Association of EPHA3 Gene Variation with Oral Hygiene in an Iranian Population

Author(s):
Hoshangh RafighdoosthHoshangh Rafighdoosth1, Elaheh HasanpourElaheh Hasanpour1, Mohamad HashemiMohamad HashemiMohamad Hashemi ORCID2, Gholamreza BahariGholamreza Bahari2, 3,**, Mohsen TaheriMohsen TaheriMohsen Taheri ORCID4, 5,*
1Department of Anatomy, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran
2Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran
3Children and Adolescent Health Research Center, Zahedan University of Medical Sciences, Zahedan, Iran
4Genetics of Non-communicable Disease Research Center, Zahedan University of Medical Sciences, Zahedan, Iran
5Genetic Department, School of Medicine, Zahedan University of Medical Sciences, Zahedan,Iran
Corresponding Authors:

Health Scope:Vol. 13, issue 2; e142145
Published online:Apr 29, 2024
Article type:Research Article
Received:Oct 22, 2023
Accepted:Jan 22, 2024
How to Cite:Rafighdoosth H, Hasanpour E, Hashemi M, Bahari G, Taheri M. Association of EPHA3 Gene Variation with Oral Hygiene in an Iranian Population. Health Scope. 2024;13(2):e142145. doi: https://doi.org/10.5812/healthscope-142145

Abstract

Background:

Non-syndromic cleft lip with or without cleft palate (NSCL/P) is the most prevalent congenital birth anomaly. The EPHA3 gene is suggested to play a pivotal role in the development of oral clefts.

Objectives:

This study aimed to evaluate the influence of EPHA3 gene polymorphisms on the risk of NSCL/P within an Iranian cohort.

Methods:

We performed genotyping of the EPHA3 gene polymorphisms rs7650466, rs1398197, rs17801309, rs1054750, and rs7632427 in 150 NSCL/P patients and 152 healthy controls using PCR-RFLP, T-ARMS-PCR, and ARMS-PCR methods.

Results:

The results indicated that the rs1398197 variation significantly reduced the risk of NSCL/P in a heterozygous codominant model (OR = 0.58, 95% CI = 0.36 - 0.94, P = 0.027, G/A vs. G/G), a dominant model (OR = 0.56, 95% CI = 0.35 - 0.89, P = 0.014, G/A + A/A vs. G/G), and at the allele level (OR = 0.62, 95% CI = 0.43 - 0.91, P = 0.014, A vs. G). The rs1054750 polymorphism showed a decreased risk of NSCL/P in codominant (OR = 0.62, 95% CI = 0.39 - 0.99, P = 0.047, T/C vs. T/T) and dominant models (OR = 0.62, 95% CI = 0.39 - 0.98, P = 0.042, T/C + C/C vs. T/T). The rs17801309 polymorphism was not associated with any risk or protection from NSCL/P. rs7650466 and rs7632427 were not polymorphic in the study sample.

Conclusions:

Our findings suggest that variants of the EPHA3 gene may be linked with a reduced risk of NSCL/P.

1. Background

Certainly, activities such as speaking, swallowing, and chewing require a healthy anatomical structure of the oral cavity. Defects like cleft palate (CP) in infants can cause food to enter the nasal cavity during feeding. This can lead to slurred speech, bad breath, and psychological consequences that significantly affect the child’s family. Such complications can arise from chromosomal syndromes or occur in non-syndromic cases. Non-syndromic cleft lip with or without cleft palate (NSCL/P) is a universally common congenital anomaly among live births (1). The prevalence of NSCL/P varies across different ethnicities; it is highest in Asian and American Indian populations at approximately 1/500, about 1/1000 in Europeans, and lowest in Africans at around 1/2500 (2). Non-syndromic cleft lip with or without cleft palate often results in facial deformity and difficulties in speech and swallowing (3). Both environmental and genetic factors contribute to the susceptibility to NSCL/P (1, 4-6).

Non-syndromic cleft lip with or without cleft palate can be categorized into cleft lip only (CLO), cleft palate only (CPO), and cleft lip with cleft palate (CLP). Cleft lip only and CLP are considered variations of the same defect and are grouped together epidemiologically as cleft lip with or without cleft palate (CL/P) (7).

The EPHA3 gene, located on chromosome 3 at 3p11.1 and comprising 17 exons (also known as EK4, ETK, HEK, ETK1, HEK4, and TYRO4), belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family (8). EPHA3 is involved in several developmental processes including morphogenesis, cell adhesion, movement, contraction, and regulation of axon guidance (9-11). Animal studies have shown that B-type ephrin is highly expressed in the pre-fusion epithelium of the palatal shelves, suggesting its potential role as a candidate gene for CLP (12). Another study indicated that EPHA3 is highly expressed in palatal mesenchymal cells during palatal development (13).

The rs7632427 polymorphism, located in the 3´UTR of EPHA3, plays a controlling role in the progression of NSCL/P (14). Additionally, rs7632427 has been associated with NSCL/P (15). These studies suggest that EPHA3 is crucial in the development of the lip and palate and may participate in the pathogenesis of NSCL/P.

2. Objectives

We conducted this investigation to examine the association between EPHA3 variations and susceptibility to NSCL/P in a sample population from southeast Iran.

3. Methods

This case-control study included 150 patients with NSCL/P and 152 healthy subjects. The control samples consisted of unaffected, unrelated individuals without a family history of clefting, collected as randomly selected, population-based controls from Zahedan. All patients were diagnosed independently and were screened by a multidisciplinary team of specialists to exclude cleft-associated syndromes, such as DiGeorge, Stickler, Nager, and Van der Woude syndromes. The design of this investigation was based on previous studies (16). The project was approved by the local Ethics Committee of Zahedan University of Medical Sciences (IR.Zaums.REC.1398.122), and written informed consent was obtained from all participants or their parents. Blood samples from all participants were collected in tubes containing EDTA and stored at -20°C prior to DNA extraction. Genomic DNA was extracted using the salting-out method.

3.1. Genotyping

Genotyping of the variants was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), Tetra-ARMS, and ARMS-PCR methods. The primer sequences, annealing temperatures, restriction enzymes, and product sizes are displayed in Table 1. PCR was conducted using prime Taq premix (Genet bio, South Korea) according to the manufacturer’s suggested procedure. Each 0.20 - milliliter PCR reaction tube contained 1 microliter of genomic DNA (~ 100 ng/mL), 1 microliter of each primer (10 μM), 10 microliters of 2X Prime Taq premix, and 7 microliters of ddH2O for the PCR-RFLP and ARMS-PCR methods (and 5 microliters of ddH2O for the Tetra-ARMS PCR method). The PCR conditions included an initial denaturation at 95°C for 5 minutes, followed by 30 cycles of 30 seconds at 95°C, annealing at the temperature listed in Table 1 for 30 seconds, and an extension at 72°C for 30 seconds, with a final extension of 72°C for 5 minutes. The PCR products (10 μL for PCR-RFLP) were digested by appropriate restriction enzymes as specified in "Table 1", analyzed by agarose gel electrophoresis, and visualized on a UV transilluminator.

Table 1.The Primers Used for the Detection of EPHA3 Polymorphisms Using PCR-RFLP, ARMS-PCR or Tetra-ARMS Methods
Polymorphism EPHA3Primer Sequence (5’ – 3’)MethodAnnealing, °CRestriction EnzymeFragment, bp
rs7650466F: TTTTGAAAAGATGTACCTGGTGGAPCR-RFLP58DdeIT allele = 233; C allele = 210 + 23
R: TCTACAACAGATGAGCACTTCTG
rs1398197F (G allele): AGAAGCTATAGCCTACCGCCAGARMS-PCR58-Product size = 211
F (A allele): AGAAGCTATAGCCTACCGCCAA
R: ACCAGGAGCCACCCAGTTACAT
rs17801309F: GAAGGGGAGAACTTAGACAAGATGATTPCR-RFLP62BstXIG allele = 294; A allele = 263 + 31
R: TGTCCAGACACCATTAAGCCAGTCACCAG
rs1054750FO: CATCAAACCTTCTTCTGGACCAAAGTetra-ARMS PCR60-Control = 285; T allele = 200; C allele = 133
RO: CGGTAGTCAGTACCTCAGATCTACCACTAA
FI (T allele): CACTGCAAGGAAATCTTCACGTGT
RI (C allele): GTGTCACAAGAACTGTACTCCCCG
rs7632427F: GCCTTTTCTTCAGTGTCTAACTPCR-RFLP56BccIT allele = 307; C allele = 190 + 117
R: ACTCTTCACTTGCTTCACTCAT

3.2. Statistical Analysis

Data analysis was performed using the statistical package SPSS 20 software (IBM Corp., Armonk, NY, USA). The associations between EPHA3 variants and NSCL/P risk were evaluated by odds ratios (ORs) and 95% confidence intervals (CIs) under different genetic models. SNPstats software was utilized for haplotype determination. P-values less than 0.05 were considered statistically significant.

4. Results

A total of 302 subjects, comprising 150 NSCL/P patients and 152 unrelated healthy subjects, were evaluated. The demographic characteristics of the subjects are shown in Table 2. Of the 150 patients, 54 had a cleft lip (CL), 51 had a CLP, and 45 had a CP. No statistically significant differences were found between the groups regarding sex and age (P = 0.352 and P = 0.101, respectively). Genotypic and allelic frequencies of EPHA3 gene polymorphisms are presented in Table 3. The findings showed that the rs1398197 polymorphism significantly decreased the odds of NSCL/P in a heterozygous codominant model (OR = 0.58, 95% CI = 0.36 - 0.94, P = 0.027, GA vs. GG), a dominant model (OR = 0.56, 95% CI = 0.35 - 0.89, P = 0.014, GA+AA vs. GG), and an allelic model (OR = 0.62, 95% CI = 0.43 - 0.91, P = 0.014, A vs. G). The rs1054750 variant was associated with protection against NSCL/P in codominant (OR = 0.62, 95% CI = 0.39 - 0.99, P = 0.047, TC vs. TT) and dominant models (OR = 0.62, 95% CI = 0.39 - 0.98, P = 0.042, TC + CC vs. TT). No significant association was detected among rs17801309 polymorphisms and NSCL/P. rs7650466 and rs7632427 were not polymorphic in the study. Stratified analysis was conducted according to CL, CLP, and CP (Table 4). The results suggested that the GA genotype.

Table 2.Demographic Characteristics of Cases and Controls a
CharacteristicsControls (n = 152)CL/P (n = 150)CL (n = 54)CP (n = 45)CLP (n = 51)P-Value
Age (y)9.09 ± 9.057.62 ± 5.558.74 ± 5.647.76 ± 5.586.31 ± 5.240.101
Sex0.352
Male85 (55.9)92 (61.3)34 (63.0)27 (60.0)31 (60.8)
Female67 (44.1)58 (38.7)20 (37.0)18 (40.0)20 (39.2)

a Values are expressed as mean ± SD or No. (%).

Table 3.Genotypic and Allelic Frequencies of EPHA3 Genes Polymorphisms Among Cases and Controls and Their Association with Non-syndromic Cleft Lip with or Without Cleft Palate
Polymorphism EPHA3Cases ControlsOR (95%CI)P-Value
rs1398197
Codominant
G/G97 (64.7)77 (50.7)1 -
G/A46 (30.7)63 (41.4)0.58 (0.36 - 0.94)0.027
A/A7 (4.6)12 (7.9)0.46 (0.17 - 1.23)0.123
Dominant
G/G97 (64.7)77 (50.7)1 -
G/A + A/A53 (35.3)75 (49.3)0.56 (0.35 - 0.89)0.014
Recessive
G/G + G/A143 (95.4)140 (92.1)1 -
A/A7 (4.6)12 (7.9)0.57 (0.22 - 1.49)0.248
Allele
G240 (80.0)217 (71.4)1 -
A60 (20.0)87 (28.6)0.62 (0.43 - 0.91)0.014
rs17801309
Codominant
G/G120 (80.0)116 (76.3)1 -
G/A26 (17.3)31 (20.4)0.81 (0.45 - 1.45)0.479
A/A4 (2.7)5 (3.3)0.77 (0.20 - 2.95)0.773
Dominant
G/G120 (80.0)116 (76.3)1 -
G/A + A/A30 (20.0)36 (23.7)0.80 (0.46 - 1.39)0.439
Recessive
G/G + G/A146 (97.3)147 (96.7)1 -
A/A4 (2.7)5 (3.3)0.81 (0.21 - 3.06)0.750
Allele
G266 (88.7)263 (86.5)1 -
A34 (11.3)41 (13.5)0.82 (0.50 - 1.33)0.422
rs1054750
Codominant
T/T100 (66.7)84 (55.2)1 -
T/C48 (32.0)65 (42.8)0.62 (0.39 - 0.99)0.047
C/C2 (1.3)3 (2.0)0.56 (0.09 - 3.43)0.525
Dominant
T/T100 (66.7)84 (55.2)1 -
T/C + C/C50 (33.3)68 (44.8)0.62 (0.39 - 0.98)0.042
Recessive
T/T + T/C148 (98.7)149 (98.0)1 -
C/C2 (1.3)3 (2.0)0.67 (0.11 - 4.08)0.663
Allele
T248 (82.7)233 (76.6)1 -
C52 (17.3)71 (23.4)0.88 (0.59 - 1.31)0.526

a Values are expressed as No. (%) except otherwise indicated.

Table 4.Genotype and Allele Frequencies of EPHA3 Gene Polymorphisms in Subjects with Confidence Interval, Cleft Lip with Cleft Palate, and Cleft Palate
PolymorphismControlCLOR (95%CI), P-ValueCLPOR (95%CI), P-ValueCPOR (95%CI), P-Value
rs1398197
G/G77 (50.7)30 (55.6)135 (68.6)132 (71.1)1
G/A63 (41.4)20 (37.0)0.81 (0.42 - 1.57), 0.54114 (27.5)0.49 (0.24 - 0.99), 0.04412 (26.7)0.46 (0.22 - 0.96), 0.037
A/A12 (7.9)4 (7.4)0.86 (0.26 - 2.86), 0.7992 (3.9)0.37 (0.08 - 1.73), 0.1891 (2.2)0.60 (0.06 - 5.59), 0.652
Allele
G217 (71.4)80 (74.1)184 (82.4)176 (84.4)1
A87 (28.6)28 (25.9)0.87 (0.53 - 1.44), 0.59218 (17.6)0.53 (0.30 - 0.94), 0.02814 (15.6)0.46 (0.25 - 0.86), 0.013
rs17801309
G/G116 (76.3)45 (83.3)140 (78.5)135 (77.8)1
G/A31 (20.4)9 (16.7)0.75 (0.33 - 1.70), 0.4877 (13.7)0.65 (0.27 - 1.60), 0.35210 (22.2)1.07 (0.48 - 2.40), 0.871
A/A5 (3.3)0 (0.0) - 4 (7.8)2.32 (0.59 - 9.07), 0.2150 (0.0) -
Allele
G263 (86.5)99 (91.7)187 (85.3)180 (88.9)1
A41 (13.5)9 (8.3)0.58 (0.27 - 1.24), 0.15915 (14.7)1.11 (0.58 - 2.09), 0.75710 (11.1)0.80 (0.38 - 1.67), 0.555
rs1054750
T/T84 (55.2)36 (66.7)132 (62.7)132 (71.1)1
T/C65 (42.8)16 (29.6)0.57 (0.29 - 1.12), 0.10419 (37.3)0.77 (0.40 - 1.48), 0.4313 (28.9)0.52 (0.26 - 1.08), 0.077
C/C3 (2.0)2 (3.7)1.56 (0.25 - 9.71), 0.6340 (0.0) - 0 (0.0) -
Allele
T233 (76.6)88 (81.5)183 (81.4)177 (85.6)1
C71 (23.4)20 (18.5)0.95 (0.55 - 1.65), 0.86619 (18.6)0.96 (0.55 - 1.68), 0.8913 (14.4)0.71 (0.37 - 1.35), 0.291

a Values are expressed as No. (%) except otherwise indicated.

5. Discussion

The pathogenesis of NSCL/P is influenced by genetic and environmental factors (4, 17, 18). Previous studies have highlighted the role of the EPHA3 gene in susceptibility to NSCL/P, noting variations across different populations (14, 15, 19). This study aimed to evaluate the association between EPHA3 polymorphisms rs7650466, rs1398197, rs17801309, rs1054750, and rs7632427, and the odds of NSCL/P. Our results demonstrated that the rs1398197 and rs1054750 variants significantly reduced the odds of NSCL/P. However, no significant association was found between the rs17801309 polymorphism and NSCL/P in our investigation. Additionally, the rs7650466 and rs7632427 variants were not polymorphic in our study population.

The findings from our stratified analysis suggested that the GA genotype and A allele of the rs1398197 variant significantly decreased the odds of both CP and CLP. Pan et al. examined the association between six loci (rs7590268, rs7632427, rs12543318, rs1873147, rs8001641, and rs742071) and the risk of NSCL/P. They found that the rs7590268 variant was associated with an increased risk of NSCL/P, while rs7632427, rs12543318, and rs1873147 exhibited protective effects. No relationship was found between rs742071 and rs8001641 and the risk of NSCL/P in their study, underscoring the role of these genes in craniofacial development and their potential association with common orthopedic birth defects (15).

Chen et al. evaluated the impact of five SNPs in EPHA3 on the risk of NSCL/P and found that only the rs7650466 variant was associated with a decreased risk of NSCL/P. The other four SNPs showed no statistically significant differences between the NSCL/P and control groups in their study (20).

They hypothesized that EPHA3 plays a crucial role in the development of cranial and maxillofacial structures. Additionally, they found that this polymorphism could alter the binding site of miR - 2052 to the 3’-UTR of EPHA3. A decrease in binding capacity led to reduced expression of EPHA3 and a decreased incidence of NSCL/P (20). There are some limitations to this study, including the relatively small sample sizes. Another limitation is that we did not examine the biological functions of the polymorphisms. In summary, our results suggest that variations in the EPHA3 gene may contribute to NSCL/P susceptibility. Future large-scale, well-designed studies with diverse ethnicities are needed to confirm the role of EPHA3 gene polymorphisms in NSCL/P risk.

Acknowledgments

Footnotes

References

  • 1.
    Sahin Uysal N, Sahin FI, Terzi YK. The impact of developmental genes in non-syndromic cleft lip and/or palate. J Turk Ger Gynecol Assoc. 2023;24(1):57-64. [PubMed ID: 36919534]. [PubMed Central ID: PMC10019015]. https://doi.org/10.4274/jtgga.galenos.2022.2021-10-7.
  • 2.
    Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet. 2011;12(3):167-78. [PubMed ID: 21331089]. [PubMed Central ID: PMC3086810]. https://doi.org/10.1038/nrg2933.
  • 3.
    Silva MARD, Balderrama IDF, Wobeto AP, Werneck RI, Azevedo-Alanis LR. The impact of nonsyndromic cleft lip with or without cleft palate on oral health-related quality of life. J Appl Oral Sci. 2018;26(0). https://doi.org/10.1590/1678-7757-2017-0145.
  • 4.
    Xu DP, Qu WD, Sun C, Cao RY, Liu DW, Du PG. A Study on Environmental Factors for Nonsyndromic Cleft Lip and/or Palate. J Craniofac Surg. 2018;29(2):364-7. [PubMed ID: 29283947]. https://doi.org/10.1097/SCS.0000000000004214.
  • 5.
    Rafighdoost H, Poudineh A, Bahari G, Ghaffari H, Hashemi M. Association of Genetic Polymorphisms of GREM1 Gene with Susceptibility to Non-Syndromic Cleft Lip with or without Cleft Palate in an Iranian Population. Fetal Pediatr Pathol. 2020;39(5):409-21. [PubMed ID: 31650875]. https://doi.org/10.1080/15513815.2019.1666329.
  • 6.
    Niktabar SM, Aarafi H, Dastgheib SA, Noorishadkam M, Mirjalili SR, Lookzadeh MH, et al. Association of MTHFR 1298A > C Polymorphism with Susceptibility to Non-Syndromic Cleft Lip with or without Palate: A Case-Control Study and Meta-Analysis. Fetal Pediatr Pathol. 2021;40(1):1-17. [PubMed ID: 31682771]. https://doi.org/10.1080/15513815.2019.1683918.
  • 7.
    Leslie EJ, Marazita ML. Genetics of cleft lip and cleft palate. Am J Med Genet C Semin Med Genet. 2013;163C(4):246-58. [PubMed ID: 24124047]. [PubMed Central ID: PMC3925974]. https://doi.org/10.1002/ajmg.c.31381.
  • 8.
    Klein R. Eph/ephrin signalling during development. Dev. 2012;139(22):4105-9. [PubMed ID: 23093422]. https://doi.org/10.1242/dev.074997.
  • 9.
    Janes PW, Slape CI, Farnsworth RH, Atapattu L, Scott AM, Vail ME. EphA3 biology and cancer. Growth Factors. 2014;32(6):176-89. [PubMed ID: 25391995]. https://doi.org/10.3109/08977194.2014.982276.
  • 10.
    Janes PW, Nievergall E, Lackmann M. Concepts and consequences of Eph receptor clustering. Semin Cell Dev Biol. 2012;23(1):43-50. [PubMed ID: 22261642]. https://doi.org/10.1016/j.semcdb.2012.01.001.
  • 11.
    Lawrenson ID, Wimmer-Kleikamp SH, Lock P, Schoenwaelder SM, Down M, Boyd AW, et al. Ephrin-A5 induces rounding, blebbing and de-adhesion of EphA3-expressing 293T and melanoma cells by CrkII and Rho-mediated signalling. J Cell Sci. 2002;115(Pt 5):1059-72. [PubMed ID: 11870224]. https://doi.org/10.1242/jcs.115.5.1059.
  • 12.
    Agrawal P, Wang M, Kim S, Lewis AE, Bush JO. Embryonic expression of EphA receptor genes in mice supports their candidacy for involvement in cleft lip and palate. Dev Dyn. 2014;243(11):1470-6. [PubMed ID: 25073978]. [PubMed Central ID: PMC4404412]. https://doi.org/10.1002/dvdy.24170.
  • 13.
    Xavier GM, Miletich I, Cobourne MT. Ephrin Ligands and Eph Receptors Show Regionally Restricted Expression in the Developing Palate and Tongue. Front Physiol. 2016;7:60. [PubMed ID: 26941654]. [PubMed Central ID: PMC4763095]. https://doi.org/10.3389/fphys.2016.00060.
  • 14.
    Ludwig KU, Mangold E, Herms S, Nowak S, Reutter H, Paul A, et al. Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. Nat Genet. 2012;44(9):968-71. [PubMed ID: 22863734]. [PubMed Central ID: PMC3598617]. https://doi.org/10.1038/ng.2360.
  • 15.
    Pan Y, Han Y, Zhang H, Zhou L, Li D, Cai Q, et al. Association and cumulative effects of GWAS-identified genetic variants for nonsyndromic orofacial clefts in a Chinese population. Environ Mol Mutagen. 2013;54(4):261-7. [PubMed ID: 23536526]. https://doi.org/10.1002/em.21773.
  • 16.
    Rafighdoost H, Hashemi M, Narouei A, Eskanadri-Nasab E, Dashti-Khadivaki G, Taheri M. Association between CDH1 and MSX1 gene polymorphisms and the risk of nonsyndromic cleft lip and/or cleft palate in a southeast Iranian population. Cleft Palate Craniofac J. 2013;50(5):e98-e104. [PubMed ID: 23231047]. https://doi.org/10.1597/12-144.
  • 17.
    Bahrami R, Dastgheib SA, Niktabar SM, Amooee A, Lookzadeh MH, Mirjalili SR, et al. Association of BMP4 rs17563 Polymorphism with Nonsyndromic Cleft Lip with or without Cleft Palate Risk: Literature Review and Comprehensive Meta-Analysis. Fetal Pediatr Pathol. 2021;40(4):305-19. [PubMed ID: 31909686]. https://doi.org/10.1080/15513815.2019.1707916.
  • 18.
    Huang L, Liang X, Ou Y, Tang S, He Y. Association between 20q12 rs13041247 polymorphism and risk of nonsyndromic cleft lip with or without cleft palate: a meta-analysis. BMC Oral Health. 2020;20(1):39. [PubMed ID: 32019513]. [PubMed Central ID: PMC7001214]. https://doi.org/10.1186/s12903-020-1003-2.
  • 19.
    do Rego Borges A, Sa J, Hoshi R, Viena CS, Mariano LC, de Castro Veiga P, et al. Genetic risk factors for nonsyndromic cleft lip with or without cleft palate in a Brazilian population with high African ancestry. Am J Med Genet A. 2015;167A(10):2344-9. [PubMed ID: 26198054]. https://doi.org/10.1002/ajmg.a.37181.
  • 20.
    Chen R, Guo S, Wang X, Mu Y, Duan E, Xu Y. Association of EPHA3 Gene Polymorphisms with Nonsyndromic Cleft Lip With or Without Cleft Palate. Genet Test Mol Biomarkers. 2018;22(7):420-4. [PubMed ID: 29932736]. https://doi.org/10.1089/gtmb.2017.0252.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles