Jentashapir J Cell Mol Biol

Image Credit:Jentashapir J Cell Mol Biol

High Expression of TWIST-1 in the Chronic Myeloid Leukemia Patients with T315I Mutation

Author(s):
Nazanin HeidariNazanin Heidari1,*, Fatemeh  NorooziFatemeh Noroozi1, Najmaldin SakiNajmaldin Saki1,**
1Thalassemia & Hemoglobinopathy Research Center, Research Institute of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
Corresponding Authors:

Jentashapir Journal of Cellular and Molecular Biology:Vol. 12, issue 3; e118718
Published online:Sep 10, 2021
Article type:Research Article
Received:Aug 21, 2021
Accepted:Aug 29, 2021
How to Cite:Heidari N, Noroozi F, Saki N. High Expression of TWIST-1 in the Chronic Myeloid Leukemia Patients with T315I Mutation. Jentashapir J Cell Mol Biol. 2021;12(3):e118718. doi: https://doi.org/10.5812/jjcmb.118718

Abstract

Background:

Among the known ABL mutations in chronic myeloid leukemia (CML), T315I is of particular importance. The T315I mutation may develop resistant cells that increase disease progression. TWIST-1 expression is impaired in patients with increased drug resistance.

Objectives:

The current study aimed to measure the expression of TWIST-1 gene in CML patients to investigate its association with T315I mutation.

Methods:

Peripheral blood samples were taken from 40 CML patients. The expression of TWIST-1 and BCR-ABL1 genes was quantified by real-time polymerase chain reaction (PCR). The gene expression was evaluated by REST software. cDNA was used for amplification refractory mutation system (ARMS)-PCR reaction.

Results:

Of the 40 patients (age range: 19 - 72 years) participating in the study, 23 (57.7%) were female, and 17 (42.5%) were male. The expression of TWIST-1 gene was 43 ± 184.09-fold. The T315I mutation was detected in 3 (7.5%) patients.

Conclusions:

According to our results, the TWIST-1 gene expression in patients with T315I mutation was significantly higher than patients without that mutation.

1. Background

Chronic myelogenous leukemia (CML) is a clonal proliferative disorder caused by the neoplastic alteration of pluripotent stem cells, which results in the overproduction of granulocytes. The hallmark of this leukemia is the Philadelphia chromosome (9; 22) (q34; q11) (1). The BCR/ABL fusion protein plays a significant role in the blast crisis of this type of leukemia. Increased expression of BCR/ABL leads to CML cell malignancy and their resistance to antitumors and apoptosis inducers (2). If the CML cells undergo further changes, the disease becomes invasive (3). Among the known ABL mutations in CML, T315I is of particular importance. This mutation was most common in patients receiving imatinib (2). The T315I mutation can be detected using molecular techniques in the chronic CML phase, which may develop resistant cells that increase disease progression. It should be noted that the T315I mutation does not necessarily cause resistance and can also be detected in tyrosine kinase inhibitor (TKI)-sensitive patients (4).
Reports indicated that TWIST-1 expression is impaired in cancers and patients with increased drug resistance (5). This protein is also one of the prognostic factors of leukemogenesis, and its expression is increased in CML patients who have cytogenetic resistance to imatinib (6). Accordingly, since no study has examined the association between T315I mutation and TWIST-1 expression so far, the present study was designed to evaluate the relationship between TWIST-1 gene expression and T315I mutation in CML patients.

2. Methods

2.1. Patients and Samples

Peripheral blood samples were taken from 40 CML patients (by census method) referred to the laboratory for their follow-up in the period of October 2015-January 2016. Also, 10 healthy controls participated in the study. Sampling was performed after receiving an informed written consent from the patients and with the agreement of the attending physician. The study was approved by the Ethical Committee of Ahvaz Jundishapur University of Medical Sciences (Ref. ID: IR.AJUMS.REC.1394.343). To minimize interference, patients who had a history of other disorders, including JAK2+ and P190 were excluded from the study.

2.2. Reverse Transcription-Polymerase Chain Reaction

Mononuclear peripheral blood cells were isolated by Ficoll-Paque (Lymphodex, inno-train, Germany) centrifugation. The isolation of DNA from PB was performed by Qiagen kit (Germany). DNA was spectrophotometrically evaluated at 260 nm. Then, mutational screening was conducted by direct sequencing technique using two sets of primers casing the Abl kinase domain.
RNA was extracted by Ribo-Prep kit (Russia). Then cDNA products of TWIST-1 gene were amplified by PCR in the subsequent settings: initial denaturation for 2 min at 95°C, 10 s at 95°C, 20 s at 60°C, 40 cycles, and extension for 20 s at 72°C. Reaction system contained within 0.5 µL PCR Forward primer 10 pM, 0.5 µL PCR Reverse primer10 pM, 2 µL template cDNA 80 ng/μL, 11 µL SYBR Green (Takara, Korea), and 8 µL DEPC.
The primers were used in this way: ABL1-ex6-Forward (F): 5′-AGTCTCAGGATGCAGGTGCT-3′; ABL1-ex6-Reverse (R): 5′-AATGTGTTGCCAGCACTGAG-3′; TWIST-1 Forward primer: 5’ GGC-TCA-GCT-ACG-CCT-TCT-C 3’; TWIST-1 Reverse primer: 5’ CCTTCTCTGGAAACAATGACATCT 3’

2.3. Amplification Refractory Mutation System (ARMS)-PCR Reaction

cDNA was used for ARMS-PCR reaction. The subsequent specific primers were used in this method: ABL kinase Forward (F): 5′-CGCAACAAGCCCACTGTCT-3′; ABL Kinase Reverse (R): 5′-TCCACTTCGTCTGAGATACTGGATT-3′ and AS-T315: 5′ CGTAGGTCATGAACTCAA-3′. 25 mL PCR reaction mixture contained 5 mL 10 buffer, 2 mL dNTP, 1 mL each primer, 3 mL MgCl2 (50mM), 0.3 mL Taq polymerase Enzyme, 9.7 mL DW, and 2 mL cDNA. The thermal cycling settings were: 5 min at 95°C for 1 cycle, 30 s at 95°C, 30s at 67°C, 40 s at 72°C followed by 35 cycles and 5 min at 72°C performed at 1 cycle.

2.4. Statistical Analysis

Data of RT-PCR data was performed using REST Software (2009, QIAGEN, Valencia, USA). Spearman’s rho test was used to evaluate the relationship between quantitative data. For assessing the differences between three groups of CML patients, Kruskal-Wallis method was used. P < 0.05 was reflected as the significance level.

3. Results

Of the 40 patients (age range: 19 - 72 years) participating in the study, 23 (57.7%) were female, and 17 (42.5%) were male. The patients were divided into three groups: optimal (55 %), warning (12.5 %), and failure (32.5 %) of response to treatment (according to ELN criteria). The mean ± SD (min-max) of WBC, Hb, and Plt were 18 ± 37 (3 - 190) 103/mm3, 11 ± 2 (8 - 17) gr/dL, and 210 ± 62 (60 - 457)103/mm3, respectively (Table 1).
Table 1.Patient’s Data a
VariableMean ± SD
WBC, 103/mm318 ± 37
Hb, gr/dL11 ± 2
Plt, 103/mm3210 ± 62
Treatment group
Optimal22 (55)
Warning5 (12.5)
Failure13 (32.5)
BCR-ABL1, fold7 ± 19
TWIST-1, fold43 ± 184.09
T315I mutation3 (7.5)

aValues are expressed as mean ± SD and No. (%).

The T315I mutation was detected in 3 (7.5 %) patients. Of these, one patient was in the optimal treatment response group (4.76%) and two patients in the failure treatment response group (15.38%).
The expression of TWIST-1 gene was 43 ± 184.09-fold with min and max of 0.006 and 1140.07, respectively. The BCR-ABL1 fusion gene expression in CML patients was 7 ± 19-fold with min and max of 0.0001 and 100-fold, respectively. The means of TWIST-1 gene expressions in groups of optimal, warning, and failure were 8.66 ± 14.31, 23.5 ± 50.59, and 102.19 ± 307.81-fold, respectively (P = 0.889). The means of BCR-ABL1 expressions in optimal, warning, and failure groups were 0.51 ± 2.07, 0.4 ± 0.13, and 20.85 ± 29.46, respectively. The TWIST-1 gene expressions in patients with and without T315I mutation were 401.2 ± 648.55 and 14.23 ± 42.49-fold, respectively (P = 0.02). The TWIST-1 gene expression in patients with T315I mutation was significantly higher than patients without that mutation.

4. Discussion

CML is a chronic myeloproliferative disease caused by specific mutations in multinucleated bone marrow stem cells (7). P210 BCR-ABL plays a key role in the pathogenesis of this disorder by interfering with several molecules regulating cell survival, proliferation, and differentiation (8). So far, various mechanisms have been identified for resistance to imatinib, including amplification of the BCR gene, mutations at the site of kinase action, and alternative signaling pathways that functionally replace imatinib-sensitive mechanisms (9-11). TWIST-1 acts at the onset of malignancy by counteracting apoptosis and at the progression of malignancy by increasing resistance to treatment (12).
In our study, 3 (7.5%) patients had T315I mutation, of whom one was in the optimal response to treatment (4.76%), and two were in the failure response to treatment group (15.38%). A study by Chahardouli et al. reported that the frequency of this mutation in patients with CML was 7% (3). Another study conducted in Malaysia reported this rate as 5.26% (13). In Kagita et al.’s study on imatinib-resistant CML patients, the highest mutations observed in these patients were related to the T315I mutation (19.04%) (14). Therefore, T315I mutation is associated with resistance to treatment, and according to Mat Yusoff et al., the diagnosis of this mutation in CML patients is clinically useful in selecting appropriate treatment strategies to prevent disease progression (13). The same is true for acute lymphocytic leukemia (ALL). Watanabe et al. reported that the presence of T315I mutation in Ph + ALL patients is associated with a very invasive phenotype of disease and resistance to TKIs. They maintained that the identification of this mutation in advanced cases and non-response to treatment are important and indicate the need to change treatment (15).
In the present study, we studied the expression of TWIST-1 gene in CML patients. This expression increased in failure response to treatment compared to optimal and warning responses, but the difference was not significant. Cosset et al. reported that the increase in TWIST-1 expression was specific to TKI-resistant patients (6). Yuan et al. found that increased TWIST-1 expression raised resistance to treatment by increasing PI3K/AKT expression in patients with CML (16). Another study reported that TWIST-1 initiates cell growth, colony formation, and drug resistance of AML and CML cell lines (17). K562/A02 may be the cause of cell line survival with multidrug resistance (18). Therefore, further studies are required to evaluate the expression of this gene in CML patients and in different response groups.
According to the results of this study, there was a significant correlation between the expression of TWIST-1 gene expression and the presence of T315I mutation. The TWIST-1 gene expression in patients with T315I mutation was significantly higher than patients without that mutation. The present study was the first to examine this association. Further studies are needed for evaluating this relationship.

4.1. Conclusions

According to our study, the TWIST-1 gene expression in patients with T315I mutation was significantly higher than patients without that mutation.

Footnotes

References

  • 1.
    Hehlmann R, Hochhaus A, Baccarani M, European L. Chronic myeloid leukaemia. Lancet. 2007;370(9584):342-50. [PubMed ID: 17662883]. https://doi.org/10.1016/S0140-6736(07)61165-9.
  • 2.
    Ding K, Su Y, Pang L, Lu Q, Wang Z, Zhang S, et al. Inhibition of apoptosis by downregulation of hBex1, a novel mechanism, contributes to the chemoresistance of Bcr/Abl+ leukemic cells. Carcinogenesis. 2009;30(1):35-42. [PubMed ID: 19028701]. https://doi.org/10.1093/carcin/bgn251.
  • 3.
    Chahardouli B, Zaker F, Mousavi SA, Kazemi A, Ostadali M, Nadali F, et al. Evaluation of T315I mutation frequency in chronic myeloid leukemia patients after imatinib resistance. Hematology. 2013;18(3):158-62. [PubMed ID: 23540562]. https://doi.org/10.1179/1607845412Y.0000000050.
  • 4.
    Willis SG, Lange T, Demehri S, Otto S, Crossman L, Niederwieser D, et al. High-sensitivity detection of BCR-ABL kinase domain mutations in imatinib-naive patients: correlation with clonal cytogenetic evolution but not response to therapy. Blood. 2005;106(6):2128-37. [PubMed ID: 15914554]. https://doi.org/10.1182/blood-2005-03-1036.
  • 5.
    Man TK, Chintagumpala M, Visvanathan J, Shen J, Perlaky L, Hicks J, et al. Expression profiles of osteosarcoma that can predict response to chemotherapy. Cancer Res. 2005;65(18):8142-50. [PubMed ID: 16166288]. https://doi.org/10.1158/0008-5472.CAN-05-0985.
  • 6.
    Cosset E, Hamdan G, Jeanpierre S, Voeltzel T, Sagorny K, Hayette S, et al. Deregulation of TWIST-1 in the CD34+ compartment represents a novel prognostic factor in chronic myeloid leukemia. Blood. 2011;117(5):1673-6. [PubMed ID: 21123820]. https://doi.org/10.1182/blood-2009-11-254680.
  • 7.
    Clark D. The chronic lymphoid and myeloid leukemia and sustained mastocytosis. 2003.
  • 8.
    Quintas-Cardama A, Cortes J. Molecular biology of bcr-abl1-positive chronic myeloid leukemia. Blood. 2009;113(8):1619-30. [PubMed ID: 18827185]. [PubMed Central ID: PMC3952549]. https://doi.org/10.1182/blood-2008-03-144790.
  • 9.
    Chvez-Gonzlez A, Avils-Vzquez S, Moreno Lorenzana D, Mayani H. Hematopoietic Stem Cells in Chronic Myeloid Leukemia. Stem Cell Biology in Normal Life and Diseases. 2013. https://doi.org/10.5772/54651.
  • 10.
    le Coutre P, Tassi E, Varella-Garcia M, Barni R, Mologni L, Cabrita G, et al. Induction of resistance to the Abelson inhibitor STI571 in human leukemic cells through gene amplification. Blood. 2000;95(5):1758-66. [PubMed ID: 10688835].
  • 11.
    Ernst T, Hoffmann J, Erben P, Hanfstein B, Leitner A, Hehlmann R, et al. ABL single nucleotide polymorphisms may masquerade as BCR-ABL mutations associated with resistance to tyrosine kinase inhibitors in patients with chronic myeloid leukemia. Haematologica. 2008;93(9):1389-93. [PubMed ID: 18603549]. https://doi.org/10.3324/haematol.12964.
  • 12.
    Merindol N, Riquet A, Szablewski V, Eliaou JF, Puisieux A, Bonnefoy N. The emerging role of Twist proteins in hematopoietic cells and hematological malignancies. Blood Cancer J. 2014;4. e206. [PubMed ID: 24769647]. [PubMed Central ID: PMC4003416]. https://doi.org/10.1038/bcj.2014.22.
  • 13.
    Mat Yusoff Y, Abu Seman Z, Othman N, Kamaluddin NR, Esa E, Zulkiply NA, et al. Prevalence of BCR-ABL T315I mutation in malaysian patients with imatinib-resistant chronic myeloid leukemia. Asian Pac J Cancer Prev. 2018;19(12):3317-20. [PubMed ID: 30583336]. [PubMed Central ID: PMC6428553]. https://doi.org/10.31557/APJCP.2018.19.12.3317.
  • 14.
    Kagita S, Uppalapati S, Jiwatani S, Linga VG, Gundeti S, Nagesh N, et al. Incidence of Bcr-Abl kinase domain mutations in imatinib refractory chronic myeloid leukemia patients from South India. Tumour Biol. 2014;35(7):7187-93. [PubMed ID: 24763825]. https://doi.org/10.1007/s13277-014-1926-9.
  • 15.
    Watanabe K, Minami Y, Ozawa Y, Miyamura K, Naoe T. T315I mutation in Ph-positive acute lymphoblastic leukemia is associated with a highly aggressive disease phenotype: three case reports. Anticancer Res. 2012;32(5):1779-83. [PubMed ID: 22593461].
  • 16.
    Yuan R, Chang J, He J. Effects of Twist1 on drug resistance of chronic myeloid leukemia cells through the PI3K/AKT signaling pathway. Cell Mol Biol (Noisy-le-grand). 2020;66(6):81-5. [PubMed ID: 33040790].
  • 17.
    Wang N, Guo D, Zhao YY, Dong CY, Liu XY, Yang BX, et al. TWIST-1 promotes cell growth, drug resistance and progenitor clonogenic capacities in myeloid leukemia and is a novel poor prognostic factor in acute myeloid leukemia. Oncotarget. 2015;6(25):20977-92. [PubMed ID: 26023795]. [PubMed Central ID: PMC4673244]. https://doi.org/10.18632/oncotarget.4007.
  • 18.
    Xin H, Kong Y, Jiang X, Wang K, Qin X, Miao ZH, et al. Multi-drug-resistant cells enriched from chronic myeloid leukemia cells by Doxorubicin possess tumor-initiating-cell properties. J Pharmacol Sci. 2013;122(4):299-304. [PubMed ID: 23903006]. https://doi.org/10.1254/jphs.13025fp.

Similar Articles

27
May
2015

Characterizing of Four Common BCR-ABL Kinase Domain Mutations (T315I, Y253H, M351T and E255K) in Iranian Chronic Myelogenous Leukemia Patients With Imatinib Resistance

Leili Rejali,
Behzad Poopak,
Mandana Hasanzad,
Fatemeh Sheikhsofla,
Ameneh Saadat Varnoosfaderani,
Nazila Safari
,et al.

Rejali L, Poopak B, Hasanzad M, Sheikhsofla F, Varnoosfaderani AS, et al. Characterizing of Four Common BCR-ABL Kinase Domain Mutations (T315I, Y253H, M351T and E255K) in Iranian Chronic Myelogenous Leukemia Patients With Imatinib Resistance. Int J Cancer Manag. 2015;8(3):e2334. doi: https://doi.org/10.17795/ijcp2334

22
Feb
2016

New Developments in Chronic Myeloid Leukemia: Implications for Therapy

Sanaz Tabarestani,
Abolfazl Movafagh

Tabarestani S, Movafagh A. New Developments in Chronic Myeloid Leukemia: Implications for Therapy. Int J Cancer Manag. 2016;9(1):e3961. doi: https://doi.org/10.17795/ijcp-3961

31
Mar
2012

Screening of C-kit gene Mutation in Acute Myeloid Leukaemia in Northern India

SR Hussain,
Seyed Tasleem Raza,
SG Babu,
P Singh,
H Naqvi,
F Mahdi

Hussain S, Raza ST, Babu S, Singh P, Naqvi H, et al. Screening of C-kit gene Mutation in Acute Myeloid Leukaemia in Northern India. Int J Cancer Manag. 2012;5(1):e80795. doi:

29
Sep
2025
Int J Cancer Manag

Prognostic Value of KMT2A and Downstream Gene Expression in AML Patients Undergoing Allogeneic Hematopoietic Stem Cell Transplantation

Sara Zehtabcheh,
Sahar Parkhideh,
Mahshid Mehdizadeh,
Mohammad Hossein Mohammadi,
Davood Bashash

Zehtabcheh S, Parkhideh S, Mehdizadeh M, Mohammadi MH, Bashash D. Prognostic Value of KMT2A and Downstream Gene Expression in AML Patients Undergoing Allogeneic Hematopoietic Stem Cell Transplantation. Int J Cancer Manag. 2025;18(1):e165616. doi: https://doi.org/10.5812/ijcm-165616

10
Mar
2020
International Journal of Cancer Management

Contribution Value of Akt, c-Myc, CIP2A, and PP2A Genes Expression in Leukemogenesis: A Bright Perspective on the Molecular Pattern of Patients with Acute Myeloid Leukemia (AML)

Mohammad Sayyadi,
Ava Safaroghli-Azar,
Somayeh Rabiemajd,
Mojtaba Didehdar,
Hassan Abolghasemi,
Ali Arash Anoushirvani
,et al.

Sayyadi M, Safaroghli-Azar A, Rabiemajd S, Didehdar M, Abolghasemi H, et al. Contribution Value of Akt, c-Myc, CIP2A, and PP2A Genes Expression in Leukemogenesis: A Bright Perspective on the Molecular Pattern of Patients with Acute Myeloid Leukemia (AML). Int J Cancer Manag. 2020;13(3):e100223. doi: https://doi.org/10.5812/ijcm.100223


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles