International Journal of Cancer Management

Image Credit:International Journal of Cancer Management

Dysregulation of miR-638 in Breast Cancer Patients and Bioinformatics Investigation of Its Target Genes in Apoptosis, Angiogenesis and Autophagy Pathways

Author(s):
Samaneh AhmadiSamaneh AhmadiSamaneh Ahmadi ORCID1, Mojtaba   SaffariMojtaba Saffari2, 3, Mohammad Hossein   ModarressiMohammad Hossein ModarressiMohammad Hossein   Modarressi ORCID2, Reza  Shirkoohi Reza Shirkoohi 3, Marjan  JamalianMarjan Jamalian4, Hossein TeimoriHossein TeimoriHossein Teimori ORCID1,*
1Cellular and Molecular Research Center, Basic Health Sciences Institute, Shahrekord University of Medical Sciences, Shahrekord, Iran
2Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
3Cancer Biology Research Center, Cancer Institute Center, Tehran University of Medical Sciences, Tehran, Iran
4Department of Epidemiology and Biostatistics, School of Public Health, Shahrekord University of Medical Sciences, Shahrekord, Iran

International Journal of Cancer Management:Vol. 12, issue 11; e88829
Published online:Nov 24, 2019
Article type:Research Article
Received:Jan 07, 2019
Accepted:Sep 04, 2019
How to Cite:Ahmadi S, Saffari M, Modarressi MH, Shirkoohi R, Jamalian M, et al. Dysregulation of miR-638 in Breast Cancer Patients and Bioinformatics Investigation of Its Target Genes in Apoptosis, Angiogenesis and Autophagy Pathways. Int J Cancer Manag. 2019;12(11):e88829. doi: https://doi.org/10.5812/ijcm.88829

Abstract

Background:

Breast cancer, as the most frequent cancer diagnosed in women worldwide, is affected by different regulatory mechanisms and cellular processes such as microRNAs (miRNAs) and autophagy, which influence tumor cell progression. MiRNAs play a crucial role in cancer progression. Aberrant miRNA expression has been described in various human cancers. Growing evidence proposes that miRNAs have a considerable role in tumor development and may constitute robust biomarkers for cancer diagnosis and prognosis.

Objectives:

The aim of this study was to evaluate miRNA-638 (miR-638) expression level in breast cancer patients and its bioinformatics analysis.

Methods:

In this case-control study, miR-638 expression was examined in fresh breast tissues of 47 patients with breast cancer using real time polymerase chain reaction (PCR). Then the role of miR-638 in various signaling pathways was studied using Target Scan, the MicroRNA-Target Interactions (miRTarBase) database, miRWalk2.0 and the database for annotation, visualization and integrated discovery (DAVID).

Results:

The miR-638 expression level showed a significant decrease in breast cancer patients. Also, this miRNA might be involved in apoptosis, angiogenesis, and autophagy.

Conclusions:

According to the results, miR-638 can be used as a potential prognostic biomarker for cancer growth, and its low expression is thought to increase cancer progression by disrupting cell death and autophagy, which are considered as important pathways in breast cancer.

1. Background

Breast cancer is the most commonly diagnosed malignancy in women worldwide and is considered to be responsible for 30% of the total new cancer cases and 14% of overall cancer mortality (1). In spite of huge efforts, the definite molecular mechanisms of breast cancer tumorigenesis have largely remained unknown. Therefore, discovering the mechanisms involved in breast cancer and unraveling the factors that contribute to the formation of such mechanisms, will help scientists to define new diagnostic and prognostic biomarkers for this cancer (2, 3). On the other side, it has been shown that three molecular pathways, including cell death, autophagy, and angiogenesis are dysregulated in breast cancer. Biomarkers used for early detection of cancer have the potency to reduce the burden of cancer in the population (4). MicroRNAs (miRNAs) are one of the most important classes of biological molecules and their role in the regulation of various molecular mechanisms has been proven by many researches (5). MiRNA expression profiles are dysregulated in different types of cancers. Some studies have suggested that miRNA expression levels correlate with prognosis of breast cancer (6-8); miR-638 is one of these miRNAs, which is located on chromosome 19p13.2 and downstream of ILF3 and QTRT1 genes (9, 10).
Altered expression of miR-638 has been identified in several different types of human tumors. For example, its expression was dramatically reduced in the human gastric tumor (11), basal cell carcinoma (12), breast cancer (13), non-small cell lung cancer (14), colorectal tumor (15), and chronic lymphocytic leukemia (16); therefore it might have a potential suppressing role in these cancers. Moreover, researchers found that miR-638 has a role in the regulation of the metastasis, autophagy and apoptosis processes in melanoma (17). A recent study demonstrated that the expression level of miR-638 was decreased in tissue samples of liver cancer compared with normal liver tissues, leading to angiogenesis promotion (18).

2. Objectives

The aim of the current study was (a) to use bioinformatics resources to prioritize susceptible miRNAs implicated in breast cancer, (b) to evaluate the expression level of prone miRNAs in clinical samples, (c) to use bioinformatics analysis of candidate miRNAs by referring to different databases in order to detect potential signaling pathways that they are involved in, and (d) to investigate the expression analysis of miR-638 in patients with breast cancer.

3. Methods

3.1. RNA Prediction

At first, the Target Scan (TargetScanHuman7.1) and Diana Tools (Diana Tools MicroT-CDS) were used to predict miR-638 target genes which have the potential binding sites on their three prime untranslated region, according to the Software for Statistical Folding of Nucleic Acids and Studies of Regulatory RNAs (SFold database) (http://sfold.wadsworth.org). Then, the Human Protein Atlas (https://www.proteinatlas.org/) and the Human microRNA Disease Database v3.0 (HMDD v3.0) (http://www.cuilab.cn/hmdd) web-based programs were used to determine mRNA and miRNA expression levels.

3.2. Samples Collection

This study was conducted on a total of 47 breast cancer samples and matched-pair adjacent non-cancerous tissues from newly diagnosed patients with breast cancer at the Imam Khomeini Hospital of Tehran University of Medical Sciences between 2015 and 2018. All the clinical samples were collected from Iran National Tumor Bank (The Cancer Institute, Imam Khomeini Hospital, Tehran, Iran). All the contributors were asked to read and sign an informed consent prior to tumor sample collection and following molecular analysis for the present study.
Specimens were removed during a surgical procedure, and a pathologist distinguished tumor tissue from adjacent healthy tissue, as a normal sample. Then the specimens were immediately frozen in liquid nitrogen, and stored at -80ºC until RNA extraction. All tests were carried out in conformity with relevant guidelines.

3.3. RNA Isolation

Total RNA was extracted from the samples using TRIZOL-Reagent RNA isolation agent (Invitrogen Carlsbad, CA). RNA extraction from tissue samples was performed according to the manufacturer’s protocol. The quantity of RNA was measured using Nano Drop spectrophotometer ND-2000 (Thermo Scientific), and RNA quality was assessed by running the RNA on 1.5% agarose gel electrophoresis.

3.4. cDNA Synthesis and qPCR

Complementary DNA (cDNA) synthesis was performed on 1 µg of extracted total RNA, using a TruScript First Strand cDNA Synthesis Kit (Norgen Canada) for 5srRNA (5S ribosomal RNA; as endogenous control of miRNA) according to manufacturer’s protocol. Quantitative polymerase chain reaction (qPCR) was done in triplicate, for each sample, on the Rotor-Gene Q instrument (Qiagen) using 2X Real-Time PCR Master Mix (Norgen, Canada). 2X SYBR Green master mix (5 µL), 1 µL of cDNA samples, 0.5 µL of each forward and reverse primers (2 pmol) and 3 µL of nuclease-free water (Norgen, Canada) were mingled in Strip Tubes and Caps, 0.1 mL (Qiagen) to perform PCR in a 10 µL reaction volume. The PCR amplifications were performed according to the following program for the thermal cycler instrument: an initial denaturing step for 2 min at 95ºC, followed by 40 cycles of denaturation at 95ºC and combined annealing/extension at 60ºC for 20 sec and 30 sec, respectively. 5srRNA was used as the reference for expression alterations comparison and the fold change in the expression of each target mRNA, relative to 5srRNA, was evaluated based on the 2−ΔΔct comparative expression Livak method (19).
The quantitative assay of mature miRNAs was carried out using the miR-Q method as described by Sharbati-Tehrani et al. (20) with sequence-specific oligonucleotide primers. Table 1 describes the utilized oligonucleotides. Briefly, 3 μL of miRNA cDNA products was added to master mix containing 1 μL MP primers (Fw + Rev), 1 μL short-miR-x and 5 μL of SYBR, in total volume of 10 μL. The qPCRs were executed in triplicate according to the standard program on Rotor-Gene Q instrument (QIAGEN, Germany). Thermal cycler was programmed to run according to the following conditions: 95ºC for 2 min followed by 40 cycles of denaturing at 95ºC for 15s and combined annealing-extension for 30 s at 60ºC. Moreover, a non-template control (NTC) reaction was employed for each primer set to guarantee the reaction specificity.
Table 1.Designed Oligonucleotides for the Target Sequences
NameSequence (5’ to 3’)
5S rRNA- FwGCCCGATCTCGTCTGATCT
5S rRNA-RevAGCCTACAGCACCCGGTATT
RT6-miR-638TGTCAGGCA ACCGTATTCACCGTGAGTAGGCCG
Short-miR-638CGTCAGATGTCCGAGTAGAGGGGGAACGGCAGGGATCGCGGGCGGGTGG
MP-FwTGTCAGGCAACCGTATTCACC
MP-RevCGTCAGATGTCCGAGTAGAGG

3.5. Bioinformatics Analysis

The study was carried out through bioinformatics methods and by using miRWalk, MicroRNA-Target Interactions (miRTarBase) database, and the database for annotation, visualization and integrated discovery (DAVID). MiRWalk2.0 database, that predicts miRNA-mRNA interactions, provided a list of more than a thousand genes. By using miRTarBase, prone genes were evaluated and compared with the previous list.
Then, by using the UniGene database, the expression of target mRNAs was analyzed in mammary gland cells to determine which mRNA is expressed in the mammary gland. Ultimately, to carry out signaling pathways enrichment analysis, miR-638 targetome expressed in mammary glands was included in the DAVID database 6.8. This database yields results obtained from pathway analyses performed by the Kyoto Encyclopedia of Genes and Genomes (KEGG) database to detect the molecular networks and signaling pathways including the most miR-638 targetome.

3.6. Statistical Analysis

The data obtained from real-time PCR were analyzed by using the ΔΔCT method in SPSS software version 25.0 (Chicago, IL, USA). Normal distribution of data was examined by the Shapiro-Wilk test. All tests were carried out in triplicate, and data were presented as mean [± standard error of measurement (SEM)]. Wilcoxon and Mann-Whitney U tests were used for analysis with SPSS (version 25.0) and GraphPad Prism (version 6.0) software. In all the tests, P value < 0.05 indicated a significant difference.

4. Results

4.1. Characteristics of Collected Samples

The study consisted of 47 breast tumor specimens and their paired non-cancerous samples. Information regarding clinicopathological factors and demographic characteristics such as age, tumor size, grade, stage, site of primary tumor, necrosis presence, vascular invasion, perineural invasion, family history, lymphatic invasion, and ductal carcinoma in situ (DCIS) have been described in Table 2. From the point of the tumor size, stage and grade, the majority of the tumors were less than 5 cm, stage 2 and grade 2, respectively. Most of the patients didn’t have a positive family history; however, their tumors had a vascular and lymphatic invasion.
Table 2.General Demographic Data of Study Participants
VariableValue
Tumor size (%)
< 3 cm17 (36.2)
≥ 3 to < 5 cm17 (36.2)
≥ 5cm13 (27.7)
Grade (%)
I4 (8.5)
II22 (46.8)
III21 (44.7)
Stage (%)
II32 (68.1)
III15 (31.9)
Site of primary tumor
Right Breast25 (53.2)
Left Breast18 (38.3)
Bilateral4 (8.5)
Necrosis presence
Yes21 (44.7)
No26 (55.3)
Vascular invasion
Yes30 (63.8)
No17 (36.2)
Perineural invasion
Yes15 (31.9)
No32 (68.1)
Family history
Yes15 (31.9)
No32 (68.1)
Lymphatic invasion
Yes27 (57.1)
No20 (42.6)
DCIS
Present36 (76.6)
Absent11 (23.4)

4.2. Expression of miR-638 in Breast Cancer Samples

Data showed that the expression of miR-638 in tumoral tissues decreased significantly, in comparison with their paired normal adjacent tissues (2.13 ± 0.82). Figure 1A shows the relative miR-638 expression in patients and the control group. Correlation analysis was conducted to find possible relations between the expression of miR-638 and the clinicopathological characteristics of the patients, including age, site of primary tumor, tumor size, grade, stage, and HER2 status (Table 3). A significant low expression of miR-638 was observed in the tumoral samples, in comparison with adjacent non-tumoral samples. Interestingly, with the progression of disease from stage 2 to stage 3, the expression level of miR-638 increased, which implicated cancer growth. As shown below, the mean expression of miR-638 in the stage II group was 0.67 ± 0.12, while in low tumor stage cluster was 1.14 ± 0.20 (P = 0.041; Figure 1B). Nevertheless, no significant association was observed in respect to age, site of primary tumor, tumor size, grade, and HER2 (Table 3).
Expression of miR-638 was evaluated by RT-qPCR in breast cancer tissues. A) According to the statistical analysis, miR-638 expression decreased in breast cancer tissue samples, compared with adjacent noncancerous tissue samples (Wilcoxon test). B) Differential expression of miR-638 in stage II and III of breast cancer patients. Values represent means and error bars represent the SEM (P &lt; 0.0001 and P &lt; 0.05 respectively).
Figure 1.

Expression of miR-638 was evaluated by RT-qPCR in breast cancer tissues. A) According to the statistical analysis, miR-638 expression decreased in breast cancer tissue samples, compared with adjacent noncancerous tissue samples (Wilcoxon test). B) Differential expression of miR-638 in stage II and III of breast cancer patients. Values represent means and error bars represent the SEM (P < 0.0001 and P < 0.05 respectively).

Table 3.Association of miR-638 Expression Levels and Clinicopathological Characteristics of Cancerous Breast Samples
FeaturemiR-638
Mean ± SEMP
Age
< 540.72 ± 0.150.196
≥ 540.93 ± 0.16
Site of primary tumor
Left0.98 ± 0.180.277
Right0.69 ± 0.14
Bilateral0.98 ± 0.48
Tumor size
< 3 cm0.83 ± 0.190.928
≥ 3 to < 5 cm0.78 ± 0.17
≥ 5cm0.19 ± 0.22
Grade
I1.01 ± 0.480.655
II0.73 ± 0.16
III0.89 ± 0.15
Stage
II0.67 ± 0.120.041
III1.14 ± 0.20
HER2
Positive1.18 ± 0.210.167
Negative0.74 ± 0.15

4.3. Signaling Pathway Enrichment Analysis of miR-638 Targetome

Molecular signaling pathway enrichment analysis was conducted to study the potential roles of miR-638 in the tumorigenesis and progression of breast cancer. All of the 1152 predicted mRNAs and 53 validated mRNAs which were obtained from miRWalk and miRTarBase respectively were targeted by miR-638. All the validated targets drawn from the miRTarBase database were confirmed by persuasive tests, such as western blot, quantitative real-time PCR, and reporter assay. Thirty-eight out of the 53 validated mRNAs (71%) were also observed in the list of predicted mRNAs, confirmed by at least five prediction databases, which demonstrated that the threshold of five databases is reliable to select predicted miR-638 targets. The targets’ expression profiles in the UniGene database revealed that only 38 out of the validated mRNA targets and 1018 out of the predicted ones were expressed in mammary gland cells. These targets were selected as miR-638 targetome for additional molecular enrichment analysis. Next, the selected miR-638 targetome was entered into the DAVID functional annotation to investigate whether the association of the entered genes with signaling pathways and biological terms was statistically significant. Findings from the miRWalk2.0 database and signaling pathways, which have been obtained from DAVID, indicated that the change in the expression level of miR-638 could deviate the cell from its original pathway by affecting cells’ target genes during apoptosis, autophagy, and angiogenesis (Figure 2). Table 4 displays the pathways obtained from the DAVID database and their P value.
Overview of signaling pathways and miR-638 target genes obtained from DAVID data base, marked with a star sign. Image taken from David’s database at https://david.ncifcrf.gov.
Figure 2.

Overview of signaling pathways and miR-638 target genes obtained from DAVID data base, marked with a star sign. Image taken from David’s database at https://david.ncifcrf.gov.

Table 4.The Signaling Paths Obtained from the DAVID Database and Their P-Value Derived from DAVID
KEGG PathwayP Value
MicroRNA in cancer4.3E-6
PI3K-Akt signaling pathway5.7E-4
Notch signaling pathway7.7E-4
Pathway in cancer2.1E-3
AMPk signaling pathway2.2E-3

5. Discussion

Recent studies have indicated that miRNAs play a crucial regulatory role in many cancers (21). Therefore, it can be deduced that miRNAs may have a promising and prominent prognostic and diagnostic value in different cancers, such as breast cancer (22). The data obtained from the present study showed that the expression level of miR-638 was down-regulated in breast cancer tissues compared to matched-tumor-adjacent tissues. Furthermore, reduced miR-638 expression was correlated with clinicopathological characteristics of breast cancer patients, including advanced stage. The expression level of miR-638 was higher in stage 3, compared with stage 2 (Figure 1B). Since the down-regulation of miR-638 occurred in lower stages, but not in higher stages, it may indicate that the need for more angiogenesis is the cause of the up-regulation of miR-638. From obtained results and bioinformatics data, it can be inferred that the low expression of miR-638 is associated with a decrease in apoptosis. Thus, it can be understood that the up-regulation of miR-638 in patients with breast cancer, is associated with poor prognosis; for this reason, this miRNA can be used as a potential prognostic biomarker.
Bioinformatics analysis revealed that dysregulation of miR-638 had a role in angiogenesis and the inhibition of autophagy. miR-638 has many target genes including ATG-5, ATG-2B, VEGF, TP53, and TRAF (23, 24). Apoptosis is a normal cellular process which leads to controlling the growth and development rate. Excessive activity of apoptosis causes diseases such as Alzheimer’s and Parkinson and if apoptosis rate is too little, it can lead to cancer (25). The genes involved in apoptosis have the potential to be regulated by microRNAs. In the apoptosis pathway, which was induced by miR-638, a change in the P53 protein was observed. TP53 is a tumor suppressor gene and mutations in this gene have been indicated in most of the human cancers. This gene plays an important role in suppressing the tumor, stopping the cell cycle, inducing apoptosis, and inhibiting angiogenesis (26).
The proteins that play a role in apoptosis pathway are divided into 2 groups: (i) anti-apoptotic proteins, which include Bcl-2 and TRAFs, and (ii) pro-apoptotic members that include BAX, and BAK. These proteins, by binding to the outer membrane of mitochondria and inhibition of pro-apoptotic family members, maintain the mitochondrial membrane and inhibit apoptosis (27) (Figure 3).
Genes involved in delaying cell death. The target genes of miR-638 are marked with a star (This image is captured from image 4).
Figure 3.

Genes involved in delaying cell death. The target genes of miR-638 are marked with a star (This image is captured from image 4).

Since tumor cells have fast and uncontrolled growth in comparison to normal cells, some of them that are far from blood vessels encounter with hypoxia or lack of oxygen. Therefore, angiogenesis begins inside and around the tumor to provide the oxygen needed for the cancer cells (28). VEGF is one of the most significant proteins in the angiogenesis process, and miR-638 alters its expression (18). Figure 4 shows the genes induced by miR-638 in the angiogenesis pathway.
The genes induced by miR-638 in the angiogenesis pathway. The target genes of miR-638 are marked with a star.
Figure 4.

The genes induced by miR-638 in the angiogenesis pathway. The target genes of miR-638 are marked with a star.

Bioinformatics analyses indicated that miR-638 exerts its effect through affecting ATG-5 and ATG-2B proteins, which play a role ‏in cellular autophagy. MiR-638 leads to autophagy inhibition by targeting the genes in the elongation phase. Further studies are needed to illustrate the effects of reducing the expression of miR-638 in autophagy. The findings of this study indicate how miR-638 affects intracellular pathways, including autophagy and angiogenesis, which lead to the progression of breast cancer.
Our results and bioinformatics analysis showed that downregulation of miR-638 may be associated with a good prognosis in breast cancer, because with decreases in miR-638 expression level, we observed the overexpression of ATG-5 and TP53 genes, which are involved in autophagy and apoptosis, respectively.
In line with our study, Zhang et al. observed that miR-638 expression was reduced in colorectal cancer tissues, in comparison to their adjacent normal tissues (15). On the other hand, the mean expression level of miR-638 was significantly up-regulated in prostate and kidney cancers (29). Taken together, it can be suggested that miR-638 may have a potential prognostic role in breast cancer patients.

5.1. Conclusions

The results of the present study indicate a significant expression pattern difference of miR-638 in breast tumor specimens and their paired non-cancerous samples. Our findings showed that miR-638 was down-regulated in cancerous samples and was associated with higher stages. We conducted bioinformatics research to reach the target genes of miR-638, which can have the greatest impact on the pathways leading to cancer progression, and the possibility of using this miRNA in cancer prognosis. These results demonstrate that miR-638 might serve as a potential prognostic biomarker; however, more investigation is needed.

Acknowledgments

Footnotes

References

  • 1.
    Siegel RL, Miller KD, Jemal A. Cancer statistics, 2017. CA Cancer J Clin. 2017;67(1):7-30. [PubMed ID: 28055103]. https://doi.org/10.3322/caac.21387.
  • 2.
    Li S, Yang X, Yang J, Zhen J, Zhang D. Serum microRNA-21 as a potential diagnostic biomarker for breast cancer: A systematic review and meta-analysis. Clin Exp Med. 2016;16(1):29-35. [PubMed ID: 25516467]. https://doi.org/10.1007/s10238-014-0332-3.
  • 3.
    Mo MH, Chen L, Fu Y, Wang W, Fu SW. Cell-free circulating miRNA biomarkers in cancer. J Cancer. 2012;3:432-48. [PubMed ID: 23074383]. [PubMed Central ID: PMC3471083]. https://doi.org/10.7150/jca.4919.
  • 4.
    Rebbeck TR, Burns-White K, Chan AT, Emmons K, Freedman M, Hunter DJ, et al. Precision prevention and early detection of cancer: Fundamental principles. Cancer Discov. 2018;8(7):803-11. [PubMed ID: 29907587]. https://doi.org/10.1158/2159-8290.CD-17-1415.
  • 5.
    Heneghan HM, Miller N, Lowery AJ, Sweeney KJ, Newell J, Kerin MJ. Circulating microRNAs as novel minimally invasive biomarkers for breast cancer. Ann Surg. 2010;251(3):499-505. [PubMed ID: 20134314]. https://doi.org/10.1097/SLA.0b013e3181cc939f.
  • 6.
    Qu H, Xu W, Huang Y, Yang S. Circulating miRNAs: Promising biomarkers of human cancer. Asian Pac J Cancer Prev. 2011;12(5):1117-25. [PubMed ID: 21875254].
  • 7.
    Iorio MV, Casalini P, Tagliabue E, Menard S, Croce CM. MicroRNA profiling as a tool to understand prognosis, therapy response and resistance in breast cancer. Eur J Cancer. 2008;44(18):2753-9. [PubMed ID: 19022662]. https://doi.org/10.1016/j.ejca.2008.09.037.
  • 8.
    Lowery AJ, Miller N, McNeill RE, Kerin MJ. MicroRNAs as prognostic indicators and therapeutic targets: Potential effect on breast cancer management. Clin Cancer Res. 2008;14(2):360-5. [PubMed ID: 18223209]. https://doi.org/10.1158/1078-0432.CCR-07-0992.
  • 9.
    Zavala V, Perez-Moreno E, Tapia T, Camus M, Carvallo P. miR-146a and miR-638 in BRCA1-deficient triple negative breast cancer tumors, as potential biomarkers for improved overall survival. Cancer Biomark. 2016;16(1):99-107. [PubMed ID: 26835710]. https://doi.org/10.3233/CBM-150545.
  • 10.
    Nicoloso MS, Sun H, Spizzo R, Kim H, Wickramasinghe P, Shimizu M, et al. Single-nucleotide polymorphisms inside microRNA target sites influence tumor susceptibility. Cancer Res. 2010;70(7):2789-98. [PubMed ID: 20332227]. [PubMed Central ID: PMC2853025]. https://doi.org/10.1158/0008-5472.CAN-09-3541.
  • 11.
    Zhao LY, Yao Y, Han J, Yang J, Wang XF, Tong DD, et al. miR-638 suppresses cell proliferation in gastric cancer by targeting Sp2. Dig Dis Sci. 2014;59(8):1743-53. [PubMed ID: 24623314]. https://doi.org/10.1007/s10620-014-3087-5.
  • 12.
    Sand M, Skrygan M, Sand D, Georgas D, Hahn SA, Gambichler T, et al. Expression of microRNAs in basal cell carcinoma. Br J Dermatol. 2012;167(4):847-55. [PubMed ID: 22540308]. https://doi.org/10.1111/j.1365-2133.2012.11022.x.
  • 13.
    Tan X, Peng J, Fu Y, An S, Rezaei K, Tabbara S, et al. miR-638 mediated regulation of BRCA1 affects DNA repair and sensitivity to UV and cisplatin in triple-negative breast cancer. Breast Cancer Res. 2014;16(5):435. [PubMed ID: 25228385]. [PubMed Central ID: PMC4303116]. https://doi.org/10.1186/s13058-014-0435-5.
  • 14.
    Xia Y, Wu Y, Liu B, Wang P, Chen Y. Downregulation of miR-638 promotes invasion and proliferation by regulating SOX2 and induces EMT in NSCLC. FEBS Lett. 2014;588(14):2238-45. [PubMed ID: 24842609]. https://doi.org/10.1016/j.febslet.2014.05.002.
  • 15.
    Zhang J, Fei B, Wang Q, Song M, Yin Y, Zhang B, et al. MicroRNA-638 inhibits cell proliferation, invasion and regulates cell cycle by targeting tetraspanin 1 in human colorectal carcinoma. Oncotarget. 2014;5(23):12083-96. [PubMed ID: 25301729]. [PubMed Central ID: PMC4322991]. https://doi.org/10.18632/oncotarget.2499.
  • 16.
    Zhu DX, Zhu W, Fang C, Fan L, Zou ZJ, Wang YH, et al. miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis. 2012;33(7):1294-301. [PubMed ID: 22610076]. https://doi.org/10.1093/carcin/bgs179.
  • 17.
    Bhattacharya A, Schmitz U, Raatz Y, Schonherr M, Kottek T, Schauer M, et al. miR-638 promotes melanoma metastasis and protects melanoma cells from apoptosis and autophagy. Oncotarget. 2015;6(5):2966-80. [PubMed ID: 25650662]. [PubMed Central ID: PMC4413631]. https://doi.org/10.18632/oncotarget.3070.
  • 18.
    Cheng J, Chen Y, Zhao P, Liu X, Dong J, Li J, et al. Downregulation of miRNA-638 promotes angiogenesis and growth of hepatocellular carcinoma by targeting VEGF. Oncotarget. 2016;7(21):30702-11. [PubMed ID: 27120793]. [PubMed Central ID: PMC5058711]. https://doi.org/10.18632/oncotarget.8930.
  • 19.
    Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. [PubMed ID: 11846609]. https://doi.org/10.1006/meth.2001.1262.
  • 20.
    Sharbati-Tehrani S, Kutz-Lohroff B, Bergbauer R, Scholven J, Einspanier R. miR-Q: A novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sample. BMC Mol Biol. 2008;9:34. [PubMed ID: 18400113]. [PubMed Central ID: PMC2374797]. https://doi.org/10.1186/1471-2199-9-34.
  • 21.
    Peng Y, Croce CM. The role of MicroRNAs in human cancer. Signal Transduct Target Ther. 2016;1:15004. [PubMed ID: 29263891]. [PubMed Central ID: PMC5661652]. https://doi.org/10.1038/sigtrans.2015.4.
  • 22.
    Bertoli G, Cava C, Castiglioni I. MicroRNAs: New biomarkers for diagnosis, prognosis, therapy prediction and therapeutic tools for breast cancer. Theranostics. 2015;5(10):1122-43. [PubMed ID: 26199650]. [PubMed Central ID: PMC4508501]. https://doi.org/10.7150/thno.11543.
  • 23.
    Tchernitsa O, Kasajima A, Schafer R, Kuban RJ, Ungethum U, Gyorffy B, et al. Systematic evaluation of the miRNA-ome and its downstream effects on mRNA expression identifies gastric cancer progression. J Pathol. 2010;222(3):310-9. [PubMed ID: 20726036]. https://doi.org/10.1002/path.2759.
  • 24.
    Ueda T, Volinia S, Okumura H, Shimizu M, Taccioli C, Rossi S, et al. Relation between microRNA expression and progression and prognosis of gastric cancer: A microRNA expression analysis. Lancet Oncol. 2010;11(2):136-46. [PubMed ID: 20022810]. [PubMed Central ID: PMC4299826]. https://doi.org/10.1016/S1470-2045(09)70343-2.
  • 25.
    Offen D, Elkon H, Melamed E. Apoptosis as a general cell death pathway in neurodegenerative diseases. J Neural Transm Suppl. 2000;(58):153-66. [PubMed ID: 11128605]. https://doi.org/10.1007/978-3-7091-6284-2_13.
  • 26.
    Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science. 1994;265(5170):346-55. [PubMed ID: 8023157]. https://doi.org/10.1126/science.8023157.
  • 27.
    Liu XH, Yao S, Kirschenbaum A, Levine AC. NS398, a selective cyclooxygenase-2 inhibitor, induces apoptosis and down-regulates bcl-2 expression in LNCaP cells. Cancer Res. 1998;58(19):4245-9. [PubMed ID: 9766645].
  • 28.
    Carmeliet P, Jain RK. Principles and mechanisms of vessel normalization for cancer and other angiogenic diseases. Nat Rev Drug Discov. 2011;10(6):417-27. [PubMed ID: 21629292]. https://doi.org/10.1038/nrd3455.
  • 29.
    Tay Y, Tan SM, Karreth FA, Lieberman J, Pandolfi PP. Characterization of dual PTEN and p53-targeting microRNAs identifies microRNA-638/Dnm2 as a two-hit oncogenic locus. Cell Rep. 2014;8(3):714-22. [PubMed ID: 25088422]. [PubMed Central ID: PMC4128194]. https://doi.org/10.1016/j.celrep.2014.06.064.

Similar Articles

11
Jul
2018

MiR-206 Target Prediction in Breast Cancer Subtypes by Bioinformatics Tools

Mahnaz Seifi-Alan,
Roshanak Shamsi,
Ali Behmanesh,
Reza Mirfakhraie,
Mir Davood Omrani,
Soudeh Ghafouri-Fard
9
Feb
2022

Analysis of Blood and Tissue miR-191, miR-22, and EGFR mRNA as Novel Biomarkers for Breast Cancer Diagnosis

Arezo Shahi,
Naghmeh Bahrami,
Robab Rafiei Tabatabaei,
Mehdi Kazempour Dizaji,
Hamidreza Jamaati,
Abdolreza Mohamadnia

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles