Int J Cancer Manag

Image Credit:Int J Cancer Manag

Evaluation of Cellular miR-122 Expression in Association with the Presence of Varicella-Zoster Virus among Central Nervous System Tumors

Author(s):
Aida AbbasiAida Abbasi1, 2,**, Javid  Sadri NahandJavid Sadri Nahand3, Mohsen  MoghoofeiMohsen Moghoofei4, Maryam  EsghaeiMaryam EsghaeiMaryam  Esghaei ORCID2,*, Davod JavanmardDavod Javanmard5, Mohammad Hadi Karbalaie NiyaMohammad Hadi Karbalaie NiyaMohammad Hadi Karbalaie Niya ORCID6, 2, Farzin  SadeghiFarzin SadeghiFarzin  Sadeghi ORCID7, Farah   Bokharaei-SalimFarah Bokharaei-SalimFarah   Bokharaei-Salim ORCID2, Mohammad  KarimzadehMohammad Karimzadeh8, Amirhossein  KhodayariAmirhossein Khodayari9, Hossein  KeyvaniHossein KeyvaniHossein  Keyvani ORCID2
1Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran
2Department of Virology, School of Medicine, Iran University of Medical Sciences, Tehran, Iran
3Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
4Infectious Diseases Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran
5Infectious Diseases Research Center, Birjand University of Medical Sciences, Birjand, Iran
6Gastrointestinal and Liver Diseases Research Center, Iran University of Medical Sciences, Tehran, Iran
7Department of Microbiology, School of Medicine, Babol University of Medical Sciences, Babol, Iran
8Core Research Facilities (CRF), Isfahan University of Medical Science, Isfahan, Iran
9Department of Civil Engineering, Islamic Azad University, Tabriz Branch, Tabriz, Iran
Corresponding Authors:

International Journal of Cancer Management:Vol. 15, issue 11; e108497
Published online:Dec 17, 2022
Article type:Research Article
Received:Aug 14, 2020
Accepted:Oct 01, 2022
How to Cite:Abbasi A, Sadri Nahand J, Moghoofei M, Esghaei M, Javanmard D, et al. Evaluation of Cellular miR-122 Expression in Association with the Presence of Varicella-Zoster Virus among Central Nervous System Tumors. Int J Cancer Manag. 2022;15(11):e108497. doi: https://doi.org/10.5812/ijcm-108497

Abstract

Background:

Brain tumors are all primary central nervous system (CNS) tumors with unclear etiologies and viral infections, especially human herpesviruses, which have emerged as a hot topic for comprehensive research.

Objectives:

The present study aimed at assessing the molecular epidemiology of varicella-zoster virus (VZV) and its association with microRNA 122 (miR-122) expression in CNS tumor samples.

Methods:

Fresh frozen tissue samples were collected from 60 CNS tumor patients and 45 healthy controls. A nested PCR assay was performed to detect the VZV-DNA. Subsequently, the expression level of miR-122 was evaluated in the CNS tumor tissue samples of patients and the brain tissue samples were obtained from healthy controls, using a real-time PCR assay.

Results:

Of 60 patients with CNS tumors, 29 were men and 31 were women. VZV-DNA was detected in 13.3% of the CNS tumor tissue specimens. There was no statistically significant association between the presence of VZV-DNA and different types of CNS tumors (P > 0.05). Furthermore, the expression level of miR-122 was significantly downregulated in the CNS tumor tissue samples obtained from the patients compared with those of the healthy controls (P < 0.05). Additionally, the expression level of miR-122 was significantly lower in the VZV-positive tumor samples as compared with those of the VZV-negative tumor samples and the healthy controls.

Conclusions:

Although VZV plays no direct role in the development of CNS tumors, the virus may affect the biology of CNS tumors by decreasing the expression levels of miR-122, which consequently leads to an increased risk of malignancy. However, the experimental data are not conclusive enough; so, further investigations are needed.

1. Background

Malignancies of the central nervous system (CNS) are the second most common type of tumor and the most frequent type of solid tumor in childhood (1-3), which are associated with a high mortality rate (4). They are frequent in adults with a mean age of 47 years old (3, 5) and are usually caused by abnormal, uncontrolled growth of the spinal cord and brain cells, which are known as astrocytoma, meningioma, glioblastoma, ependymoma, medulloblastoma, oligodendroglioma, choroid plexus papilloma, and pineocytoma (6, 7). Although several genetic and environmental risk factors (e.g. radiation exposure, viral infections, and neuro-carcinogens) probably play important roles in the development of CNS tumors, the exact etiologies of these tumors are not well understood (8-11).
The role of viral infection in tumorigenesis of the CNS has long been under debate. However, it has been reported that some avian retroviruses can induce gliomas under in vivo conditions (12). Among human oncoviruses, herpesviruses (e.g. HCMV, HHV-6, and EBV) and polyomaviruses (e.g. SV40, JCV) have been investigated more extensively in human CNS tumors (11), which are suspected to be associated with CNS disorders. varicella-zoster virus (VZV), or human herpesvirus 3 (HHV3), is a member of the herpesvirus family that is neurotropic. Primary infection with VZV first leads to varicella (chickenpox) and, then, establishes a latent infection in the dorsal root of the ganglion. Subsequently, reactivation of the primary infection can cause zoster (shingles) as well as some complications related to the CNS (13). Only a few studies have been carried out to illustrate the role of VZV on brain tumors; therefore, there are still many gaps that need to be addressed. Furthermore, contradictory reports have been published on the frequency of VZV in brain tumors (14). Although few studies have focused on the role of VZV in CNS tumors, this hypothesis requires further investigation.
It is known that miRNAs (miR) play several critical roles in the regulation of various cellular processes, such as cell growth, differentiation, cell signaling, and apoptosis (15-17). In addition, they may act as oncomiR (a tumor inducer) or tumor suppressors in cancer cells. MiR-122, as a tumor suppressor, targets the IGF1R in breast cancer cells (18); however, it could be considered an oncomiR in renal cell carcinoma (RCC) (19). The expression levels and function of miR-122 in CNS tumors have not been well defined up to now. Several studies have shown that there are distinct expression patterns of the host miRNAs in both viral-infected and uninfected cells, wherein they can be used as novel diagnostic biomarkers (20, 21). Besides, these viruses may contribute to tumor progression by altering miRNA expression (22, 23). In this regard, a few studies have been conducted on VZV genome detection in brain tumors; so, the miRNA pattern in the VZV-infected CNS-tumor remains unevaluated.

2. Objectives

The current study aimed at evaluating the VZV infection rate in CNS tumors, as well as the expression levels of miR-122 in brain tumors.

3. Methods

3.1. Patients and Settings

The present case-control study was conducted from January 2017 to October 2019. A total of 60 CNS tumor samples were obtained from the included patients, who underwent surgery at the neurosurgery departments of hospitals affiliated with Iran University of Medical Sciences. The aim and procedures were verbally explained to all the participants, and the patients’ guardians signed the consent form freely concerning the Helsinki Declaration. In total, 45 normal CNS tissue samples as controls were obtained from a peripheral region of the surgically removed tumors from individuals matched with the case group in terms of sex and age. Patients previously treated (by chemotherapy) were excluded from the study. All the patients received dexamethasone at a dose of 8 mg/m2, which was prescribed to reduce pressure and swelling in normal tissues around the tumor before the surgery. Additionally, none of the patients were HIV-positive, and almost all of them had a WBC cell count of more than 4500 cells per µL (Table 1). Thereafter, the tumor-node-metastasis (TNM) system was used for staging CNS tumors as decided by the Department of Pathology at the same hospital. For collection, tissues are immediately preserved in RNA Later solution (Ambion, Inc., Austin, TX) and, then, stored at -80°C until the extraction of total RNA and DNA.
Table 1.Demographic and Clinical Characteristics of the Participants
HistopathologyTotal (N = 60), No. (%)Location of TumorGenderMean Age (Range)Mean WBCa Counts Per Microliter (Range)
MaleFemale
Astrocytoma27 (45)Brain161140.7 (25 - 56)7951.4 (4500 - 10950)
Glioblastoma multiform19 (31.7)Brain71261.1 (83 - 49)8967.5 (6190 - 14150)
Oligoastrocytoma4 (6.6)Brain1252.9 (20 - 74)7138.5 (3400 - 9100)
Schwannoma 3 (5)Meninge1250.3 (18 - 67)9396.6 (6800 - 11900)
Meningioma 2 (3.3)Brain1 - 54.7 (46 - 65)8748.3 (7650 - 10450)
Pituitary adenoma 2 (3.3)Brain1139.0 (35 - 44)10436.6 (6210 - 15490)
Epidermoid tumor 1 (1.7)Brain - 149.7 (37 - 60)9260.0 (5400 - 16700)
Hemangioblastoma1 (1.7)Brain - 151.0 (48 - 54)7685.0 (6620 - 8750)
Pineoblastoma1 (1.7)Brain1 - 13.5 (11 - 16)7700.0 (6100 - 9300)

3.2. Nucleic Acid Extraction

The extraction of DNA was performed, using the QIAamp DNA Mini Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s protocol. To evaluate miRNA, total cellular RNA was extracted from the specimens, using the Trizol approach (miRNeasy Mini Kit, QIAGEN GmbH, Hilden, Germany) following the kit’s instructions. Afterward, the achieved RNAs were converted to cDNA, using the miScript II RT Kit (Qiagen). The concentrations of the extracted nucleic acids were assessed, using a spectrophotometer, NanoDrop ND-1000® (Thermo Fisher Scientific Inc., Waltham, MA, USA) after the extraction procedure.

3.3. Polymerase Chain Reaction

For the identification of VZV-DNA, we designed primers for ORF 63 to detect all the known genotypes of VZV (Table 2). The PCR (polymerase chain reaction) assay was performed in two consecutive PCR reactions, each one containing 2.5 µL of the extracted DNA, 12.5 µL (1X) of 2x Amplicon MasterMix, and 1 µL (0.5 µM) of each primer in a 25 µL final volume. The PCR program was performed, using T100™ Thermal Cycler (Life Science Research Bio-Rad) under the following conditions: an initial denaturation step for 5 min at 95°C followed by 45 cycles (in the first PCR round) and 35 cycles (in the second PCR round) for 35 s at 95°C, for the 20 s at 58°C, and 35 s at 72°C, respectively.
Table 2.The Primer Sequences Used in the Study with Given Cycling Conditions
PrimerSequence (3' → 5')LocationTM Genomic (°C)Target Product Size
First roundOrf63, 645 bp
H3F1GGCGGGCTTTTCACAGAA11033460
H3R1CTGCGTCTGGGTGGGTTG11097861
Second roundOrf63, 437 bp
H3F2CCATTGCCATTTTACCCAAG11048258
H3R2TCTGGTGCGACCCATTAGAT11091859

3.4. Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)

Quantification of miR-122 was conducted, using the miScript SYBR Green PCR Kit (Qiagen) according to the manufacturer’s protocol. All reactions were performed in triplicate. The miRNA named SnRNA RNU6B was used for normalization in relative quantification analysis. The primer sequences used for the amplification of U6 snRNA were forward primer: 5´- CCGATAAAATTGGAACGATACAGAG- 3´ and reverse primer: 5´-TCGATTTGTGCGTGTCATCC- 3´.
Moreover, the expression levels of miR-122 were normalized to the level of U6 snRNA, as an internal control, using the efficiency-corrected calculation models of the Pfaff method (24).
The reaction mixture contained 2 µL of cDNA (0.2 - 0.5 µM), 2 µL (0.5 µM concentration) of each primer, 7.5 µL of 2 × QuantiTect SYBR Green PCR Master Mix, and nuclease-free water up to 15 µL. The optimal real-time PCR was investigated under the following conditions: In the first step, an initial denaturation was performed for 10 min at 95°C, which was followed by a further 40 cycles for 15s at 95°C, for the 30 s at 60°C, and 1 min at 72°C. The results were confirmed, using melt curve analysis that was set in the annealing/extension step. Heating was set between 50°C and 95°C at a 2°C per second rate, and continuous fluorescence measurement was, then, applied.

3.5. Statistical Analysis

SPSS version 16 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Also, multidimensional qPCR analysis was performed, using GenEx and Graphpad software. The relationship among categorical variables was calculated by running the v2 test (the Mont-Carlo method was used for the exact P-value calculation). The Kolmogorov-Smirnov test was used to assess the normal distribution of variables. Also, the independent-samples t-test/Mann-Whitney U test and the Kruskal-Wallis test were used to analyze continuous variables. In addition, Dunn's multiple comparison test and Tukey's multiple comparison test were used to estimate the correlation among quantitative variables. A P-value of < 0.05 was considered statistically significant.

4. Results

4.1. Characteristics of the Participants

In the present age-and sex-matched case-control study, we examined 45 healthy controls and 60 CNS tumor cases obtained from 29 males (mean age ± SD 48.3 ± 14.5 years old) and 31 females (mean age ± SD 47.5 ± 18.0 years old). The patients’ total mean age was 46.5 ± 13.1 years old, ranging from 11 to 83 years old, and the mean WBC count of the subjects was 8320.8 ± 2701.5 cells per µL (range, 3400 - 16700 WBC per µL). According to the histologic criteria, the primary CNS tumor samples were enrolled and, then, classified as follows: 27 (45 %) were Astrocytoma, 19 (31.7 %) glioblastoma multiform, 4 (6.7 %) Oligoastrocytoma, 3 (5 %) Schwannoma, 2 (3.33 %) Meningioma, and 2 (3.33 %) Pituitary adenoma. As shown in Table 1, in the current study, less common tumors were epidermoid tumor (no = 1) (1.7 %), hemangioblastoma (no = 1) (1.7 %), and pineoblastoma (no = 1) (1.7 %).

4.2. Determination of VZV DNA

In the present study, CNS specimens were tested for the presence of VZV ORF-63. The PCR results showed that VZV DNA existed in 13.3% of the CNS tumor specimens with a mean age of 48.8 ± 18.6 years old, ranging from 20 to 83 years. The VZV‐infected samples included Astrocytoma (5/8) and Glioblastoma multiform (3/8). There was no statistically significant association between gender and VZV positivity, as investigated by the Fisher exact test (P > 0.05).
The mean age value of the VZV-positive and VZV-negative cases was 48.8 ± 18.6 years old (ranging from 20 to 83 years) and 45.0 ± 17.3 years old (ranging from 11 to 74 years), respectively (P = 0.56). No statistically significant association was found between the presence of VZV and various types of CNS malignancies after running the v2 test, using the Monte Carlo method (P = 0.452) (Table 3).
Table 3.Comparison of VZV Detection Rate Between Different CNS Tumor Types a
VZV orf63 SequenceP-Value
PositiveNegativeTotal
Number7 (11.7)53 (88.3)60
Age, y48.8 ± 18.6 (20 - 83)45.0 ± 17.3 (11 - 47)46.5 ± 13.1 (11 - 83)0.56
WBC counts per microliter9047.3 ± 3317.2 (4500 - 16700)8182.7 ± 2432.5 (3400 - 15490)8320.8 ± 2701.5 (3400 - 16700)0.155
Tumor location0.2
Meninge 2 (28.5)5 (71.5)7
Brain 5 (9.4)48 (90.6)53
Gender1.0
Male5 (17.2)24 (82.8)29
Female3 (9.6)28 (90.4)31
Tumor pathology 0.452
Astrocytoma2 (16.7)10 (83.3)12 (20)
Glioblastoma multiform1 (10)9 (90)10 (16.6)
Oligoastrocytoma1 (12.5)7 (87.5)8 (13.3)
Schwannoma 1 (12.5)7 (87.5)8 (13.3)
Meningioma 2 (28.6)5 (71.4)7 (11.6)
Pituitary adenoma 1 (14.2)6 (85.8)7 (11.6)
Epidermoid tumor 03 (100)3 (5)
Hemangioblastoma03 (100)3 (5)
Pineoblastoma02 (100)2 (3.3)

a Values are expressed as No. (%) or mean + SD (range).

4.3. Determination of miR-122 Expression

The expression level of miR-122 decreased significantly in the astrocytoma and glioblastoma multiforme samples compared with the controls (P < 0.0001) (see Table 4 for more information). The highest and the lowest expression levels of miR-122 were observed in pituitary adenoma and hemangioblastoma samples, respectively. Additionally, the expression level of miR-122 was lower in the samples infected with VZV as compared with those of the VZV-negative samples (Figure 1).
A, The expression level of miR-122 was significantly downregulated in VZV-positive astrocytoma (AS) compared to VZV-negative AS (-3.07 ± 0.22 vs. -0.59 ± 0.2, P &lt; 0.0001) and healthy group (-3.07 ± 0.36 vs. 0.31 ± 0.19, P &lt; 0.0001). B, The expression of miR-122 was significantly downregulated in VZV-positive glioblastoma multiforme (GBM) compared to VZV-negative GBM (-2.8 ± 0.4 vs. -0.64 ± 0.2, P = 0.0076) and healthy group (-2.8 ± 0.4 vs. 0.36 ± 0.19, P &lt; 0.0001) (P ≤ 0.05. ** P ≤ 0.01. **** P ≤ 0.0001).
Figure 1.

A, The expression level of miR-122 was significantly downregulated in VZV-positive astrocytoma (AS) compared to VZV-negative AS (-3.07 ± 0.22 vs. -0.59 ± 0.2, P < 0.0001) and healthy group (-3.07 ± 0.36 vs. 0.31 ± 0.19, P < 0.0001). B, The expression of miR-122 was significantly downregulated in VZV-positive glioblastoma multiforme (GBM) compared to VZV-negative GBM (-2.8 ± 0.4 vs. -0.64 ± 0.2, P = 0.0076) and healthy group (-2.8 ± 0.4 vs. 0.36 ± 0.19, P < 0.0001) (P ≤ 0.05. ** P ≤ 0.01. **** P ≤ 0.0001).

Table 4.Comparison of Fold Change Based on qRT-PCR for miR-122 Between CNS Tumor Patients and Healthy Controls (Control Group as a Reference Group) a
Tumor TypeFold-change DifferenceP-Value
Astrocytoma (n = 27)-1.12 ± 0.24< 0.0001
Glioblastoma multiform (n = 19)-1.07 ± 0.25< 0.0001
Oligoastrocytoma (n = 4)0.03 ± 0.47Ns
Schwannoma (n = 3)-0.68 ± 0.45Ns
Meningioma (n = 2)-0.78 ± 0.65Ns
Pituitary adenoma (n = 2) -1.5 ± 0.640.021
Epidermoid tumor (n = 1)-0.76 ± 0.9Ns
Hemangioblastoma (n = 1)1.33 ± 0.84Ns
Pineoblastoma (n = 1)-1.062 ± 0.410.013

a Ns, not significant.

5. Discussion

In 2019, 23 820 new cases of CNS tumors and 17 760 deaths caused by brain tumors were reported in the US (7). Emerging evidence has demonstrated a frequent presence of viral infection, especially human herpesviruses, in CNS tumors in both children and adults (12, 25-30). VZV is a neurotropic virus that can cause latent infection in the dorsal root ganglia and cranial nerve ganglia (31). Moreover, the reactivation of VZV can lead to some neurological disorders, such as myelitis and encephalitis (32, 33). Therefore, the investigation of the relationship between this virus and gliomagenesis or other CNS tumors is of particular importance.
Among the 60 tumor samples examined in the present study, the sequences of VZV open reading frame (ORF) 63 were detected in 8 (out of 60) tissue samples (13.33%), including astrocytoma (n = 5/27) and glioblastoma multiform (n = 3/19), whereas no VZV-DNA was detected in the control samples. However, the statistical analysis demonstrated no significant correlation between the frequency of VZV-DNA and different tumor types. Previous studies demonstrated a higher VZV-IgG level among the normal population compared to glioma patients (34-36). These findings led to the proposal of the "neuroprotective effect" hypothesis of VZV immunoglobulin in GBM (11). However, this protective effect is mostly related to the specific immunoglobulins produced against the virus rather than the virus itself. Thus, this is not in contrast to the results of our study (11). In a study almost similar to the present study, Neves et al. (29) investigated the prevalence of herpesviruses in the cerebellum (tumor‐containing tissue) and found the virus in two tumor samples, while it was absent in the control group.
For the first time, Gelb and Dohner reported that VZV is capable of transforming mammalian cells in vitro (37). Furthermore, experimental evidence has shown that some proteins expressed by the VZV genes, such as orf-12, orf-66, and orf-63, can block apoptosis in VZV-infected cells (38-40). In another study, it was observed that ORF63 is expressed during both latent and productive infections, which promotes the survival of neurons by suppressing apoptosis, and also plays an important role in the pathogenesis of the VZV (40). These studies suggest that VZV may play a potential role in tumorigenesis.
In general, according to the studies cited, there are two hypotheses related to the role of VZV in carcinogenesis. Correspondingly, some studies reported a reverse relationship between VZV infection and brain tumors, and some others suggested that VZV can contribute to tumorigenesis through the inhibition of apoptosis.
Given the critical role of miRNAs in cellular processes, it is not surprising that viruses alter cellular conditions in their favor by dysregulation of miRNA expression (41-43). It has been observed that the expression pattern of miRNAs has been significantly downregulated in different human cancer cells, which act either as tumor suppressors or as oncomiR. Besides, several miRNAs are deregulated in various human CNS tumor cells (44, 45). The results of the current study showed a significant downregulation level of miR-122 in glioblastoma multiform, astrocytoma, pituitary adenoma, and hemangioblastoma (Table 4). Moreover, the expression level of miR-122 was found to be statistically significant among different tumor samples (P < 0.02).
As mentioned earlier, the expression level of tumor suppressors, miRNAs, has mainly increased in cancer cells, while oncomiRs are overexpressed in cancer cells. Notably, it has been observed that the expression pattern of miR-122 is different in various cancers (46, 47). Furthermore, it is reported that miR-122 acts as an oncomiR in renal cell carcinoma (19), and also as a tumor suppressor in gastric cancer (36), hepatocellular carcinoma (48-50), and breast cancer (18). In the present study, we also found that miR-122 expression was downregulated in CNS tumor tissue compared to that in the control samples. As a result, it may play a role as a tumor suppressor in human CNS cancer cells. The average fold change of relative expression showed that the expression level of this miRNA was significantly lower in the VZV-positive tumor samples compared to those of the VZV-negative tumor and control samples. Additionally, a statistically significant difference was found between these groups (P < 0.001). In contrast, Qi et al. (51) evaluated the dysregulation of cellular miRNA (including miR-122, 196, 269, 363, and 132) expression, using a TaqMan low-density array (TLDA) assay in the sera of non-vaccinated children with varicella-zoster infection (51). The different expression patterns of miR-122 used in this study and ours may be due to the different types of samples (serum vs tissue), different methods (qPCR vs TLDA), and different disease types (CNS tumor vs varicella-zoster infection) studied.
In conclusion, the present study showed that the prevalence of VZV infection in CNS tumors was 13.33%. However, more studies should be carried out to explain the roles of viral infections in these types of tumors. The expression level of miR-122 has been significantly downregulated in both tumor specimens and VZV-infected patients. Given that VZV infection may be involved in the dysregulation of miR-122 expression and since miR-122 is probably a tumor suppressor miRNA in CNS tumors, VZV may contribute to tumor progression through the downregulation of miR-122. However, the experimental data are not enough to be conclusive in this regard; therefore, further investigations are needed.

Acknowledgments

Footnotes

References

  • 1.
    Pekmezovic T, Jarebinski M, Pavlovic M. Epidemiology of central nervous system tumors. Archive of Oncology. 2002;10(3):177-8. https://doi.org/10.2298/aoo0203177p.
  • 2.
    Asirvatham JR, Deepti AN, Chyne R, Prasad MS, Chacko AG, Rajshekhar V, et al. Pediatric tumors of the central nervous system: a retrospective study of 1,043 cases from a tertiary care center in South India. Childs Nerv Syst. 2011;27(8):1257-63. [PubMed ID: 21344241]. https://doi.org/10.1007/s00381-011-1407-z.
  • 3.
    Ward E, DeSantis C, Robbins A, Kohler B, Jemal A. Childhood and adolescent cancer statistics, 2014. CA Cancer J Clin. 2014;64(2):83-103. [PubMed ID: 24488779]. https://doi.org/10.3322/caac.21219.
  • 4.
    Gittleman HR, Ostrom QT, Rouse CD, Dowling JA, de Blank PM, Kruchko CA, et al. Trends in central nervous system tumor incidence relative to other common cancers in adults, adolescents, and children in the United States, 2000 to 2010. Cancer. 2015;121(1):102-12. [PubMed ID: 25155924]. [PubMed Central ID: PMC4298242]. https://doi.org/10.1002/cncr.29015.
  • 5.
    Liigant A, Asser T, Kulla A, Kaasik AE. Epidemiology of primary central nervous system tumors in Estonia. Neuroepidemiology. 2000;19(6):300-11. [PubMed ID: 11060504]. https://doi.org/10.1159/000026269.
  • 6.
    National Institutes of Health. Adult Central Nervous System Tumors Treatment–Health Professional Version (PDQ®) Metastatic Brain Tumors. National Institutes of Health; 2017.
  • 7.
    PDQ Adult Treatment Editorial Board. Adult central nervous system tumors treatment (PDQ®). PDQ Cancer Information Summaries [Internet]. National Cancer Institute (US); 2022.
  • 8.
    Kleihues P, Aguzzi A, Ohgaki H. Genetic and environmental factors in the etiology of human brain tumors. Toxicol Lett. 1995;82-83:601-5. [PubMed ID: 8597115]. https://doi.org/10.1016/0378-4274(95)03503-6.
  • 9.
    Preston-Martin S. Epidemiology of primary CNS neoplasms. Neurol Clin. 1996;14(2):273-90. [PubMed ID: 8827171]. https://doi.org/10.1016/s0733-8619(05)70256-5.
  • 10.
    Wrensch M, Minn Y, Chew T, Bondy M, Berger MS. Epidemiology of primary brain tumors: current concepts and review of the literature. Neuro Oncol. 2002;4(4):278-99. [PubMed ID: 12356358]. [PubMed Central ID: PMC1920665]. https://doi.org/10.1093/neuonc/4.4.278.
  • 11.
    Saddawi-Konefka R, Crawford JR. Chronic viral infection and primary central nervous system malignancy. J Neuroimmune Pharmacol. 2010;5(3):387-403. [PubMed ID: 20387126]. [PubMed Central ID: PMC2914282]. https://doi.org/10.1007/s11481-010-9204-0.
  • 12.
    Kofman A, Marcinkiewicz L, Dupart E, Lyshchev A, Martynov B, Ryndin A, et al. The roles of viruses in brain tumor initiation and oncomodulation. J Neurooncol. 2011;105(3):451-66. [PubMed ID: 21720806]. [PubMed Central ID: PMC3278219]. https://doi.org/10.1007/s11060-011-0658-6.
  • 13.
    Gilden D. Varicella zoster virus and central nervous system syndromes. Herpes. 2004;11 Suppl 2:89A-94A. [PubMed ID: 15319095].
  • 14.
    Pundole X, Amirian ES, Scheurer ME. Role of varicella zoster virus in glioma risk: current knowledge and future directions. OA Epidemiol. 2014;2(6).
  • 15.
    Ricarte-Filho JC, Fuziwara CS, Yamashita AS, Rezende E, da-Silva MJ, Kimura ET. Effects of let-7 microRNA on Cell Growth and Differentiation of Papillary Thyroid Cancer. Transl Oncol. 2009;2(4):236-41. [PubMed ID: 19956384]. [PubMed Central ID: PMC2781070]. https://doi.org/10.1593/tlo.09151.
  • 16.
    Sun W, Julie Li YS, Huang HD, Shyy JY, Chien S. microRNA: a master regulator of cellular processes for bioengineering systems. Annu Rev Biomed Eng. 2010;12:1-27. [PubMed ID: 20415587]. https://doi.org/10.1146/annurev-bioeng-070909-105314.
  • 17.
    Su Z, Yang Z, Xu Y, Chen Y, Yu Q. MicroRNAs in apoptosis, autophagy and necroptosis. Oncotarget. 2015;6(11):8474-90. [PubMed ID: 25893379]. [PubMed Central ID: PMC4496162]. https://doi.org/10.18632/oncotarget.3523.
  • 18.
    Wang B, Wang H, Yang Z. MiR-122 inhibits cell proliferation and tumorigenesis of breast cancer by targeting IGF1R. PLoS One. 2012;7(10). e47053. [PubMed ID: 23056576]. [PubMed Central ID: PMC3466252]. https://doi.org/10.1371/journal.pone.0047053.
  • 19.
    Jingushi K, Kashiwagi Y, Ueda Y, Kitae K, Hase H, Nakata W, et al. High miR-122 expression promotes malignant phenotypes in ccRCC by targeting occludin. Int J Oncol. 2017;51(1):289-97. [PubMed ID: 28534944]. https://doi.org/10.3892/ijo.2017.4016.
  • 20.
    Sullivan CS, Ganem D. MicroRNAs and viral infection. Mol Cell. 2005;20(1):3-7. [PubMed ID: 16209940]. https://doi.org/10.1016/j.molcel.2005.09.012.
  • 21.
    Nahand JS, Taghizadeh-Boroujeni S, Karimzadeh M, Borran S, Pourhanifeh MH, Moghoofei M, et al. microRNAs: New prognostic, diagnostic, and therapeutic biomarkers in cervical cancer. J Cell Physiol. 2019;234(10):17064-99. [PubMed ID: 30891784]. https://doi.org/10.1002/jcp.28457.
  • 22.
    Sadri Nahand J, Bokharaei-Salim F, Salmaninejad A, Nesaei A, Mohajeri F, Moshtzan A, et al. microRNAs: Key players in virus-associated hepatocellular carcinoma. J Cell Physiol. 2019;234(8):12188-225. [PubMed ID: 30536673]. https://doi.org/10.1002/jcp.27956.
  • 23.
    Vojtechova Z, Tachezy R. The Role of miRNAs in Virus-Mediated Oncogenesis. Int J Mol Sci. 2018;19(4). [PubMed ID: 29673190]. [PubMed Central ID: PMC5979478]. https://doi.org/10.3390/ijms19041217.
  • 24.
    Pfaffl MW. Relative quantification. Real-time PCR. 63. Taylor & Francis; 2006. p. 63-82.
  • 25.
    Strojnik T, Duh D, Lah TT. Prevalence of Neurotropic Viruses in Malignant Glioma and Their Onco-Modulatory Potential. In Vivo. 2017;31(2):221-9. [PubMed ID: 28358704]. [PubMed Central ID: PMC5411749]. https://doi.org/10.21873/invivo.11049.
  • 26.
    Fonseca RF, Rosas SL, Oliveira JA, Teixeira A, Alves G, Carvalho Mda G. Frequency of Epstein-Barr virus DNA sequences in human gliomas. Sao Paulo Med J. 2015;133(1):51-4. [PubMed ID: 25626853]. https://doi.org/10.1590/1516-3180.2013.1912814.
  • 27.
    Lin CT, Leibovitch EC, Almira-Suarez MI, Jacobson S. Human herpesvirus multiplex ddPCR detection in brain tissue from low- and high-grade astrocytoma cases and controls. Infect Agent Cancer. 2016;11:32. [PubMed ID: 27462365]. [PubMed Central ID: PMC4960850]. https://doi.org/10.1186/s13027-016-0081-x.
  • 28.
    Zavala-Vega S, Castro-Escarpulli G, Hernandez-Santos H, Salinas-Lara C, Palma I, Mejia-Arangure JM, et al. An overview of the infection of CMV, HSV 1/2 and EBV in Mexican patients with glioblastoma multiforme. Pathol Res Pract. 2017;213(3):271-6. [PubMed ID: 28215646]. https://doi.org/10.1016/j.prp.2016.12.006.
  • 29.
    Neves AM, Thompson G, Carvalheira J, Trindade JC, Rueff J, Caetano JM, et al. Detection and quantitative analysis of human herpesvirus in pilocytic astrocytoma. Brain Res. 2008;1221:108-14. [PubMed ID: 18565499]. https://doi.org/10.1016/j.brainres.2008.05.009.
  • 30.
    Akhtar S, Vranic S, Cyprian FS, Al Moustafa AE. Epstein-Barr Virus in Gliomas: Cause, Association, or Artifact? Front Oncol. 2018;8:123. [PubMed ID: 29732319]. [PubMed Central ID: PMC5919939]. https://doi.org/10.3389/fonc.2018.00123.
  • 31.
    Arvin A. Aging, immunity, and the varicella-zoster virus. N Engl J Med. 2005;352(22):2266-7. [PubMed ID: 15930416]. https://doi.org/10.1056/NEJMp058091.
  • 32.
    Steiner I, Kennedy PG, Pachner AR. The neurotropic herpes viruses: herpes simplex and varicella-zoster. Lancet Neurol. 2007;6(11):1015-28. [PubMed ID: 17945155]. https://doi.org/10.1016/S1474-4422(07)70267-3.
  • 33.
    Nagel MA, Gilden D. Complications of varicella zoster virus reactivation. Curr Treat Options Neurol. 2013;15(4):439-53. [PubMed ID: 23794213]. [PubMed Central ID: PMC3752706]. https://doi.org/10.1007/s11940-013-0246-5.
  • 34.
    Poltermann S, Schlehofer B, Steindorf K, Schnitzler P, Geletneky K, Schlehofer JR. Lack of association of herpesviruses with brain tumors. J Neurovirol. 2006;12(2):90-9. [PubMed ID: 16798670]. https://doi.org/10.1080/13550280600654573.
  • 35.
    Wrensch M, Weinberg A, Wiencke J, Masters H, Miike R, Barger G, et al. Does prior infection with varicella-zoster virus influence risk of adult glioma? Am J Epidemiol. 1997;145(7):594-7. [PubMed ID: 9098175]. https://doi.org/10.1093/oxfordjournals.aje.a009155.
  • 36.
    Wrensch M, Weinberg A, Wiencke J, Miike R, Barger G, Kelsey K. Prevalence of antibodies to four herpesviruses among adults with glioma and controls. Am J Epidemiol. 2001;154(2):161-5. [PubMed ID: 11447050]. https://doi.org/10.1093/aje/154.2.161.
  • 37.
    Gelb L, Dohner D. Varicella-zoster virus-induced transformation of mammalian cells in vitro. J Invest Dermatol. 1984;83(1 Suppl):77s-81s. [PubMed ID: 6330228]. https://doi.org/10.1111/1523-1747.ep12281388.
  • 38.
    Liu X, Cohen JI. Varicella-zoster virus ORF12 protein activates the phosphatidylinositol 3-kinase/Akt pathway to regulate cell cycle progression. J Virol. 2013;87(3):1842-8. [PubMed ID: 23192871]. [PubMed Central ID: PMC3554186]. https://doi.org/10.1128/JVI.02395-12.
  • 39.
    Schaap A, Fortin JF, Sommer M, Zerboni L, Stamatis S, Ku CC, et al. T-cell tropism and the role of ORF66 protein in pathogenesis of varicella-zoster virus infection. J Virol. 2005;79(20):12921-33. [PubMed ID: 16188994]. [PubMed Central ID: PMC1235817]. https://doi.org/10.1128/JVI.79.20.12921-12933.2005.
  • 40.
    Hood C, Cunningham AL, Slobedman B, Arvin AM, Sommer MH, Kinchington PR, et al. Varicella-zoster virus ORF63 inhibits apoptosis of primary human neurons. J Virol. 2006;80(2):1025-31. [PubMed ID: 16379003]. [PubMed Central ID: PMC1346839]. https://doi.org/10.1128/JVI.80.2.1025-1031.2006.
  • 41.
    Nahand JS, Karimzadeh MR, Nezamnia M, Fatemipour M, Khatami A, Jamshidi S, et al. The role of miR-146a in viral infection. IUBMB Life. 2020;72(3):343-60. [PubMed ID: 31889417]. https://doi.org/10.1002/iub.2222.
  • 42.
    Sadri Nahand J, Bokharaei-Salim F, Karimzadeh M, Moghoofei M, Karampoor S, Mirzaei HR, et al. MicroRNAs and exosomes: key players in HIV pathogenesis. HIV Med. 2020;21(4):246-78. [PubMed ID: 31756034]. [PubMed Central ID: PMC7069804]. https://doi.org/10.1111/hiv.12822.
  • 43.
    Sadri Nahand J, Moghoofei M, Salmaninejad A, Bahmanpour Z, Karimzadeh M, Nasiri M, et al. Pathogenic role of exosomes and microRNAs in HPV-mediated inflammation and cervical cancer: A review. Int J Cancer. 2020;146(2):305-20. [PubMed ID: 31566705]. [PubMed Central ID: PMC6999596]. https://doi.org/10.1002/ijc.32688.
  • 44.
    Kopkova A, Sana J, Machackova T, Vecera M, Radova L, Trachtova K, et al. Cerebrospinal Fluid MicroRNA Signatures as Diagnostic Biomarkers in Brain Tumors. Cancers (Basel). 2019;11(10). [PubMed ID: 31614872]. [PubMed Central ID: PMC6826583]. https://doi.org/10.3390/cancers11101546.
  • 45.
    Yue X, Lan F, Hu M, Pan Q, Wang Q, Wang J. Downregulation of serum microRNA-205 as a potential diagnostic and prognostic biomarker for human glioma. J Neurosurg. 2016;124(1):122-8. [PubMed ID: 26230475]. https://doi.org/10.3171/2015.1.JNS141577.
  • 46.
    Qiao DD, Yang J, Lei XF, Mi GL, Li SL, Li K, et al. Expression of microRNA-122 and microRNA-22 in HBV-related liver cancer and the correlation with clinical features. Eur Rev Med Pharmacol Sci. 2017;21(4):742-7. [PubMed ID: 28272709].
  • 47.
    Rao M, Zhu Y, Zhou Y, Cong X, Feng L. MicroRNA-122 inhibits proliferation and invasion in gastric cancer by targeting CREB1. Am J Cancer Res. 2017;7(2):323-33. [PubMed ID: 28337380]. [PubMed Central ID: PMC5336505].
  • 48.
    Zeisel MB, Pfeffer S, Baumert TF. miR-122 acts as a tumor suppressor in hepatocarcinogenesis in vivo. J Hepatol. 2013;58(4):821-3. [PubMed ID: 23085250]. https://doi.org/10.1016/j.jhep.2012.10.010.
  • 49.
    Yang F, Zhang L, Wang F, Wang Y, Huo XS, Yin YX, et al. Modulation of the unfolded protein response is the core of microRNA-122-involved sensitivity to chemotherapy in hepatocellular carcinoma. Neoplasia. 2011;13(7):590-600. [PubMed ID: 21750653]. [PubMed Central ID: PMC3132845]. https://doi.org/10.1593/neo.11422.
  • 50.
    Nassirpour R, Mehta PP, Yin MJ. miR-122 regulates tumorigenesis in hepatocellular carcinoma by targeting AKT3. PLoS One. 2013;8(11). e79655. [PubMed ID: 24244539]. [PubMed Central ID: PMC3820664]. https://doi.org/10.1371/journal.pone.0079655.
  • 51.
    Qi Y, Zhu Z, Shi Z, Ge Y, Zhao K, Zhou M, et al. Dysregulated microRNA expression in serum of non-vaccinated children with varicella. Viruses. 2014;6(4):1823-36. [PubMed ID: 24759212]. [PubMed Central ID: PMC4014722]. https://doi.org/10.3390/v6041823.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles