Int J Cancer Manag

Image Credit:Int J Cancer Manag

The Effects of BMI and Genetic Variation of Adipokines on Serum Concentrations of Hormones in Untreated Individuals with Breast Cancer; a Pilot Study

Author(s):
Zahra Tahmasebi FardZahra Tahmasebi FardZahra Tahmasebi Fard ORCID1,*
1Department of Biology, Roudehen Branch, Islamic Azad University, Roudehen, Iran

International Journal of Cancer Management:Vol. 15, issue 9; e120259
Published online:Oct 02, 2022
Article type:Research Article
Received:Oct 31, 2021
Accepted:Sep 07, 2022
How to Cite:Tahmasebi Fard Z. The Effects of BMI and Genetic Variation of Adipokines on Serum Concentrations of Hormones in Untreated Individuals with Breast Cancer; a Pilot Study. Int J Cancer Manag. 2022;15(9):e120259. doi: https://doi.org/10.5812/ijcm-120259

Abstract

Background:

Numerous studies have shown an association between hormones secreted by adipose tissues and cancer development.

Objectives:

This study aimed at investigating the effect of body mass index (BMI) and genetic variation of leptin and adiponectin on serum concentrations of leptin, adiponectin, and estradiol among untreated breast cancer.

Methods:

This case-control study was performed on 350 women (175 women with breast cancer and 175 healthy controls), who had not taken any medications. Serum levels of estradiol (17-beta estradiol), leptin, and adiponectin were measured, using the ELISA technique. Single-nucleotide polymorphisms of leptin gene (LepG2548A), leptin receptor (Q223, K109R, and K656N), and adiponectin gene (T45G, G276T, C11377G, and 11391A) in blood-isolated DNA were evaluated, using RFLP-PCR technique.

Results:

Body mass index can affect serum concentrations of hormones and is associated with breast cancer. Also, except for adiponectin C11377G polymorphism, other all genetic variations showed significant relationships with breast cancer. In both groups, BMI was significantly correlated with the mean serum concentrations of hormones, and the risk of breast cancer increased in G2548A, Q223R, K656N, and G276T polymorphisms. The effect of risk allele genotypes on serum concentration of hormones showed that changes in serum concentration of estrogen and leptin in all studied polymorphisms were associated with breast cancer in postmenopausal women. But adiponectin level was only affected by polymorphisms K109R, K656N, and G276 and G11391A.

Conclusions:

High BMI and genetic variation can affect cancer development by changing the serum concentrations of hormones in different genotypes. Studying various populations’ genetics and lifestyle can help definitive conclusions about genetics and obesity.

1. Background

Obesity is a widespread health condition that has increased in recent decades. Body weight gain is associated with the etiology of a wide range of human cancers (1). Numerous studies have shown an association between obesity and cancer progression in various tissues, especially ovarian (2), pancreatic (3), esophageal, colon, prostate, and breast tissues (4).

Adipose tissues secrete various hormones, cytokines, and metabolites called Adipokines. As the body gains weight, some changes occur in the number and size of cells, adipokines secretion, adipocyte death, local hypoxia, and fatty acid motility (5). Adipose tissue dysfunction is known as the main cause of obesity and related disorders (6). Adipokines are produced and secreted by various adipose tissues, including subcutaneous, visceral, and breast adipose tissues. In the breast tissue, Adipokines are in paracrine and autocrine pathways (7). Adipose tissue itself (8) following the ovaries (9) is a source of estradiol production through the aromatization of androgens (8). A direct relationship has been reported between body weight and aromatase activity (8). With increased physical activity, the serum level of estradiol decreases; it indicated the effect of body weight on estradiol concentration (9).

Leptin is the most important adipokine that regulates energy balance and nutrient uptake in the hypothalamus. At the cellular level, it acts as a mitogen, a metabolic regulator, and an angiogenic agent. The role of this hormone in tumorigenesis, especially in the development of breast, colorectal, and prostate cancers, has been discussed (10). Leptin can directly affect obesity-caused breast cancer by the continuous proliferation of benign and malignant cells in the breast epithelium and reduced cell proliferation modulators (11).

Adiponectin, a peptide hormone released from fat tissue, is inversely related to body fat (12). This multifunctional protein, which affects various tissues and organs in the body, has been implicated in the development of obesity-related disorders, such as metabolic syndrome, diabetes, cardiovascular disease, and malignancies. Most studies have reported an association between low concentrations of this hormone and an increased risk of breast cancer (4). Generally, the level of this hormone is independent of adipose mass, and differences may be attributed to estradiol or bloodstream androgens (13).

2. Objectives

In this study, the effects of body mass index (BMI) on serum concentrations of estradiol, leptin, and adiponectin were evaluated. Also, the association between the risk of breast cancer and polymorphisms in leptin gene promoter (LEPG2548A rs7799039), polymorphisms in leptin receptors (Q223R rs1137101, K109 rs1137100, and K656N rs8179183), and adiponectin polymorphisms (T45G Rs2241766, G276T rs1501299, C11377G rs266729, and G11391A rs17300539) were studied concerning BMI in two groups of women.

3. Methods

3.1. Study Participants (Includes/Excludes Criteria)

The protocol of the study is following the ethical guidelines of the 1975 Helsinki Declaration, which was reflected in the prior approval of the University Medical Research Committee. After approval of the study protocol, blood samples were collected from 350 women, who had been referred to hospitals in Tehran. Totally, 175 women with breast cancer, whose disease was diagnosed by mammography, ultrasonography, and biochemical tests, needed surgical interventions and were selected by a specialist. Limitations of the study included not taking medications and not starting treatments such as chemotherapy, radiotherapy, etc. The healthy controls (175 women) also did not have specific diseases such as cardiovascular or diabetes. The case and control groups were matched for age, area of residency, and absence of cardiovascular disease or diabetes. In both groups, postmenopausal and non-menopausal women were selected (menopause if not for using estrogen therapy). They were in the same terms of not smoking, not alcohol consumption, and not having thyroid or fatty liver diseases, which resulted in the exclusion of large numbers of individuals.

According to the limitations of the study, individuals who had taken medications for migraine, thyroid problems, fatty liver, or any other drug were excluded from the study. After obtaining informed consent from all participants, some information, such as age, height, weight, and family history of breast cancer were collected. Pathological information was collected from their medical records after surgery.

3.2. DNA and Serum Isolation

For DNA extraction and serum preparation, blood samples (5 - 7 mL) were collected between 8 a.m. and 10 a.m. after 8 to 10 hours of fasting. Some of the blood samples were poured into a tube containing 200 μL of 0.5 mM EDTA and stored at -20°C to extract DNA based on the salting-out method. The remaining blood sample was transferred to a separate tube via centrifugation for serum separation and stored at -80°C. Hormone levels were measured after serum separation, using commercial 17-beta estradiol (DiaMetra Company, Italy), leptin (LDN, Nordhorn), and adiponectin (AviBion, Finland) kits. The assays were performed according to the protocol of each kit.

3.3. Selection of Single-Nucleotide Polymorphisms and Genotyping

In this study, single-nucleotide polymorphisms (SNPs), which were associated with the risk of multiple malignancies and diseases according to many previous studies, were selected (14-20). To investigate genetic variations in leptin, G2548A polymorphism at the gene promoter site, 3 polymorphisms, including Q223R, K109R, and K656N at the leptin receptor site were also selected. Also, genetic variations of adiponectin were investigated in G276T, T45G, C11377G, and G11391A polymorphisms.

After testing the quality and quantity of the extracted DNA, the samples were amplified with the designed primers (Table 1). After enzymatic digestion based on the size of formed bands on 2% gel, genotypes were determined in the samples. To confirm the results, some samples were randomly re-tested, and positive and negative controls were used to confirm enzymatic digestion.

Table 1.Primer Sequences, TM Primers, PCR Products, Restriction Enzyme, and Digested Fragments
Polymorphism and Sequence 5’ → 3’TMPCR ProductRestriction EnzymeDigested Fragment
Leptin, G2548A, rs779903958.8°C229 bpHhaIGG: 181 bp, 48 bp; AA: 229 bp; GA: 229, 181 and 48 bp
F: TCCCGTGAGAACTATTCTTCTTTTG
R: AAAGCAAAGACAGGCATAAAA
Leptin R, Q223R, rs113710159.9°C366 bpMae IIIAA: 243 bp and 123 bp; GG: 366 bp; AG: 366, 243 and 123 bp
F: TCCTGCTTTAAAAGCCTATCCAGTATTT
R: AGCTAGCAAATATTTTTGTAAGCAAT
Leptin R, K109R, rs113710059°C104 bpBsgIAA: 72 bp and 32 bp; GG: 104 bp; AG: 104, 72 and 32 bp
F: TTTTTTCCACTGTTGCTTTCGGA
R: AAACTAAAGAATTTACTGTTGAAACAAATGTC
Leptin R, K656N, rs817918361.1°C258 bpBstUIGG: 231 bp and 27 bp; CC: 258 bp; GC: 258, 231 and 27 bp
F: GCTAGATGGACTGGGATATTGGAGTAAT
R: CTTCCAAAGTAAAGTGACATTTTTCTC
Adiponectin, T45G, rs224176660.5°C372 bpBsphITT: 216 bp and 156 bp; GG: 372 bp; TG: 372, 216 and 156 bp
F: GAAGTAGACTCTGCTGAGATGG
R: TATCAGTGTAGGAGGTCTGTGATG
Adiponectin, G276T, rs150129965.4°C468 bpMva1269IGG: 320 bp and 148 bp; TT: 468 bp; GT: 468, 320 and 148 bp
F: TCTCTCCATGGCTGACAGTG
R: AGATGCAGCAAAGCCAAAGT
Adiponectin, C11377G, rs26672958.8°C163 bpBspCNICC: 120 bp and 43 bp; GG: 163 bp; CG: 163, 120 and 43 bp
F: CATCAGAATGTGTGGCTTGC
R: AGAAGCAGCCTGGAGAACTG
Adiponectin, G11391A, rs1730053958.8°C163 bpMspIGG: 137 bp and 26 bp; AA: 163 bp; GA: 163, 137 and 26 bp
F: CATCAGAATGTGTGGCTTGC
R: AGAAGCAGCCTGGAGAACTG

3.4. Statistical Analysis

The distribution of genotypes and alleles was determined for each polymorphism in the case and control groups based on the Hardy-Weinberg equilibrium, using unconditional univariate and multivariate logistic regression analyses for measuring the crude and adjusted odds ratios (ORs) of polymorphisms. The participants in the two groups were divided into subgroups based on BMI (BMI ≥ 25 and BMI < 25) to determine the relationship between SNPs and BMI, using logistic regression. In addition, the participants were subdivided into two age subgroups (< 50 and ≥ 50 years) to study the relationship between polymorphism genotypes and age via logistic regression analysis. The mean serum levels of estradiol, leptin, and adiponectin in the case and control groups, BMI subgroups, and different genotypes of polymorphisms were calculated, using an unpaired t test. In all analyses, serum concentrations of hormones were reported as mean ± SD and the significance level was considered ≤ 0.05.

4. Results

The participants were in the age range of 35 to 72 years. Demographic and biochemical characteristics of patients with breast cancer and healthy controls are summarized in Table 2.

Table 2.Frequency Distribution of Demographic and Biochemistry Characteristics Among Cancer Patients and Controls a
CharacteristicsPatients n = 175Controls n = 175P Value
Age (Range of years)0.470
< 5058 (33.14)56 (32)
≥ 50117 (66.86)119 (68)
Mean ± SD56.06 ± 8.0955.39 ± 9.32
Body mass index (kg/m2)5.9 × 10 -5
≤ 2574 (42.29)130 (74.29)
> 25101 (57.71)45 (25.71)
Mean ± SD24.89 ± 2.0624.02 ± 1.95
Menopausal statue0.052
Premenopausal
Body mass index ≤ 2534 (19.43)59 (33.71)
Body mass index > 2545 (25.71)21 (12)
Mean ± SD24.67 ± 1.9924.04 ± 2.06
Postmenopausal2.6 × 10-4
Body mass index ≤ 2540 (22.86)71 (40.57)
Body mass index > 2556 (32)24 (13.72)
Mean ± SD25.08 ± 2.1124.00 ± 1.87
Estrogen (ng/mL)
Body mass index ≤ 2544.50 ± 13.9837.45 ± 14.760.001
Body mass index > 2554.33 ± 15.9737.61 ± 16.452.32 × 10-8
Total Mean ± SD50.35 ± 15.9237.49 ± 15.171.14 × 10-13
Leptin (ng/mL)
Body mass index ≤ 2517.64 ± 8.3113.62 ± 4.311 × 10-5
Body mass index > 2517.69 ± 6.5914.17 ± 5.110.002
Total Mean ± SD17.67 ± 7.3413.76 ± 4.535.3 × 10-9
Adiponectin (ng/mL)
Body mass index ≤ 259.94 ± 3.4411.67 ± 6.360.031
Body mass index > 258.58 ± 3.6811.40 ± 6.210.001
Total Mean ± SD9.15 ± 3.6311.60 ± 6.301.2 × 10-5
Family history0.005
Positive52 (29.71)30 (17.14)
Negative123 (70.29)145 (82.86)
Histological report
Estrogen receptor
Positive144 (82.29)
Negative31 (17.71)
Progesterone receptor
Positive106 (60.57)
Negative69 (39.43)
Type of cancer
Invasive lobular carcinoma (ILC)60 (34.29)
Invasive ductal carcinoma (IDC)70 (40)
Ductal carcinoma in situ (DCIS)31 (17.71)
Lobular carcinoma in situ (LCIS)14 (8)
Stage of cancer
I34 (19.43)
II26 (14.86)
II/III41 (23.43)
III47 (26.85)
Metastasis27 (15.43)

a Values are expressed as No. (%).

4.1. Polymorphisms and Breast Cancer

Moreover, the relationship between SNPs and breast cancer was evaluated, using logistic regression analysis as shown in Table 3.

Table 3.Association Between Single Nucleotide Polymorphisms in LEP, LEPR, ADIPO, and Odds Ratio of Breast Cancer by Logistic Regression a
VariablesCases (n = 158)Controls (n = 158)Crude Odds Ratio (95% CI)P ValueAdjusted Odds Ratio (95% CI)P Value
Leptin G2548A rs7799039
GG83 (47.43)112 (64)Referent
AA60 (34.29)41 (23.43)0.506 (0.311 - 0.825)0.0060.565 (0.325 - 0.980)0.042
GA32 (18.28)22 (12.57)0.509 (0.276 - 0.940)0.0310.598 (0.304 - 1.175)0.136
Alleles
G198 (56.57)246 (70.29)Referent
A152 (43.43)104 (29.71)0.579 (0.424 - 0.791)0.001
Leptin R Q223R rs1137101
AA116 (66.29)140 (80)Referent
GG50 (28.57)25 (14.29)0.414 (0.242 - 0.711)0.0010.375 (0.208 - 0.678)0.001
AG9 (5.14)10 (5.71)0.921 (0.362 - 2.342)0.8620.958 (0.347 - 2.639)0.933
Alleles
A241 (68.86)290 (82.86)Referent
G109 (31.14)60 (17.14)0.464 (0.324 - 0.664)2.7 × 10- 5
Leptin R K109R rs1137100
AA94 (53.71)118 (67.43)Referent
GG67 (38.29)50 (28.57)0.594 (0.377 - 0.938)0.0250.644 (0.389 - 1.066)0.087
AG14 (8)7 (4)0.398 (0.155 - 1.027)0.0570.529 (0.186 - 1.503)0.232
Alleles
A202 (57.71)243 (69.43)Referent
G148 (42.29)107 (30.57)0.624 (0.457 - 0.851)0.003
Leptin R K656N rs8179183
GG81 (46.29)118 (67.43)Referent
CC55 (31.43)25 (14.29)0.312 (0.180 - 0.541)3.4 × 10-50.373 (0.206 - 0.676)0.001
GC39 (22.28)32 (18.28)0.563 (0.326 - 0.973)0.0390.605 (0.329 - 1.110)0.104
Alleles
G201 (57.43)268 (76.57)Referent
C149 (42.57)82 (23.43)1.412 (1.048 - 1.902)0.023
Adiponectin T45G rs2241766
TT111 (63.43)138 (78.86)Referent
GG39 (22.29)25 (14.28)0.516 (0.294 - 0.903)0.0210.496 (0.265 - 0.927)0.028
TG25 (14.28)12 (6.86)0.386 (0.186 - 0.803)0.0110.425 (0.192 - 0.942)0.035
Alleles
T247 (70.57)288 (82.29)Referent
G103 (29.43)62 (17.71)0.523 (0.366 - 0.749)4 × 10-4
Adiponectin G276T rs1501299
GG96 (54.86)119 (68)Referent
TT38 (21.71)23 (13.14)0.488 (0.272 - 0.875)0.0160.416 (0.222 - 0.781)0.006
GT41 (23.43)33 (18.86)0.649 (0.382 - 1.105)0.1110.648 (0.353 - 1.191)0.162
Alleles
G233 (66.57)271 (77.43)Referent
T117 (33.43)79 (22.57)0.598 (0.428 - 0.835)0.003
Adiponectin C11377G rs266729
CC120 (68.57)122 (69.71)Referent
GG35 (20)29 (16.57)0.815 (0.469 - 1.417)0.4680.891 (0.480 - 1.652)0.714
CG20 (11.43)24 (13.72)1.180 (0.619 - 2.249)0.6141.649 (0.777 - 3.497)0.192
Alleles
C260 (74.29)268 (76.57)Referent
G90 (25.71)82 (23.43)0.912 (0.647 - 1.286)0.6
Adiponectin G11391A rs17300539
GG105 (60)126 (72)Referent
AA57 (32.57)41 (23.43)0.599 (0.372 - 0.966)0.0360.803 (0.467 - 1.382)0.429
GA13 (7.43)8 (4.57)0.513 (0.195 - 1.284)0.1540.548 (0.201 - 1.493)0.240
Alleles
G223 (63.71)260 (74.29)Referent
A127 (36.29)90 (25.71)0.615 (0.445 - 0.851)0.003

a Values are expressed as No. (%).

As shown in Table 4, the association between polymorphisms and breast cancer was adjusted for age, BMI, and family history. A significant association was observed in rs7799039, rs1137101, rs8179183, and rs1501299.

Table 4.The Association Between Single Nucleotide Polymorphisms in Leptin and Adiponectin Gene and Risk of Breast Cancer After Adjustment for Age, Body Mass Index, and Family History
GenotypesCase (%)Controls (%)P-ValueOdds Ratio (CI 95%)
Leptin G2548A rs7799039
GG47.43641 (Referent)
AA34.2923.430.0242.001 (1.098-3.647)
GA18.2812.570.0691.967 (0.948-4.080)
Leptin R Q223R rs1137101
AA66.29801 (Referent)
GG28.5714.290.0042.537 (1.356-4.747)
AG5.145.710.7051.249 (0.395-3.946)
Leptin R K109R rs1137100
AA53.7167.431 (Referent)
GG38.2928.570.0531.713(0.993-2.953)
AG840.2032.036(0.681-6.091)
Leptin R K656N rs8179183
GG46.2967.431 (Referent)
CC31.4314.290.0012.842 (1.510-5.351)
GC22.2818.280.1201.676 (0.873-3.218)
Adiponectin T45G rs2241766
TT63.4378.861 (Referent)
GG22.2914.280.0551.892 (0.986-3.630)
TG14.286.860.1211.951 (0.837-4.545)
Adiponectin G276T rs1501299
GG54.86681 (Referent)
TT21.7113.140.0052.654 (1.352-5.208)
GT23.4318.860.4621.278 (0.665-2.456)
Adiponectin C11377G rs266729
CC68.5769.711 (Referent)
GG2016.570.5181.239 (0.648-2.369)
CG11.4313.720.1950.583 (0.257-1.319)
Adiponectin G11391A rs17300539
GG60721 (Referent)
AA32.5723.430.8071.076 (0.597-1.940)
GA7.434.570.2481.839 (0.654-5.171)

In another analysis, the relationship between BMI and SNPs was analyzed via logistic regression. Both homozygous mutant and heterozygous LEPG2548A genotypes had a significant relationship with BMI and increased the risk of breast cancer by 2.200 and 2.279 folds, respectively. Moreover, with an increase in BMI, the risk of breast cancer increased by 2.426, 2.899, and 2.796 folds in carriers of LEPRQ223R, LEPRK656N, and AdipoG276T genotypes, respectively, compared to individuals with other genotypes.

Concerning the variable of age in the two subgroups (< 50 and ≥ 50 years), ORs of 2.662, 2.970, 1.990, and 2.237 were reported in breast cancer patients with advancing age, carrying homozygous mutant genotypes of LEPRQ223R, LEPRK656N, AdipoT45G, and AdipoG276T, respectively.

In addition to the above studies, the relationship between polymorphism genotypes and history of disease in first-degree relatives was studied among patients. The results showed that just the TT genotype of AdipoG276T with an OR of 3.023 (P = 0.043, OR: 3.023, CI95%: 0.992 - 9.214) and GG genotype of AdipoC11377G polymorphism with an OR of 1.374 (P = 0.049, OR: 1.374, CI95%: 0.545 - 3.462) had significant relationships with the risk of breast cancer.

4.2. Influence of Risk Allele on Serum Concentration of Hormones in Pre- and Post-menopause Samples

In another study, the effect of the risk alleles of studied polymorphisms on the serum concentration of the estrogen, leptin, and adiponectin hormones in premenopausal and postmenopausal women regarding the incidence of breast cancer was investigated. The effect of risk allele genotypes on serum concentration of hormones indicated changes in serum concentration of estrogen and leptin in all studied polymorphisms associated with breast cancer in postmenopausal women. Adiponectin level was affected only by polymorphisms K109R, K656N, and G276 and G11391A in postmenopausal women with breast cancer. Mean serum concentrations of hormones and their association with breast cancer are shown in Figure 1.

Influence of mutant allele of polymorphisms on serum concentration of estradiol, leptin, and adiponectin hormones in pre-menopause and post-menopause of two groups. Postmenopausal women with gene mutations are more likely to develop breast cancer. However, some mutations can affect the risk of cancer by affecting the concentration of adiponectin. * P ≤ 0.01, ** P ≤ 0.001, *** P ≤ 0.0001, **** P ≤ 0.00001
Figure 1.

Influence of mutant allele of polymorphisms on serum concentration of estradiol, leptin, and adiponectin hormones in pre-menopause and post-menopause of two groups. Postmenopausal women with gene mutations are more likely to develop breast cancer. However, some mutations can affect the risk of cancer by affecting the concentration of adiponectin. * P ≤ 0.01, ** P ≤ 0.001, *** P ≤ 0.0001, **** P ≤ 0.00001

5. Discussion

In this study, the effects of BMI and genetic variations of leptin and adiponectin genes on the serum concentrations of estradiol, leptin, and adiponectin in postmenopausal and non-menopausal patients with breast cancer were evaluated. Because taking medication or exposure to radiation affects hormone concentrations, patients whose diseases had been diagnosed and had not started any treatment were selected.

Evaluation of genetic variations in SNPs revealed that G2548A polymorphism was associated with breast cancer risk. This finding was in line with the results reported by Cleveland et al. (21) and Tang et al. (22). On the other hand, in a study by Luan et al., no significant association (G2548A polymorphism) was found with breast cancer (23).

In a previous study of Luan, LEPR Q223R polymorphism was associated with a reduced risk of breast cancer in Asians (23). The present results also showed the firmest association between Q223R polymorphism and reduced risk of breast cancer, which is in line with the results reported by Wang et al. (24). Moreover, in a meta-analysis by Liu and Liu, LEPRQ223R was associated with the spread of breast cancer in East Asia (25). In addition, Okobia et al. attributed the increased relative risk of breast cancer before menopause to changes in leptin signaling capacity (16). Conversely, Rong et al. found no significant association between Q223R polymorphism and cancer risk (26). But, in this study, the allele frequency of LEPR K109R polymorphism was associated with a reduced risk of breast cancer. A similar finding was reported by Shi et al. (27). But Rodrigo et al. reported that LEPR K109R polymorphism increased the risk of breast cancer (OR = 4.125) (28).

In this study, LepR K656N polymorphism had the firmest allelic association with the reduced risk of breast cancer, which is in line with the results reported by Huerta et al. (29). Nevertheless, Liu et al. did not find any relationship between this SNP and cancer in a meta-analysis (30). Also, Wang et al. did not report any association between this polymorphism and breast cancer (31).

In our study, there was a significant relationship between breast cancer and risk alleles of AdipoT45G and AdipoG276T polymorphisms. Similar results were reported by Reddy in an Indian population (32), whereas Nyante et al. found no significant relationship with breast cancer (33).

Two same results were obtained for C11377G polymorphism in the gene promoter site. In a previous study of 156 samples, Adipo C11377G polymorphism was not significantly associated with breast cancer (34). Also, in the current study, no changes occurred by increasing the sample size to 350. It seems that this polymorphism is not related to breast cancer. Conversely, in a study by Liu et al., this polymorphism was associated with non-alcoholic fatty liver disease (35). Polymorphism G11391A was associated with a reduced risk of breast cancer in terms of genotypic and allelic frequencies. Furthermore, in a study by Vasseur et al., C11377G and G11391A polymorphisms were associated with the risk of type II diabetes (36).

Our findings revealed that carriers of LEPRQ223R, LEPRK656N, AdipoT45G, and AdipoG276T polymorphisms, who were above 50 years, had higher risks of developing breast cancer by 2.662, 2.970, 1.990, and 2.237 folds, respectively. With increasing BMI, ORs of cancer development in individuals with AA and AG genotypes of LepG2548A polymorphism were 2.200 and 2.279, respectively. Also, ORs of cancer in individuals with GG genotype of LEPRQ223R, CC genotype of LEPRK656N, and TT genotype of AdipoG276T were 2.426, 2.899, and 2.796 folds, respectively. The relationship between polymorphism genotype and family history of patients showed ORs of developing breast cancer in individuals carrying GC genotype of LEPRK656N, homozygous TT mutant of AdipoG276T, and GG genotype of AdipoC11377G were 1.352, 3.023, and 1.374, respectively.

The results showed that elevated serum levels of estradiol and leptin, besides the decreased level of adiponectin, were associated with the risk of breast cancer; similar results were reported by Chen et al. (37). Furthermore, in a meta-analysis by Pan et al., leptin was identified as an important biomarker in women at risk of breast cancer, especially in overweight/obese or postmenopausal women (38). In addition, by a meta-analysis, Gu et al. found that serum leptin level might play an essential role in the pathogenesis and metastasis of breast cancer and could be used as a suitable therapeutic target for breast cancer treatment (39). On the contrary, Hu et al. (40) and Assiri and Kamel found an inverse association between serum leptin concentration and breast cancer risk in premenopausal women (12).

The study of the effect of risk alleles on serum concentration of estradiol and leptin hormones showed that postmenopausal individuals were associated with breast cancer for all studied polymorphisms. But, the serum level of adiponectin was only affected by K109R, K656N, and G276T and G11391A polymorphisms. During perimenopause, polymorphisms Q223R, K656N, T45G, and G276T and G11391A affected serum level of estradiol, polymorphisms G2548A, Q223R, and G276T and C11377G affected leptin level, and K109R, K656N affected adiponectin serum level.

The association of menopausal status with the risk of breast cancer and leptin level has been reported in several studies. Some research has indicated an inverse relationship between leptin level and menopausal status. Also, in a study by Pan et al., leptin level was associated with a higher risk of breast cancer in postmenopausal women (38), while no significant association was observed in premenopausal women. In addition, a study by Ando et al. revealed the role of postmenopausal estradiol (4).

In terms of BMI, there was a significant difference between premenopausal and postmenopausal women in the control and cancer groups, and a significant association was observed in the BMI > 25. In line with the present study, the finding of Renehan et al. indicated a specific association between breast cancer and BMI increase in premenopausal and postmenopausal women in Asia-Pacific (8). Some recent studies have suggested BMI as a risk factor for breast cancer in postmenopausal women (41-44) similar to this study. In contrast, Rinaldi et al. reported an inverse relationship between BMI and breast cancer risk (44). Van den Brandt et al. also found a strong association between BMI and breast cancer risk in postmenopausal women. Also, a negative relationship was reported in premenopausal women (45).

5.1. Conclusions

The current results indicated that weight gain and obesity, along with polymorphisms in leptin and adiponectin genes, are major contributing factors to the development of breast cancer. Also, findings suggest that the expression of estradiol, leptin and adiponectin should be reduced in premenopausal women by following a healthy body weight to prevent breast cancer development during menopause.

Acknowledgments

Footnotes

References

  • 1.
    Ecker BL, Lee JY, Sterner CJ, Solomon AC, Pant DK, Shen F, et al. Impact of obesity on breast cancer recurrence and minimal residual disease. Breast Cancer Res. 2019;21(1):41. [PubMed ID: 30867005]. [PubMed Central ID: PMC6416940]. https://doi.org/10.1186/s13058-018-1087-7.
  • 2.
    Tworoger SS, Huang T. Obesity and Ovarian Cancer. Recent Results Cancer Res. 2016;208:155-76. [PubMed ID: 27909907]. https://doi.org/10.1007/978-3-319-42542-9_9.
  • 3.
    Zhou B, Wu D, Liu H, Du LT, Wang YS, Xu JW, et al. Obesity and pancreatic cancer: An update of epidemiological evidence and molecular mechanisms. Pancreatology. 2019;19(7):941-50. [PubMed ID: 31447281]. https://doi.org/10.1016/j.pan.2019.08.008.
  • 4.
    Ando S, Gelsomino L, Panza S, Giordano C, Bonofiglio D, Barone I, et al. Obesity, Leptin and Breast Cancer: Epidemiological Evidence and Proposed Mechanisms. Cancers (Basel). 2019;11(1). [PubMed ID: 30634494]. [PubMed Central ID: PMC6356310]. https://doi.org/10.3390/cancers11010062.
  • 5.
    Choe SS, Huh JY, Hwang IJ, Kim JI, Kim JB. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front Endocrinol (Lausanne). 2016;7:30. [PubMed ID: 27148161]. [PubMed Central ID: PMC4829583]. https://doi.org/10.3389/fendo.2016.00030.
  • 6.
    Luo L, Liu M. Adipose tissue in control of metabolism. J Endocrinol. 2016;231(3):R77-99. [PubMed ID: 27935822]. [PubMed Central ID: PMC7928204]. https://doi.org/10.1530/JOE-16-0211.
  • 7.
    Mattsson C, Olsson T. Estrogens and glucocorticoid hormones in adipose tissue metabolism. Curr Med Chem. 2007;14(27):2918-24. [PubMed ID: 18045137]. https://doi.org/10.2174/092986707782359972.
  • 8.
    Renehan AG, Tyson M, Egger M, Heller RF, Zwahlen M. Body-mass index and incidence of cancer: a systematic review and meta-analysis of prospective observational studies. Lancet. 2008;371(9612):569-78. [PubMed ID: 18280327]. https://doi.org/10.1016/S0140-6736(08)60269-X.
  • 9.
    Cleary MP, Grossmann ME. Minireview: Obesity and breast cancer: the estrogen connection. Endocrinology. 2009;150(6):2537-42. [PubMed ID: 19372199]. [PubMed Central ID: PMC2689796]. https://doi.org/10.1210/en.2009-0070.
  • 10.
    Garofalo C, Surmacz E. Leptin and cancer. J Cell Physiol. 2006;207(1):12-22. [PubMed ID: 16110483]. https://doi.org/10.1002/jcp.20472.
  • 11.
    Wu MH, Chou YC, Chou WY, Hsu GC, Chu CH, Yu CP, et al. Circulating levels of leptin, adiposity and breast cancer risk. Br J Cancer. 2009;100(4):578-82. [PubMed ID: 19223908]. [PubMed Central ID: PMC2653731]. https://doi.org/10.1038/sj.bjc.6604913.
  • 12.
    Assiri AM, Kamel HF. Evaluation of diagnostic and predictive value of serum adipokines: Leptin, resistin and visfatin in postmenopausal breast cancer. Obes Res Clin Pract. 2016;10(4):442-53. [PubMed ID: 26388139]. https://doi.org/10.1016/j.orcp.2015.08.017.
  • 13.
    Dalamaga M, Diakopoulos KN, Mantzoros CS. The role of adiponectin in cancer: a review of current evidence. Endocr Rev. 2012;33(4):547-94. [PubMed ID: 22547160]. [PubMed Central ID: PMC3410224]. https://doi.org/10.1210/er.2011-1015.
  • 14.
    Mizuta E, Kokubo Y, Yamanaka I, Miyamoto Y, Okayama A, Yoshimasa Y, et al. Leptin gene and leptin receptor gene polymorphisms are associated with sweet preference and obesity. Hypertens Res. 2008;31(6):1069-77. [PubMed ID: 18716353]. https://doi.org/10.1291/hypres.31.1069.
  • 15.
    Kim EY, Jun KH. The relationship between susceptibility of gastric cancer and leptin/leptin receptor gene polymorphisms in Kore. Surg Obes Relat Dis. 2016;12(7):S202-3. https://doi.org/10.1016/j.soard.2016.08.352.
  • 16.
    Okobia MN, Bunker CH, Garte SJ, Zmuda JM, Ezeome ER, Anyanwu SN, et al. Leptin receptor Gln223Arg polymorphism and breast cancer risk in Nigerian women: a case control study. BMC Cancer. 2008;8:338. [PubMed ID: 19017403]. [PubMed Central ID: PMC2613914]. https://doi.org/10.1186/1471-2407-8-338.
  • 17.
    Chun KA, Kocarnik JM, Hardikar SS, Robinson JR, Berndt SI, Chan AT, et al. Leptin gene variants and colorectal cancer risk: Sex-specific associations. PLoS One. 2018;13(10). e0206519. [PubMed ID: 30379922]. [PubMed Central ID: PMC6209341]. https://doi.org/10.1371/journal.pone.0206519.
  • 18.
    Erbay B, Yilmaz TU, Eraldemir C, Uren N, Tiryaki C, Ergul E, et al. The Relationship between Adiponectin and Breast Cancer. J Breast Health. 2016;12(2):67-71. [PubMed ID: 28331736]. [PubMed Central ID: PMC5351503]. https://doi.org/10.5152/tjbh.2016.2881.
  • 19.
    Mamur BA, Akbaş E, Çolak T, Türkmenoğlu MÖ, Seyit H, Sungur MA. Relationship between adiponectin and adiponectin receptor 1 gene polymorphisms with colorectal cancer. Journal of Clinical and Experimental Investigations. 2014;5(4). https://doi.org/10.5799/ahinjs.01.2014.04.0460.
  • 20.
    Skibola CF, Holly EA, Forrest MS, Hubbard A, Bracci PM, Skibola DR, et al. Body mass index, leptin and leptin receptor polymorphisms, and non-hodgkin lymphoma. Cancer Epidemiol Biomarkers Prev. 2004;13(5):779-86. [PubMed ID: 15159310].
  • 21.
    Cleveland RJ, Gammon MD, Long CM, Gaudet MM, Eng SM, Teitelbaum SL, et al. Common genetic variations in the LEP and LEPR genes, obesity and breast cancer incidence and survival. Breast Cancer Res Treat. 2010;120(3):745-52. [PubMed ID: 19697123]. [PubMed Central ID: PMC3571680]. https://doi.org/10.1007/s10549-009-0503-1.
  • 22.
    Tang W, Kang M, Liu C, Qiu H. Leptin rs7799039 (G2548A) polymorphism is associated with cancer risk: a meta-analysis involving 25,799 subjects. Onco Targets Ther. 2019;12:2879-90. [PubMed ID: 31114233]. [PubMed Central ID: PMC6489571]. https://doi.org/10.2147/OTT.S190093.
  • 23.
    Luan H, Zhang H, Li Y, Wang P, Cao L, Ma H, et al. Association of two obesity-related gene polymorphisms LEPG2548A rs7799039 and LEPRQ223R rs1137101 with the risk of breast cancer. Oncotarget. 2017;8(35):59333-44. [PubMed ID: 28938640]. [PubMed Central ID: PMC5601736]. https://doi.org/10.18632/oncotarget.19580.
  • 24.
    Wang Y, Yang H, Gao H, Wang H. The association between LEPR Q223R polymorphisms and breast cancer risk. Breast Cancer Res Treat. 2015;151(1):1-6. [PubMed ID: 25863476]. https://doi.org/10.1007/s10549-015-3375-6.
  • 25.
    Liu C, Liu L. Polymorphisms in three obesity-related genes (LEP, LEPR, and PON1) and breast cancer risk: a meta-analysis. Tumour Biol. 2011;32(6):1233-40. [PubMed ID: 21887553]. https://doi.org/10.1007/s13277-011-0227-9.
  • 26.
    Rong G, Tang W, Wang Y, Qiu H, Chen S. Investigation of leptin receptor rs1137101 G>A polymorphism with cancer risk: evidence from 35936 subjects. Biosci Rep. 2019;39(6). [PubMed ID: 31196966]. [PubMed Central ID: PMC6597850]. https://doi.org/10.1042/BSR20182240.
  • 27.
    Shi H, Shu H, Huang C, Gong J, Yang Y, Liu R, et al. Association of LEPR K109R polymorphisms with cancer risk: a systematic review and pooled analysis. J BUON. 2014;19(3):847-54. [PubMed ID: 25261678].
  • 28.
    Rodrigo C, Tennekoon KH, Karunanayake EH, De Silva K, Amarasinghe I, Wijayasiri A. Circulating leptin, soluble leptin receptor, free leptin index, visfatin and selected leptin and leptin receptor gene polymorphisms in sporadic breast cancer. Endocr J. 2017;64(4):393-401. [PubMed ID: 28190851]. https://doi.org/10.1507/endocrj.EJ16-0448.
  • 29.
    Huerta L, Cabrera C, Montes R, Cuellar H, López J, Covarrubias S. Association between leptin and leptin receptor gene polymorphisms and breast cancer risk in premenopausal and postmenopausal Mexican women. Cancer Res Front. 2017;3(1):56-63. https://doi.org/10.17980/2017.56.
  • 30.
    Liu PC, Yang YJ, Liu R, Huang CJ, Shu HX, Gong JP, et al. Lack of association between LEPR Lys656Asn or Ser343Ser polymorphisms and cancer susceptibility: A meta-analysis. Biomed Rep. 2014;2(6):849-54. [PubMed ID: 25279158]. [PubMed Central ID: PMC4179704]. https://doi.org/10.3892/br.2014.326.
  • 31.
    Wang LQ, Shen W, Xu L, Chen MB, Gong T, Lu PH, et al. The association between polymorphisms in the leptin receptor gene and risk of breast cancer: a systematic review and pooled analysis. Breast Cancer Res Treat. 2012;136(1):231-9. [PubMed ID: 22983835]. https://doi.org/10.1007/s10549-012-2228-9.
  • 32.
    Reddy NM. Association of Adiponectin Gene Functional Polymorphisms (+45T/G and 276G/T) with Obese Breast Cancer. J Mol Biomark Diagn. 2012;3(6). https://doi.org/10.4172/2155-9929.1000138.
  • 33.
    Nyante SJ, Gammon MD, Kaufman JS, Bensen JT, Lin DY, Barnholtz-Sloan JS, et al. Common genetic variation in adiponectin, leptin, and leptin receptor and association with breast cancer subtypes. Breast Cancer Res Treat. 2011;129(2):593-606. [PubMed ID: 21516303]. [PubMed Central ID: PMC3355661]. https://doi.org/10.1007/s10549-011-1517-z.
  • 34.
    Tahmasebifar Z. [Investigating the relationship between Body Mass Index (BMI) and C11377G polymorphism of adiponectin gene with breast cancer]. J Fasa Univ Med Sci. 2018;8(2):754-9. Persian.
  • 35.
    Liu M, Liu S, Shang M, Liu X, Wang Y, Li Q, et al. Association between ADIPOQ G276T and C11377G polymorphisms and the risk of non-alcoholic fatty liver disease: An updated meta-analysis. Mol Genet Genomic Med. 2019;7(5). e624. [PubMed ID: 30838812]. [PubMed Central ID: PMC6503060]. https://doi.org/10.1002/mgg3.624.
  • 36.
    Vasseur F, Helbecque N, Dina C, Lobbens S, Delannoy V, Gaget S, et al. Single-nucleotide polymorphism haplotypes in the both proximal promoter and exon 3 of the APM1 gene modulate adipocyte-secreted adiponectin hormone levels and contribute to the genetic risk for type 2 diabetes in French Caucasians. Hum Mol Genet. 2002;11(21):2607-14. [PubMed ID: 12354786]. https://doi.org/10.1093/hmg/11.21.2607.
  • 37.
    Chen DC, Chung YF, Yeh YT, Chaung HC, Kuo FC, Fu OY, et al. Serum adiponectin and leptin levels in Taiwanese breast cancer patients. Cancer Lett. 2006;237(1):109-14. [PubMed ID: 16019138]. https://doi.org/10.1016/j.canlet.2005.05.047.
  • 38.
    Pan H, Deng LL, Cui JQ, Shi L, Yang YC, Luo JH, et al. Association between serum leptin levels and breast cancer risk: An updated systematic review and meta-analysis. Medicine (Baltimore). 2018;97(27). e11345. [PubMed ID: 29979411]. [PubMed Central ID: PMC6076146]. https://doi.org/10.1097/MD.0000000000011345.
  • 39.
    Gu L, Wang CD, Cao C, Cai LR, Li DH, Zheng YZ. Association of serum leptin with breast cancer: A meta-analysis. Medicine (Baltimore). 2019;98(5). e14094. [PubMed ID: 30702563]. [PubMed Central ID: PMC6380739]. https://doi.org/10.1097/MD.0000000000014094.
  • 40.
    Hu X, Juneja SC, Maihle NJ, Cleary MP. Leptin--a growth factor in normal and malignant breast cells and for normal mammary gland development. J Natl Cancer Inst. 2002;94(22):1704-11. [PubMed ID: 12441326]. https://doi.org/10.1093/jnci/94.22.1704.
  • 41.
    Lahmann PH, Hoffmann K, Allen N, van Gils CH, Khaw KT, Tehard B, et al. Body size and breast cancer risk: findings from the European Prospective Investigation into Cancer And Nutrition (EPIC). Int J Cancer. 2004;111(5):762-71. [PubMed ID: 15252848]. https://doi.org/10.1002/ijc.20315.
  • 42.
    Ahn J, Schatzkin A, Lacey JV, Albanes D, Ballard-Barbash R, Adams KF, et al. Adiposity, adult weight change, and postmenopausal breast cancer risk. Arch Intern Med. 2007;167(19):2091-102. [PubMed ID: 17954804]. https://doi.org/10.1001/archinte.167.19.2091.
  • 43.
    Li CI, Malone KE, Daling JR. Interactions between body mass index and hormone therapy and postmenopausal breast cancer risk (United States). Cancer Causes Control. 2006;17(5):695-703. [PubMed ID: 16633917]. https://doi.org/10.1007/s10552-005-0001-7.
  • 44.
    Rinaldi S, Key TJ, Peeters PH, Lahmann PH, Lukanova A, Dossus L, et al. Anthropometric measures, endogenous sex steroids and breast cancer risk in postmenopausal women: a study within the EPIC cohort. Int J Cancer. 2006;118(11):2832-9. [PubMed ID: 16385576]. https://doi.org/10.1002/ijc.21730.
  • 45.
    van den Brandt PA, Spiegelman D, Yaun SS, Adami HO, Beeson L, Folsom AR, et al. Pooled analysis of prospective cohort studies on height, weight, and breast cancer risk. Am J Epidemiol. 2000;152(6):514-27. [PubMed ID: 10997541]. https://doi.org/10.1093/aje/152.6.514.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.