Suppressive Effect of Crocin and Cisplatin on Pluripotency Genes Expression in Human Cervical Cancer Cells

Author(s):
Homa MollaeiHoma Mollaei1, 2, Mohammad Reza AbediniMohammad Reza Abedini1, Reyhane HoshyarReyhane HoshyarReyhane Hoshyar ORCID1,*
1Cellular and Molecular Research Center, Birjand University of Medical Sciences, Birjand, IR Iran
2Department of Animal Biology, University of Tabriz, Tabriz, IR Iran
*Corresponding Author: Corresponding author: Reyhane Hoshyar, Cellular and Molecular Research Center, Birjand University of Medical Sciences, Birjand, IR Iran. Tel: +98-5632381542, E-mail: Email: [email protected]

International Journal of Cancer Management:Vol. 10, issue 10; e11152
Published online:Oct 28, 2017
Article type:Brief Report
Received:Feb 24, 2017
Accepted:Oct 15, 2017
How to Cite:Mollaei H, Abedini MR, Hoshyar R. Suppressive Effect of Crocin and Cisplatin on Pluripotency Genes Expression in Human Cervical Cancer Cells. Int J Cancer Manag. 2017;10(10):e11152. doi: https://doi.org/10.5812/ijcm.11152

Abstract

Background:

Cervical cancer is the fourth most common cancer in women. Since pluripotency genes are one of the main contributors of cancer, designing novel combinational therapies that target them would be helpful.

Methods:

In this study we assayed the anticancer effects of crocin and cisplatin on cervical cancer cells through suppression of Sox2 and Nanog. OV2008 cells were treated with crocin and cisplatin, and the viability and apoptosis were assessed by the MTT and Flowcytometery respectively. The expression levels of mRNA of pluripotency genes were detected by Real-Time PCR analysis.

Results:

Our data showed that treatment of OV2008 cells with crocin and cisplatin decrease cell viability in a dose- and time-dependent manner. Also cell cycle analysis indicated that the percentage of apoptotic cells significantly increased after treatment. Moreover, this treatment led to down-regulation of Sox2 and Nanog genes.

Conclusions:

So it would be proposed that crocin in combination with cisplatin could induce cytotoxicity in cervical cancer cells through inhibition of pluripotency genes.

1. Background

Cervical cancer is the fourth leading cause of cancer-related mortality among women worldwide. Ineffectiveness of common therapeutic techniques attracts scientists' attention to combinational therapy (1). Current studies have been proved contributions of aberrant expression of stem cell marker genes, such as Sox2 and Nanog, to progression of several tumors such as esophagus (2), bladder (3), colorectal (4), lung (5), breast (6) and cervix (7, 8). So it is not unexpected that targeting these factors can be served as a powerful approach in cancer treatment. Cisplatin is an anti-neoplastic agent that interferes with DNA replication and kills the proliferating cells. However, because of drug resistance and unwanted side effects, combination therapies of cisplatin with other anti-tumor agents, especially herbs, have been highly suggested (9). Crocin is one of the main carotenoids of saffron (Crocus Sativus L.) that its anti-tumor effects have been reported on various cancer cells through interaction with multiple signaling pathways (10, 11).

2. Objectives

In the present study, for the first time, we aimed to evaluate the combinational effects of crocin and cisplatin on suppression of pluripotency genes, Sox2 and Nanog, in OV2008 cervical cancer cells.

3. Methods

Cervical cancer cell line (OV2008) was kindly provided by Doctor Benjamin K. Tsang’s laboratory (University of Ottawa, Canada). The cytotoxic effects of crocin (0 - 4 mg/mL) and 0.003 mg/mL cisplatin measured with MTT assay. Cisplatin was obtained from Sigma (Oakville, ON, Canada) pharmaceutical company and crocin was extracted and purified according to our previous paper (12). Then OV2008 cells were treated with an effective dose of both crocin (1.5 mg/mL) and cisplatin (0.003 mg/mL) for various hours. Annexin-V-FLUOS and PI staining kit (IQ-Product, Netherlands) were used for apoptosis detection. Total RNA was extracted by RNX Plus (Cinnagen, Iran) and cDNA was synthesized using Thermo-scientific Kit (USA). qRT-PCR was performed by designed primers in the ABI Step One™ Real-Time PCR System (Foster City, CA). The relative expression of genes was calculated by 2ΔΔCT method and SYBR Green kit (Parstoos, Iran).
SOX2:AGCTACAGCATGATGCAGGA(forward), GGTCATGGAGTTGTACTGCA(reverse)
NANOG: AATACCTCAGCCTCCAGCAGATG(forward), TGCGTCACACCATTGCTATTCTTC (revers)
Bactin: TGGCACCCAGCACAATGAA(forward),CTAAGTCATAGTCCGCCTAGAAGCA(reverse)
Results expressed as the means ± SEM of at least three independent experiments (n = 3). Data were analyzed using one-way ANOVA and with Tukey’s post hoc test to assess differences between experimental groups. Statistical significances inferred at P≤0.05, (PRISM 6.07; Graph- Pad Software Inc.).

4. Results

The viability of treated cells with various concentrations of crocin (0 - 4 mg/mL) and 0.003 mg/mL cisplatin significantly reduced in a time- and dose-dependent manner after 24, 48 and 72 hours. The IC50 values of crocin in this combinational treatment were 3, 1.5 and 1 mg/mL, at 24, 48 and 72 hours, respectively. Our previous study showed that IC50 values of crocin alone were higher than these doses (Under reviewed paper).
Staining of cells with Annexin V-FLOUS and PI showed that 1.5 mg/mL crocin and 0.003 mg/mL cisplatin increased early apoptosis in a time dependent manner (Figure 1). Also cell cycle analysis showed that after 24, 48, and 72 hours of treatment, the percentage of apoptotic cells in the SubG1 phase was determined as 9%, 10% and 33% respectively.
Effect of 1.5 mg/mL Crocin Alone (Up) and with 0.003 mg/mL Cisplatin (Down) on Apoptosis; Viable cells (Annexin V- /PI - ), early apoptotic cells (Annexin V+ /PI - ), secondary necrotic cells (Annexin V+ /PI + ), and primary necrotic cells (Annexin V-/PI + ) are located in the lower left, lower right, upper right, and upper left quadrants, respectively.
Figure 1.

Effect of 1.5 mg/mL Crocin Alone (Up) and with 0.003 mg/mL Cisplatin (Down) on Apoptosis; Viable cells (Annexin V- /PI - ), early apoptotic cells (Annexin V+ /PI - ), secondary necrotic cells (Annexin V+ /PI + ), and primary necrotic cells (Annexin V-/PI + ) are located in the lower left, lower right, upper right, and upper left quadrants, respectively.

Real-Time PCR data showed that this combinational treatment of cells led to reductions in the mRNA levels of Sox2 (Figure 2A; P < 0.01, P < 0.0001) and Nanog (Figure 2B; P < 0.0001) at 12, 24 and 36 hours. Nonetheless individual treatment of cells with 1.5 mg/mL crocin down-regulated expression levels of Sox2 (Figure 2A; P < 0.0001) at all time intervals and Nanog (Figure 2B; P < 0.0001) at just 36 hours.
Effect of 1.5 mg/mL Crocin in the Present and Absent of 0.003 mg/mL CDDP on mRNA Expression of A, Sox2 and Nanog; #Suppressive Effect of Crocin and Cisplatin on. Revision 0; Journal: Iranian Journal of Ca. Page 10 of 11 24 February 2017 12:29:57; B, in OV2008 cell line.) **P &lt; 0.01, ****P &lt; 0.0001); CDDP: Cisplatin.
Figure 2.

Effect of 1.5 mg/mL Crocin in the Present and Absent of 0.003 mg/mL CDDP on mRNA Expression of A, Sox2 and Nanog; #Suppressive Effect of Crocin and Cisplatin on. Revision 0; Journal: Iranian Journal of Ca. Page 10 of 11 24 February 2017 12:29:57; B, in OV2008 cell line.) **P < 0.01, ****P < 0.0001); CDDP: Cisplatin.

5. Discussion

Cervical cancer is one of the main female cancers in developing countries such as Iran (13). Despite the usefulness of current therapies for this cancer, chemoresistance of tumor cells and unwanted side effects of chemical drugs remain a big challenge for oncologist (1). Several studies have proved anti-cancer properties of crocin (14-16).
In this study we investigated combinational effects of crocin and cisplatin on suppression of pluripotency genes, in cervical cancer cells. A large amount of data has showed up-regulation of key stemness factors, like Sox2 and Nanog in several types of cancer cells and the importance of targeting these regulators in cancer therapy (2-8). Sox2 and Nanog are transcription factors that are essential for maintaining self-renewal or pluripotency of undifferentiated embryonic stem cells (17). Up-regulation of these factors and disregulation of downstream regulatory pathways affects several aspects of cancer development such as cell proliferation, self-renewal, motility, epithelial-mesenchymal transition, and drug-resistance (18). The effects of Cisplatin as a chemotherapy drug on pluripotency genes have been evaluated before (19, 20). So finding the novel agents in combination with this drug as pluripotency regulators could help us to improve efficiency of cancer therapy. In the present study we aimed to investigate the molecular mechanism of crocin via alternation of ploripotency genes. Our result showed that treatment of cervical cancer cells with crocin and cisplatin could reduce the expression level of Sox2 and Nanog and also increase the percentage of apoptotic cells and cytotoxicity of cisplatin in these cells. Also according to our previous study, we could claim that combinational treatment of crocin and cisplatin is more effective than each of them individually. In conclusion, it could be proposed that crocin might serve as an adjuvant therapy for cervical cancer besides cisplatin.

Acknowledgments

Footnotes

  • Authors’ Contribution:Reyhane Hoshyar designed the study, and revised the paper. Mohammad Reza Abedini designed the study, Homa Mollaei performed all tests and written the paper.

  • Conflict of Interests:None declared.

  • Financial Discloser:None declared.

References

  • 1.
    Obstetricians ACo Gynecologists. Diagnosis and treatment of cervical carcinomas. Washington (DC): American College of Obstetricians and Gynecologists (ACOG); 2002.
  • 2.
    He W, Li K, Wang F, Qin YR, Fan QX. Expression of OCT4 in human esophageal squamous cell carcinoma is significantly associated with poorer prognosis. World J Gastroenterol. 2012;18(7):712-9. [PubMed ID: 22363145]. https://doi.org/10.3748/wjg.v18.i7.712.
  • 3.
    Tahmasebi MM, Sadeghizadeh M, Najafi F, Mowla SJ. Dendrosomal curcumin induced apoptosis by suppression of pluripotency genes in 5637 bladder cancer cells. Modares J Med Sci Pathobiol. 2013;16(1):23-39.
  • 4.
    Gazouli M, Roubelakis MG, Theodoropoulos GE, Papailiou J, Vaiopoulou A, Pappa KI, et al. OCT4 spliced variant OCT4B1 is expressed in human colorectal cancer. Mol Carcinog. 2012;51(2):165-73. [PubMed ID: 21480394]. https://doi.org/10.1002/mc.20773.
  • 5.
    Karoubi G, Gugger M, Schmid R, Dutly A. OCT4 expression in human non-small cell lung cancer: implications for therapeutic intervention. Interact Cardiovasc Thorac Surg. 2009;8(4):393-7. [PubMed ID: 19126554]. https://doi.org/10.1510/icvts.2008.193995.
  • 6.
    Leis O, Eguiara A, Lopez-Arribillaga E, Alberdi MJ, Hernandez-Garcia S, Elorriaga K, et al. Sox2 expression in breast tumours and activation in breast cancer stem cells. Oncogene. 2012;31(11):1354-65. [PubMed ID: 21822303]. https://doi.org/10.1038/onc.2011.338.
  • 7.
    Vishnoi K, Tyagi A, Singh SM, Das BC, Bharti AC. Cervical Cancer Stem Cells and Their Association with Human Papillomavirus: Are They Ready as Anticancer Targets?Multi-Targeted Approach to Treatment of Cancer. . Springer; 2015. p. 377-99.
  • 8.
    Liu XF, Yang WT, Xu R, Liu JT, Zheng PS. Cervical cancer cells with positive Sox2 expression exhibit the properties of cancer stem cells. PLoS One. 2014;9(1). e87092. [PubMed ID: 24489842]. https://doi.org/10.1371/journal.pone.0087092.
  • 9.
    Zhu H, Luo H, Zhang W, Shen Z, Hu X, Zhu X. Molecular mechanisms of cisplatin resistance in cervical cancer. Drug Des Devel Ther. 2016;10:1885-95. [PubMed ID: 27354763]. https://doi.org/10.2147/DDDT.S106412.
  • 10.
    Mostafavinia SE, Khorashadizadeh M, Hoshyar R. Antiproliferative and Proapoptotic Effects of Crocin Combined with Hyperthermia on Human Breast Cancer Cells. DNA Cell Biol. 2016;35(7):340-7. [PubMed ID: 27003728]. https://doi.org/10.1089/dna.2015.3208.
  • 11.
    Hoshyar R, Bathaie SZ, Sadeghizadeh M. Crocin triggers the apoptosis through increasing the Bax/Bcl-2 ratio and caspase activation in human gastric adenocarcinoma, AGS, cells. DNA Cell Biol. 2013;32(2):50-7. [PubMed ID: 23347444]. https://doi.org/10.1089/dna.2012.1866.
  • 12.
    Bolhasani A, Bathaie SZ, Yavari I, Moosavi-Movahedi AA, Ghaffari M. Separation and purification of some components of Iranian saffron. Asian J Chem. 2005;17(2):725.
  • 13.
    Behtash N, Karimi Zarchi M, Deldar M. Preoperative prognostic factors and effects of adjuvant therapy on outcomes of early stage cervical cancer in Iran. Asian Pac J Cancer Prev. 2009;10(4):613-8. [PubMed ID: 19827880].
  • 14.
    Hoshyar R, Mostafavinia SE, Bathaie SZ. Anticancer effects of saffron stigma (Crocus Sativus): a review study. Razi J Med Sci. 2016;22(140):69-78.
  • 15.
    Abdullaev FI, Espinosa-Aguirre JJ. Biomedical properties of saffron and its potential use in cancer therapy and chemoprevention trials. Cancer Detect Prev. 2004;28(6):426-32. [PubMed ID: 15582266]. https://doi.org/10.1016/j.cdp.2004.09.002.
  • 16.
    Alavizadeh SH, Hosseinzadeh H. Bioactivity assessment and toxicity of crocin: a comprehensive review. Food Chem Toxicol. 2014;64:65-80. [PubMed ID: 24275090]. https://doi.org/10.1016/j.fct.2013.11.016.
  • 17.
    Jeter CR, Yang T, Wang J, Chao HP, Tang DG. Concise Review: NANOG in Cancer Stem Cells and Tumor Development: An Update and Outstanding Questions. Stem Cells. 2015;33(8):2381-90. [PubMed ID: 25821200]. https://doi.org/10.1002/stem.2007.
  • 18.
    Wang ML, Chiou SH, Wu CW. Targeting cancer stem cells: emerging role of Nanog transcription factor. Onco Targets Ther. 2013;6:1207-20. [PubMed ID: 24043946]. https://doi.org/10.2147/OTT.S38114.
  • 19.
    Abedini MR, Muller EJ, Brun J, Bergeron R, Gray DA, Tsang BK. Cisplatin induces p53-dependent FLICE-like inhibitory protein ubiquitination in ovarian cancer cells. Cancer Res. 2008;68(12):4511-7. [PubMed ID: 18559494]. https://doi.org/10.1158/0008-5472.CAN-08-0673.
  • 20.
    Barr MP, Gray SG, Hoffmann AC, Hilger RA, Thomale J, O'Flaherty JD, et al. Generation and characterisation of cisplatin-resistant non-small cell lung cancer cell lines displaying a stem-like signature. PLoS One. 2013;8(1). e54193. [PubMed ID: 23349823]. https://doi.org/10.1371/journal.pone.0054193.

Copyright

Copyright © 2017, Cancer Research Center (CRC), Shahid Beheshti University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

31
Dec
2019
International Journal of Cancer Management

Crocin Enhances Cisplatin-Induced Chemosensitivity in Human Cervical Cancer Cell Line

Homa Mollaei,
Reyhane Hoshyar,
Mohammad Reza Abedini,
Reza Safaralizadeh

Mollaei H, Hoshyar R, Abedini MR, Safaralizadeh R. Crocin Enhances Cisplatin-Induced Chemosensitivity in Human Cervical Cancer Cell Line. Int J Cancer Manag. 2019;12(12):e94909. doi: https://doi.org/10.5812/ijcm.94909

25
Dec
2018
Effects of Combined Crocin and Epirubicin on Apoptosis and Cell Cycle Pathways in a Human Cervical Cancer Cell Line

Effects of Combined Crocin and Epirubicin on Apoptosis and Cell Cycle Pathways in a Human Cervical Cancer Cell Line

Masoomeh Valavi,
Arash Ghorbani Abdi Saedabad,
Reyhane Hoshyar,
Homa Mollaei

Valavi M, Ghorbani Abdi Saedabad A, Hoshyar R, Mollaei H. Effects of Combined Crocin and Epirubicin on Apoptosis and Cell Cycle Pathways in a Human Cervical Cancer Cell Line. Int J Cancer Manag. 2018;11(12):e82575. doi: https://doi.org/10.5812/ijcm.82575

25
Apr
2016

Concomitant Use of Sea Cucumber Organic Extract and Radiotherapy on Proliferation and Apoptosis of Cervical (HeLa) Cell Line

Javad Baharara,
Elaheh Amini,
Vahid Vazifedan

Baharara J, Amini E, Vazifedan V. Concomitant Use of Sea Cucumber Organic Extract and Radiotherapy on Proliferation and Apoptosis of Cervical (HeLa) Cell Line. Zahedan J Res Med Sci. 2016;18(4):e6442. doi: https://doi.org/10.17795/zjrms-6442

23
Nov
2014

Crocin Effects on Human Myeloma Cells Regarding Intracellular Redox State, DNA Fragmentation, and Apoptosis or Necrosis Profile

Ramin Rezaee,
Khadijeh Jamialahmadi,
Bamdad Riahi Zanjani,
Mahmoud Mahmoudi,
Khalil Abnous,
Shahrzad Zamani Taghizadeh Rabe
,et al.

Rezaee R, Jamialahmadi K, Riahi Zanjani B, Mahmoudi M, Abnous K, et al. Crocin Effects on Human Myeloma Cells Regarding Intracellular Redox State, DNA Fragmentation, and Apoptosis or Necrosis Profile. Jundishapur J Nat Pharm Prod. 2014;9(4):e20131. doi: https://doi.org/10.17795/jjnpp-20131

Download PDF166.65 KB
Indexed in

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles