness of molecular diagnostic methods for patients should be considered.
One of the limitations of this study is that the LAMP assay was used only for the identification of E. faecalis and E. faecium as the most common agents associated with clinical complications although the LAMP method can be accomplished for the differentiation of all Enterococcus species. Furthermore, in the present study, the LAMP assay was developed as a confirmatory tool for species identification of cultured clinical isolates while this diagnostic method can rapidly identify infectious agents in clinical specimens.

5.1. Conclusions

The study highlights the importance of PCR-based genotypic techniques in routine use for the identification of Enterococcus spp. Although most laboratories employ phenotypic methods for bacterial identification, this study provides strong evidence that a number of enterococcal isolates may be misidentified when only biochemical tests are used. Considering the rapid performance of the LAMP assay, it may have implications as a diagnostic and confirmatory tool for the identification of clinical Enterococcus species.

Acknowledgments

Footnotes

References

  • 1.
    Talebi M, Eshraghi S, Pourshafie M, Pourmand M, Eshraghian M. Characterization of vancomycin resistant Enterococcus faecium. Iran J Public Health. 2007;36(4):20-5.
  • 2.
    Jahansepas A, Aghazadeh M, Rezaee MA, Hasani A, Sharifi Y, Aghazadeh T, et al. Occurrence of Enterococcus faecalis and Enterococcus faecium in various clinical infections: Detection of their drug resistance and virulence determinants. Microb Drug Resist. 2018;24(1):76-82. [PubMed ID: 28525287]. https://doi.org/10.1089/mdr.2017.0049.
  • 3.
    Fallah F, Yousefi M, Pourmand MR, Hashemi A, Nazari Alam A, Afshar D. Phenotypic and genotypic study of biofilm formation in Enterococci isolated from urinary tract infections. Microb Pathog. 2017;108:85-90. [PubMed ID: 28483600]. https://doi.org/10.1016/j.micpath.2017.05.014.
  • 4.
    McBride SM, Fischetti VA, Leblanc DJ, Moellering RJ, Gilmore MS. Genetic diversity among Enterococcus faecalis. PLoS One. 2007;2(7). e582. [PubMed ID: 17611618]. [PubMed Central ID: PMC1899230]. https://doi.org/10.1371/journal.pone.0000582.
  • 5.
    Peciuliene V, Balciuniene I, Eriksen HM, Haapasalo M. Isolation of Enterococcus faecalis in previously root-filled canals in a Lithuanian population. J Endod. 2000;26(10):593-5. [PubMed ID: 11199800]. https://doi.org/10.1097/00004770-200010000-00004.
  • 6.
    Martzy R, Kolm C, Brunner K, Mach RL, Krska R, Sinkovec H, et al. A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water. Water Res. 2017;122:62-9. [PubMed ID: 28591662]. https://doi.org/10.1016/j.watres.2017.05.023.
  • 7.
    Khardori N. Future of diagnostic microbiology. Indian J Med Microbiol. 2014;32(4):371-7. [PubMed ID: 25297019]. https://doi.org/10.4103/0255-0857.142233.
  • 8.
    Ranjbar R, Karami A, Farshad S, Giammanco GM, Mammina C. Typing methods used in the molecular epidemiology of microbial pathogens: A how-to guide. New Microbiol. 2014;37(1):1-15. [PubMed ID: 24531166].
  • 9.
    Mirzai S, Safi S, Mossavari N, Afshar D, Bolourchian M. Development of a loop-mediated isothermal amplification assay for rapid detection of Burkholderia mallei. Cell Mol Biol (Noisy-le-grand). 2016;62(10):32-6. [PubMed ID: 27609471].
  • 10.
    Lee D, Kim EJ, Kilgore PE, Kim SA, Takahashi H, Ohnishi M, et al. Clinical evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Neisseria meningitidis in cerebrospinal fluid. PLoS One. 2015;10(4). e0122922. [PubMed ID: 25853422]. [PubMed Central ID: PMC4390149]. https://doi.org/10.1371/journal.pone.0122922.
  • 11.
    Ranjbar R, Afshar D. Development of a loop-mediated isothermal amplification assay for rapid detection of Yersinia enterocolitica via targeting a conserved locus. Iran J Microbiol. 2015;7(4):185-90. [PubMed ID: 26697156]. [PubMed Central ID: PMC4685161].
  • 12.
    Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12). E63. [PubMed ID: 10871386]. [PubMed Central ID: PMC102748]. https://doi.org/10.1093/nar/28.12.e63.
  • 13.
    Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002;16(3):223-9. [PubMed ID: 12144774].
  • 14.
    Xu X, Zhang S, Wu Q, Zhang J, Li F, Cheng J. Development and application of a loop-mediated isothermal amplification (LAMP) method for rapid and sensitive detection of Enterococcus faecalisin drinking water. J Food Saf. 2014;34(2):103-10. https://doi.org/10.1111/jfs.12101.
  • 15.
    Velasco D, Perez S, Pena F, Dominguez MA, Cartelle M, Molina F, et al. Lack of correlation between phenotypic techniques and PCR-based genotypic methods for identification of Enterococcus spp. Diagn Microbiol Infect Dis. 2004;49(3):151-6. [PubMed ID: 15246503]. https://doi.org/10.1016/j.diagmicrobio.2004.03.012.
  • 16.
    Kim HJ, Kim YJ, Yong DE, Lee K, Park JH, Lee JM, et al. Loop-mediated isothermal amplification of vanA gene enables a rapid and naked-eye detection of vancomycin-resistant enterococci infection. J Microbiol Methods. 2014;104:61-6. [PubMed ID: 24925601]. https://doi.org/10.1016/j.mimet.2014.05.021.
  • 17.
    Almasi MA, Hosseini Dehabadi SM, Moradi A, Eftekhari Z, Aghapour Ojaghkandi M, Aghaei S. Development and application of loop-mediated isothermal amplification assay for rapid detection of Fusarium oxysporum f. sp. lycopersici. J Plant Pathol Microbiol. 2013;4(5):177.
  • 18.
    Biswas G, Sakai M. Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: current state and perspectives. Appl Microbiol Biotechnol. 2014;98(7):2881-95. [PubMed ID: 24477385]. https://doi.org/10.1007/s00253-014-5531-z.
  • 19.
    Ahmad F, Stedtfeld RD, Waseem H, Williams MR, Cupples AM, Tiedje JM, et al. Most probable number - loop mediated isothermal amplification (MPN-LAMP) for quantifying waterborne pathogens in <25min. J Microbiol Methods. 2017;132:27-33. [PubMed ID: 27856278]. [PubMed Central ID: PMC5195917]. https://doi.org/10.1016/j.mimet.2016.11.010.
  • 20.
    Manavalan J, Kannaiyan K, Velayutham A, Vadivel S, Kuthalaramalingam S. Phenotypic speciation of enterococci with special reference to prevalence, virulence and antimicrobial resistance. Int J Res Med Sci. 2015:2623-9. https://doi.org/10.18203/2320-6012.ijrms20150802.
  • 21.
    Rizwana M, Parvathi S, Appalaraju B. Phenotypic and genotypic characterization of Enterococci from clinical isolates in a tertiary care hospital. Int J Cur Microbiol Appl Sci. 2017;6(7):1160-73. https://doi.org/10.20546/ijcmas.2017.607.141.
  • 22.
    Gomes BC, Esteves CT, Palazzo ICV, Darini ALC, Franco BDGM, de Martinis ECP. Correlation between API 20 STREP and multiplex PCR for identification of Enterococcus spp. isolated from Brazilian foods. Brazil J Microbiol. 2007;38(4):617-9. https://doi.org/10.1590/s1517-83822007000400007.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles