Gene Cell Tissue

Image Credit:Gene Cell Tissue

In-Vitro Evaluation of Biological Activity of New Series of 1, 3, 4-Oxadiazole Derivatives Against Bap Gene Expression in Acinetobacter baumannii Biofilm

Author(s):
Sedigheh Akbarnezhad Ghareh LarSedigheh Akbarnezhad Ghareh LarSedigheh Akbarnezhad Ghareh Lar ORCID1, Nakisa Zarrabi AhrabiNakisa Zarrabi AhrabiNakisa Zarrabi Ahrabi ORCID1,*, Yasin SarveAhrabiYasin SarveAhrabiYasin SarveAhrabi ORCID1,**
1Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran
Corresponding Authors:
*Corresponding Author: Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran. Email: [email protected]
**Corresponding Author: Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran. Email: [email protected]

Gene, Cell and Tissue:Vol. 8, issue 3; e111894
Published online:May 25, 2021
Article type:Research Article
Received:Dec 14, 2020
Accepted:Jan 30, 2021
How to Cite:Akbarnezhad Ghareh Lar S, Zarrabi Ahrabi N, SarveAhrabi Y. In-Vitro Evaluation of Biological Activity of New Series of 1, 3, 4-Oxadiazole Derivatives Against Bap Gene Expression in Acinetobacter baumannii Biofilm. Gene Cell Tissue. 2021;8(3):e111894. doi: https://doi.org/10.5812/gct.111894

Abstract

Background:

Acinetobacter baumannii is one of the most common opportunistic pathogens in health centers that is resistant to many antibiotics due to biofilm production. 1, 3, 4-oxadiazoles have a wide range of biological activities.

Objectives:

The aim of this research was to examine the impact of new 1, 3, 4-oxadiazole derivatives on the expression of biofilm-associated surface protein (Bap), playing an important role in promoting the biofilm formation ability of A. baumannii strains.

Methods:

Derivatives of 1, 3, 4-oxadiazole were synthesized through a one-step synthesis. Acinetobacter baumannii strains were identified and isolated in the laboratory. The antimicrobial properties of the synthesized materials against the isolated strains were investigated. DNA, RNA, and cDNA were extracted, and the relative expression of BAP gene in A. baumannii isolates was evaluated by real-time polymerase chain reaction.

Results:

The compound with methoxyphenyl functional group with MIC = 62.50 mg/mL had the best inhibitory performance among all derivatives. Also, the combination of 4i reduced the expression of the Bap gene by about 24 times, but it had no effect on the expression of the 16srRNA housekeeping gene.

Conclusions:

1, 3, 4-oxadiazole derivatives, especially the methoxyphenyl functional group, act as an inhibitor of bacterial biofilm formation and have the potential to be used in the pharmaceutical and biological industries.

1. Background

Acinetobacter baumannii (A. baumannii) is an opportunistic pathogen that has always been identified as one of the most important pathogens of nosocomial infections (1). One of the major problems in treating and preventing infections caused by A. baumannii is its antibiotic resistance (2). Acinetobacter baumannii develops multidrug resistance, which has been demonstrated by a variety of antibiotic resistance mechanisms, including the activation of efflux pumps, production of beta-lactamase enzymes, reduction of foreign membrane permeability, and synthesis of enzymes such as phosphoryl transferases and acetyltransferases that cause resistance to aminoglycosides (3).
In addition to the above, there is another mechanism in the antibiotic resistance of A. baumannii called biofilm (4). Biofilms are complex bacterial communities attached to surfaces that are created by an extracellular matrix produced by bacteria. This matrix is composed of polysaccharides, DNA, and proteins. Bacterial biofilms cause many problems in medical, industrial, and environmental fields. Adherence of bacteria to surfaces is an important issue in ecology, biotechnology, bio-pollution, and wastewater treatment. Various proteins are involved in the development of this resistance, including proteins that create and strengthen the biofilm structure (5). The first member of this group of proteins, called BAP, has been identified in the bacterium A. baumannii (6). These proteins are located on the outer surface of bacteria. They consist of a central nucleus consisting of iterations of similar sequences. Bacteria are able to form biofilms, thus playing an important role in infectious pathogens. The structural features of these proteins include their presence on the outer surface of bacteria, high molecular weight, and the presence of a central nucleus consisting of repetitive sequences of similar sequences. These proteins give the bacterium the ability to form biofilms, and thus, play an important role in infectious pathogens (7).
Today, researchers are looking for new solutions to treat drug-resistant bacteria (8). One area of application, in this case, is the use of newly synthesized drug structures in the treatment of microbial infections. So far, numerous studies have shown that various compounds of oxadiazole derivatives have antibacterial properties against A. baumannii strains (9). Among these compounds, we can mention fluorophenyl compounds with thiol (10), fluorophenyl with chlorophenyl group (11), etc. Due to the antibiotic resistance of A. baumannii, few classes of antibiotics can be used to treat infections caused by this bacterium.
In this study, the effect of the synthesized materials was investigated for the first time on the expression of biofilm-inducing Bap gene in A. baumannii isolates. The effect of synthesized derivatives on the bacteria present in the biofilm, especially in deeper layers, was comparable to antibiotic treatment and phagocytic function of immune cells through inhibiting the formation of biofilm and regulating the development of the degenerative environment. Just as it is important to identify genes involved in the biofilm formation and pathogenesis of this bacterium, it is also important to recognize the environmental factors playing a role in regulating the expression of these genes (12).

2. Objectives

The aim of this study was to investigate the impact of new derivatives of 1, 3, 4-oxadiazole based on the 1, 3, 4-oxadiazole-2-yl-piridin-2-yl-methanol group on the expression of A. baumannii Bap gene, which is effective in promoting the biofilm formation ability of drug-resistant specimens.

3. Methods

This study was conducted in the genetic laboratory of Islamic Azad University, Tehran branch, with code number 10130553971011 in 2019. Starting materials, solvents, and culture environments were obtained from Merck, Germany, and used moving forward without any more filtration.

3.1. Preparation of Samples

In this study, 100 urine samples suspected of Acinetobacter infection were cultured on plates (Mueller Hinton agar). The samples were from patients with severe urinary tract infections and were delivered from the research department of Shariati and Sarem hospitals in Tehran. In the microbiology laboratory of Islamic Azad University, Central Tehran Branch, by using biochemical methods, 10 strains of A. baumannii were identified. A pure culture of all isolates of A. baumannii strains was prepared on blood agar medium, and then the cultures were incubated for 24 h at 37°C. To preserve the bacteria, they were inoculated in liquid culture medium containing glycerol and then stored at -70°C. The presence of Bap gene was confirmed by the PCR technique. In addition to clinical specimens, the standard strain and reference A. baumannii ATCC25923 were used, which makes the test conditions under quality control. The standard strain was obtained from the Iranian Research Organization for Science and Technology (IROST).

3.2. PCR to Confirm the Bap Gene

The presence of Bap gene was confirmed by molecular PCR using CinnaGen fermentase kit. The reaction mixture for PCR of the Bap gene was as follows: (1) MasterMix (1x): 12.5 µL; (2) primer F (0.1 - 1 µM) 1 µ; (3) primer R (0.1 - 1 µM): 1µ; (4) template DNA: 5 µ (20 pg), (5) sterile deionized water: 5.5 µ; the final volume was 25 µL, and PCR was set up to detect the Bap gene according to the following method. Initial denaturation: 95°C, 120 s, 1 cycle, denaturation: 93°C, 45 s, 35 cycles, annealing: 57°C, 60 s, 35 cycles, extension: 72°C, 30 s, 35 cycles, and final extension: 72°C, 90 s, 1 cycle. The primers used for the Bap and 16srRNA genes are listed in Table 1. Finally, six strains of A. baumannii with the Bap gene were selected for molecular studies.
Table 1.Primers Used to Target and Control Gene Amplification
Gene NamePrimersProduct Size
BAPForward: 5'- TAGACGCAATGGATAACG -3'127 bp
Reverse: 5'- TTAGAACCGATAACGATACC -3'
16s rRNAForward: 5'- TATCAGGACCATCTGGAGTAGG -3'110 bp
Reverse: 5'- CATCAACTTCACCTTCACGC -3'

3.3. Synthesis of Derivatives

1, 3, 4-oxadiazole compounds were synthesized using a single-stage, high-yield method. Single-stage: (1) N‑iso-cyan-imino-triphenyl-phosphoran (1 mmol) + 2‑pyridine-carbaldehyde (1 mmoL) were dissolved in CH3COCH3 (7 mL); (2) in the next step, the carboxylic acid (1 mmoL) in CH3COCH3 (10 mL) was added to the previous solution. The final solution was stirred for 12 h by a magnetic stirrer at room temperature. The solvent was removed by evaporation, and the viscous residue was purified by flash column chromatography [silica gel powder: petroleum ether-ethyl acetate (4: 1)] (13).

3.4. Preparation of Derivatives Suspension

To prepare the stock solution, 1 g of each synthetic material was dissolved in 100 mL of dimethyl sulfoxide (99% DMSO) to prepare 0.1 mg/mL of each compound.

3.5. Broth Microdilution Test to Determine the Minimum Inhibitory Concentration (MIC)

To determine the MIC, the serial dilution method was performed in three replications in the culture medium. Thus, different dilutions from 1000 to 31.25 μL/mL of synthetic materials were added to 96-well plate wells. Then, 100 μL of microbial suspension was added to each well, and the plates were treated overnight at 37°C in a greenhouse. Finally, the turbidity of all wells was visually investigated and reported as MIC in each sample.

3.6. Treatment of Acinetobacter baumannii Samples with Synthesized Derivatives

To investigate the effects of synthesized derivatives (4a-4i) on the expression of the desired genes, A. baumannii samples were treated with the treated compounds, and then RNA extraction was performed. To do this, samples of A. baumannii, equivalent to half a McFarland, were cultured in a test tube containing 5 mL of broth nutrient medium. The MIC equivalent of the compounds was then added to each tube. After mixing, it was incubated for 42 h at 39°C. After incubation, the samples were used to extract RNA.

3.7. RNA Extraction

To extract RNA from CinnaPure-RNA kit with No. cat PR891620 of Cinnagen Company was used. Then, the accuracy of RNAs was measured by a NanoDrop, and the samples were placed at -80°C.

3.8. Total RNA Treatment of Acinetobacter baumannii Samples Before and After Proximity with Derivatives by DNase Enzyme

To convert RNA to cDNA and perform real-time PCR, RNA samples must be free of genomic DNA contamination; thus, before cDNA synthesis, all RNA samples were treated with DNase enzyme. RNA treatment was performed using the Fermentas kit during a two-step process. Then, 1 µg of RNA was added to a sterile nuclease-free microtube, and 1 µL of reaction buffer 10x DNase1 and 1 µL of RNase-free were added to the microtubes, and the microtubes were incubated for 30 min at 39°C. Finally, 1 µL of EDTA (25 mM) was added to each microtube, and the microtubes were placed at 65°C for 10 min. RNA concentration of the extracted samples was measured after treatment with DNase by a nanodrop device. After confirming the accuracy of RNA and removing the extra DNA, all RNA samples were quickly converted to cDNA, and its conversion was confirmed by electrophoresis.

3.9. Investigation of Bap Gene Expression

RNA samples of pathogenic strains were prepared immediately after quality assay with a nanodrop device. The accuracy of the cDNA reaction was confirmed by PCR on the agarose gel. The result of electrophoresis of the PCR product of cDNA samples is shown in Figure 1.
Columns 1, 2, 3 and 4 of the <i>Bap </i>gene PCR product, column 5 of the 16s rRNA gene PCR product, column 6 of the standard strain PCR product and column M (100 bp marker) are shown. The amplified fragment is 127 bp for the <i>Bap </i>gene and 110 bp for the 16s rRNA gene.
Figure 1.

Columns 1, 2, 3 and 4 of the Bap gene PCR product, column 5 of the 16s rRNA gene PCR product, column 6 of the standard strain PCR product and column M (100 bp marker) are shown. The amplified fragment is 127 bp for the Bap gene and 110 bp for the 16s rRNA gene.

3.10. cDNA Synthesis

To make cDNA, Cinnagen Company RT PCR kit with the product code RTPL12 was used. The samples were then used for real-time PCR.

3.11. Real-time PCR

Real-time PCR technique was used to determine the expression of Bap and 16srRNA genes. The efficiency and melting temperature (TM) of these primers were evaluated and confirmed by ID Allele software. Requirements for real-time PCR were performed according to the protocol of Fermentase SYBR Green MasterMix kit and according to Table 2 in 36-house plates for Corbett machine. The amplification fragment contains 127 nucleotides for the Bap gene and 110 nucleotides for the 16srRNA gene. The annealing temperature was 57°C for the Bap gene and 51.8°C for 16srRNA gene. The preparation of real-time PCR samples and the conditions for real-time PCR are shown in Table 2. It should be noted that the real-time PCR was performed according to the MIC results and for 4i combination.
Table 2.Preparation of Samples and Conditions for Performing Real-time PCR
MaterialFinal ConcentrationVolume
qPCR SYBR green master mix1x12.5 µL
ROX dye 50x1x0.05 µL
F primer(0.1 - 1 µM)1 µL
R primer(0.1 - 1 µM)1 µL
Template1 µg1 µL
D.W-9.45 µL
Total volume-25 µL
Initial ActivationDenaturationAnnealingExtensionRepeatFinal Extension
95°С95°С-72°С40 cycle72°С
10 min20 sec20 sec20 sec-1 min

3.12. Quantitative Determination of Bap Gene Expression Before and After Exposure with a Concentration of 1 Mg/Ml of 4a, 4d, and 4i Derivatives Using Real-time PCR Technique

After real-time PCR, relative quantification can be performed in several ways, including using the standard curve of one gene and using the standard curve of both genes and the ΔCT method. The default of the ΔCT method is the relative parity of the cDNA amplification reaction efficiency with these two primers. Due to the equality of amplification efficiency of the two primers in the present study, the relative quantification of the cDNA of the studied genes in comparison with the cDNA of the 16srRNA gene (internal reference gene) was performed by the ΔCT method.

4. Results

4.1. Isolation and Diagnosis of Isolates from Clinical Samples

Four isolates were identified as A. baumannii using diagnostic and confirmatory microbiological/biochemical tests.

4.2. PCR to Confirm the Bap Gene

The results of electrophoresis of the Bap gene PCR products on agarose gel are shown in Figure 1.

4.3. Preparation of Derivatives

4a: (5-(phenyl)-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4b: (5-(3-(bromophenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4c: (5-(3-(chlorophenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol, 4d: (5-((naphthalene)-2-il)-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4e: (5-(3-(fluorophenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4f: (5-(4-(fluorophenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4g: (5-(3,4-(difluorophenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4h: (5-(4-(methoxyphenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol; 4i: (5-(3-(methoxyphenyl))-1,3,4-oxadiazole-2-il)(pyridine-2-il)methanol (Figure 2).
Structures of new derivatives of 1, 3, 4-oxadiazole (<a href="#A111894REF14">14</a>) and MIC results
Figure 2.

Structures of new derivatives of 1, 3, 4-oxadiazole (14) and MIC results

4.4. MIC Results

The results showed that the combinations of 4a, 4d, and 4i, respectively, have the minimum inhibitory concentrations of 500, 250, and 62.50. In this regard, compound 4i has the highest inhibitory effect among the synthesized compounds. Among the compounds, this compound (4i) was used to continue experiments (Figure 2).

4.5. Real-time PCR

Figure 3 shows the Bap gene amplification diagram before and after treatment with compound 4i and the 16srRNA gene progression diagram as the housekeeping gene, along with a table of calculated CT values. A1 shows the Bap gene before treatment with compound 4i, A2 exhibits the Bap gene after treatment with compound 4i, S1 displays the housekeeping gene before treatment with compound 4i, and S2 shows the housekeeping gene after treatment with compound 4i. Controls template No (NTCS) did not have a reaction progression graph, but the samples had an exponential multiplication graph, and multiplication was performed. The 16srRNA gene was obtained before and after treatment at 14.51 and 14.03, respectively, considering that the difference in Ct before and after treatment with the combination of 4i was as small as 0.48; thus, the 16srRNA gene was used as a home gene and an internal standard. The results of the melting curve of the Bap gene in the clinical strain of A .baumannii treated with 4i showed that the main peak for the Bap gene occurs at 79 to 80°C. The ΔCt results of the Bap gene in the presence of the 4i combination are given below. The PFAFFL method was used to determine the expression of the Bap gene. In this method, it is assumed that the sample yield and internal control are equal to 100%, and the 2-ΔΔCt formula was used to investigate gene expression.
CT = 24.6 = 24.25
<i>Bap</i> gene replication diagram
Figure 3.

Bap gene replication diagram

As can be noted, the combination of 4i reduced the expression of the Bap gene by about 24 times, but it had no effect on the expression of the 16srRNA housekeeping gene.

5. Discussion

Acinetobacter baumannii is the most common human pathogen in the genus Acinetobacter and is considered as one of the most important causes of nosocomial infections. One of the major problems in the treatment and prevention of infections caused by A. baumannii is antibiotic resistance, and carbapenems are the last line of treatment in infections caused by Gram-negative bacteria, including A. baumannii. The main factor of resistance can be biofilm production. There have been many studies on the resistance of Acinetobacter, the results of which have varied according to time and place (14-17). Therefore, one of the central goals of this research was to synthetize new structures for the treatment and elimination of this bacterium.
In recent years, the resistance and stability of bacteria to antibiotics has been a good reason to research the gene expressing biofilm (Bap) in various bacteria. For example, De Gregorio et al. conducted a study on proteins related to Acinetobacter biofilm. They stated that a large protein called Bap was involved in the formation of biofilms and the attachment of A. baumannii to host cells. The results of this group showed that several proteins with Ig-like repeats appear to be involved in biofilm formation (18). It can be said that several researchers have been interested in studying the resistance of A. baumannii to various antibiotics.
In 2016, Qi et al. conducted a study on the relationship between antibiotic resistance, biofilm formation, and biofilm specific resistance in A. baumannii. In their study, the relationship between antibiotic resistance, biofilm formation, and biofilm specific resistance in clinical isolates of A. baumannii was investigated (19). Other researchers have tried to show the effect of biofilm on the stability and survival of bacteria in the environment, especially in hospitals, which is a factor in causing nosocomial infections. Regarding biofilm structure, Fernández-Cuenca et al. demonstrated that in A. baumannii, adhesive cells that are coated with various coatings form an intermediate biofilm structure in the absence of nutrients. The findings indicate a rapid increase in the number of biofilm cells and a relative increase in the number of cells containing resistance (20).
This study proved that the presence of a biofilm in A. baumannii protects this microorganism against various antibacterial factors. The extraordinary ability of numerous structures containing the 1, 3, 4-oxadiazole ring as an antimicrobial agent has led to the use of derivatives of these structures in several studies. Various studies have shown that structures containing 1, 3, 4-oxadiazole have a significant ability to inhibit bacterial infectious diseases. In our previous study (14), we tested synthesis derivatives at a concentration of 1 mg/mL on a standard sample of A. baumannii, but in this study, despite a concentration 10 times lower and the use of a clinical sample, amazing results were obtained.
The 4i derivative in the presence of methoxyphenyl attached to the main structure had acceptable anti-biofilm properties against A. baumannii. Methoxyphenyl is one of the most effective compounds in various structures of 1, 3, 4-oxadiazoles, whose antibacterial and anti-cancer properties have already been proven. This compound (methoxyphenyl) has the ability to affect the cytoplasmic membrane, electron transport chain, metabolic activity, and gene synthesis and inhibit protein synthesis. By studying these compounds on other virulence genes of A. baumannii, we can study these compounds and other derivatives of these structures in laboratory and animal studies as a treatment or adjunctive therapy in the form of tablets or additives used in patients' food as well as hand and environment disinfectants to prevent the spread of infection caused by this bacterium in hospital settings.

Acknowledgments

Footnotes

  • Authors' Contribution: Study concept and design, N. Z. , Y. S.; Acquisition of data, N. Z., Y. S., and S. A.; Analysis and interpretation of data, N. Z., Y. S., and S. A.; Drafting of the manuscript, N. Z. and Y. S.; Critical revision of the manuscript for important intellectual content, N. Z. and Y. S.; Statistical analysis, N. Z,, Y. S,, and S. A.; Administrative, technical, and material support, N. Z. and Y. S.; Study supervision, N. Z. and Y. S.

  • Conflict of Interests: The authors declare no conflicts of interest.

  • Ethical Approval: This Research study was conducted in Genetic laboratory of Islamic Azad University, Tehran branch, with code number, 10130553971011 in 2019.

  • Funding/Support: This study was supported by Islamic Azad University of Central Tehran Branch.

References

  • 1.
    Ma YX, Wang CY, Li YY, Li J, Wan QQ, Chen JH, et al. Considerations and caveats in combating ESKAPE Pathogens against nosocomial infections. Adv Sci. 2020;7(1):1901872. [PubMed ID: 31921562]. [PubMed Central ID: PMC6947519]. https://doi.org/10.1002/advs.201901872.
  • 2.
    Huang W, Zhang Q, Li W, Chen Y, Shu C, Li Q, et al. Anti-outer membrane vesicle antibodies increase antibiotic sensitivity of pan-drug-resistant Acinetobacter baumannii. Front Microbiol. 2019;10:1379. [PubMed ID: 31275290]. [PubMed Central ID: PMC6591364]. https://doi.org/10.3389/fmicb.2019.01379.
  • 3.
    Andersson DI, Hughes D. Selection and transmission of antibiotic-resistant bacteria. In: Baquero F, Bouza E, Gutiérrez-Fuentes J, Coque T, editors. Microbial transmission. Washington, DC, USA: ASM Press; 2019. p. 117-37. https://doi.org/10.1128/microbiolspec.MTBP-0013-2016.
  • 4.
    Nicol M, Alexandre S, Luizet JB, Skogman M, Jouenne T, Salcedo SP, et al. Unsaturated fatty acids affect quorum sensing communication system and inhibit motility and biofilm formation of Acinetobacter baumannii. Int J Mol Sci. 2018;19(1). [PubMed ID: 29320462]. [PubMed Central ID: PMC5796163]. https://doi.org/10.3390/ijms19010214.
  • 5.
    Flemming HC, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. Biofilms: An emergent form of bacterial life. Nat Rev Microbiol. 2016;14(9):563-75. [PubMed ID: 27510863]. https://doi.org/10.1038/nrmicro.2016.94.
  • 6.
    Kumar A, Alam A, Rani M, Ehtesham NZ, Hasnain SE. Biofilms: Survival and defense strategy for pathogens. Int J Med Microbiol. 2017;307(8):481-9. [PubMed ID: 28950999]. https://doi.org/10.1016/j.ijmm.2017.09.016.
  • 7.
    Uppalapati SR, Sett A, Pathania R. The outer membrane proteins OmpA, CarO, and OprD of Acinetobacter baumannii confer a two-pronged defense in facilitating its success as a potent human pathogen. Front Microbiol. 2020;11:589234. [PubMed ID: 33123117]. [PubMed Central ID: PMC7573547]. https://doi.org/10.3389/fmicb.2020.589234.
  • 8.
    Tiwari V, Patel V, Tiwari M. In-silico screening and experimental validation reveal L-Adrenaline as anti-biofilm molecule against biofilm-associated protein (Bap) producing Acinetobacter baumannii. Int J Biol Macromol. 2018;107(Pt A):1242-52. [PubMed ID: 28964839]. https://doi.org/10.1016/j.ijbiomac.2017.09.105.
  • 9.
    Gorlenko CL, Kiselev HY, Budanova EV, Zamyatnin AJ, Ikryannikova LN. Plant secondary metabolites in the battle of drugs and drug-resistant bacteria: New heroes or worse clones of antibiotics? Antibiotics. 2020;9(4). [PubMed ID: 32290036]. [PubMed Central ID: PMC7235868]. https://doi.org/10.3390/antibiotics9040170.
  • 10.
    Akbari Dilmaghani K, Nasuhi Pur F, Mahammad Pour M, Mahammad Nejad J. Novel oxadiazole thioglycosides as potential anti-Acinetobacter agents. Iran J Pharm Res. 2016;15(4):777-82. [PubMed ID: 28243273]. [PubMed Central ID: PMC5316255].
  • 11.
    Yarmohammadi E, Beyzaei H, Aryan R, Moradi A. Ultrasound-assisted, low-solvent and acid/base-free synthesis of 5-substituted 1,3,4-oxadiazole-2-thiols as potent antimicrobial and antioxidant agents. Mol Divers. 2020. [PubMed ID: 32770458]. https://doi.org/10.1007/s11030-020-10125-y.
  • 12.
    Tresse C, Radigue R, Gomes Von Borowski R, Thepaut M, Hanh Le H, Demay F, et al. Synthesis and evaluation of 1,3,4-oxadiazole derivatives for development as broad-spectrum antibiotics. Bioorg Med Chem. 2019;27(21):115097. [PubMed ID: 31540826]. https://doi.org/10.1016/j.bmc.2019.115097.
  • 13.
    Malathi K, Anbarasu A, Ramaiah S. Exploring the resistance mechanism of imipenem in carbapenem hydrolysing class D beta-lactamases OXA-143 and its variant OXA-231 (D224A) expressing Acinetobacter baumannii: An in-silico approach. Comput Biol Chem. 2017;67:1-8. [PubMed ID: 28012345]. https://doi.org/10.1016/j.compbiolchem.2016.12.001.
  • 14.
    SarveAhrabi Y, Souldozi A, Zarrabi Ahrabi N. In vitro evaluation of antimicrobial properties of some new 1, 3, 4-oxadiazole derivatives against Acinetobacter baumannii. Infection Epidemiology and Microbiology. 2020;6(1):37-49. https://doi.org/10.29252/iem.6.1.37.
  • 15.
    Kroger C, Kary SC, Schauer K, Cameron AD. Genetic regulation of virulence and antibiotic resistance in Acinetobacter baumannii. Genes. 2016;8(1). [PubMed ID: 28036056]. [PubMed Central ID: PMC5295007]. https://doi.org/10.3390/genes8010012.
  • 16.
    Clark NM, Zhanel GG, Lynch J3. Emergence of antimicrobial resistance among Acinetobacter species: A global threat. Curr Opin Crit Care. 2016;22(5):491-9. [PubMed ID: 27552304]. https://doi.org/10.1097/MCC.0000000000000337.
  • 17.
    Al-Kadmy IMS, Ibrahim SA, Al-Saryi N, Aziz SN, Besinis A, Hetta HF. Prevalence of genes involved in colistin resistance in Acinetobacter baumannii: First report from Iraq. Microb Drug Resist. 2020;26(6):616-22. [PubMed ID: 31816255]. https://doi.org/10.1089/mdr.2019.0243.
  • 18.
    De Gregorio E, Esposito EP, Zarrilli R, Di Nocera PP. Contact-dependent growth inhibition proteins in Acinetobacter baylyi ADP1. Curr Microbiol. 2018;75(11):1434-40. [PubMed ID: 30019131]. [PubMed Central ID: PMC6182759]. https://doi.org/10.1007/s00284-018-1540-y.
  • 19.
    Qi L, Li H, Zhang C, Liang B, Li J, Wang L, et al. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Front Microbiol. 2016;7:483. [PubMed ID: 27148178]. [PubMed Central ID: PMC4828443]. https://doi.org/10.3389/fmicb.2016.00483.
  • 20.
    Fernández-Cuenca F, Tomás M, Caballero-Moyano FJ, Bou G, Martínez-Martínez L, Vila J, et al. Reduced susceptibility to biocides in Acinetobacter baumannii: association with resistance to antimicrobials, epidemiological behaviour, biological cost and effect on the expression of genes encoding porins and efflux pumps. J Antimicrob Chemother. 2015;70(12):3222-9. [PubMed ID: 26517560]. https://doi.org/10.1093/jac/dkv262.

Copyright

Copyright © 2021, Gene, Cell and Tissue. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

24
Jun
2018
Acinetobacter baumannii, Alamy

Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii

Ehsan Ghasemi,
Zohreh Ghalavand,
Hossein Goudarzi,
Farshid Yeganeh,
Ali Hashemi,
Hossein Dabiri
,et al.

Ghasemi E, Ghalavand Z, Goudarzi H, Yeganeh F, Hashemi A, et al. Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii. Arch Clin Infect Dis. 2018;13(4):e12914. doi: https://doi.org/10.5812/archcid.12914

23
Apr
2019
85766

Detection of Genes Involved in Biofilm Formation in MDR and XDR Acinetobacter baumannii Isolated from Human Clinical Specimens in Isfahan, Iran

Ahad Mahmoudi Monfared,
Aliakbar Rezaei,
Farkhondeh Poursina,
Jamshid Faghri

Mahmoudi Monfared A, Rezaei A, Poursina F, Faghri J. Detection of Genes Involved in Biofilm Formation in MDR and XDR Acinetobacter baumannii Isolated from Human Clinical Specimens in Isfahan, Iran. Arch Clin Infect Dis. 2019;14(2):e85766. doi: https://doi.org/10.5812/archcid.85766

13
Jun
2023

Expression of Biofilm-Related Genes in Extensively Drug-Resistant Acinetobacter baumannii

Maryam Khosravy,
Farzaneh Hosseini,
Mohamad Reza Razavi,
Ramazan Ali Khavari

Khosravy M, Hosseini F, Razavi MR, Khavari RA. Expression of Biofilm-Related Genes in Extensively Drug-Resistant Acinetobacter baumannii. Jundishapur J Microbiol. 2023;16(4):e133999. doi: https://doi.org/10.5812/jjm-133999

12
Jan
2015

Molecular Detection of Class-D OXA Carbapenemase Genes in Biofilm and Non-Biofilm Forming Clinical Isolates of Acinetobacter baumannii

Omid Azizi,
Mohammad Reza Shakibaie,
Farzan Modarresi,
Fereshteh Shahcheraghi

Azizi O, Shakibaie MR, Modarresi F, Shahcheraghi F. Molecular Detection of Class-D OXA Carbapenemase Genes in Biofilm and Non-Biofilm Forming Clinical Isolates of Acinetobacter baumannii. Jundishapur J Microbiol. 2015;8(1):e21042. doi: https://doi.org/10.5812/jjm.21042

3
Aug
2022
Gene Cell Tissue

Expression of bap Gene in Clinical Acinetobacter baumannii Isolates in Khorramabad, Iran

Pegah Shakib,
Shahnaz Halimi,
Faranak Rezaei,
Somayeh Delfani

Shakib P, Halimi S, Rezaei F, Delfani S. Expression of bap Gene in Clinical Acinetobacter baumannii Isolates in Khorramabad, Iran. Gene Cell Tissue. 2022;10(2):e124061. doi: https://doi.org/10.5812/gct-124061

Download PDF790.45 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles