Jentashapir J Cell Mol Biol

Image Credit:Jentashapir J Cell Mol Biol

Genome-wide Identification of HvPP2C Genes and Expression Profiling in Response to Cold and Heat Stresses in Barley (Hordeum vulgare L.)

Author(s):
Zohreh HajibaratZohreh Hajibarat1, Abbas SaidiAbbas Saidi1,*
1Department of Plant Sciences and Biotechnology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran

Jentashapir Journal of Cellular and Molecular Biology:Vol. 14, issue 3; e135719
Published online:Oct 01, 2023
Article type:Research Article
Received:Feb 22, 2023
Accepted:Sep 10, 2023
How to Cite:Hajibarat Z, Saidi A. Genome-wide Identification of HvPP2C Genes and Expression Profiling in Response to Cold and Heat Stresses in Barley (Hordeum vulgare L.). Jentashapir J Cell Mol Biol. 2023;14(3):e135719. doi: https://doi.org/10.5812/jjcmb-135719

Abstract

Background:

Protein phosphatases (PP2Cs) are the main classes of protein phosphatases in plants, having pivotal functions in different plant stages and abiotic stresses. The PP2C genes are suggested to have critical roles in barley by exposure to heat and cold treatments.

Objectives:

We surveyed HvPP2C genes from the barley genome in the present study. Phylogenetic analysis, functional annotation, synteny analysis, chromosomal distribution, prediction of cis-elements, and gene expression of HvPP2Cs under abiotic stresses were studied.

Methods:

In this study, HvPP2Cs of barley were surveyed using bioinformatics tools, and HvPP2C gene expression profiles under cold and heat stresses in 3 tissues (root, leaf, and stem) were analyzed.

Results:

In this study, 61 HvPP2C genes were detected from barley, and a phylogenetic tree was divided into 13 subfamilies. The results of chromosomal distribution showed that the HvPP2C genes were located on 7 chromosomes. Real-time quantitative reverse transcription PCR (qRT-PCR) analysis of HvPP2Cs showed that they were largely expressed in different tissues (root, stem, and leaf) in the Azaran and Jolge barley cultivars. In Azaran, the HvPP2C gene expression increased in response to cold stress, whereas, in the Jolge cultivar, the HvPP2C gene expression increased in response to heat stress. The analysis of synteny revealed that HvPP2C24b with HvPP2C24a, HvPP2C24 with HvPP2C24a and HvPP2C24b; HvPP2C5 with HvPP2C5a, and HvPP2C41 with HvPP2C41a were paralogous.

Conclusions:

Results revealed a broad understanding of the HvPP2C gene family in barley, which can be valuable for the functional description of HvPP2Cs in plant response to abiotic stresses.

1. Background

Phosphorylation and dephosphorylation of proteins are vital post-translational modifications, acting as a reversible change to control different functions of proteins, such as protein-protein interaction and protein localization in response to different stresses such as drought, salt, and cold (1). It is indispensable to probe into the identification and functional description of the PP2C gene family, cementing the base for understanding its essential molecular mechanism in stress signaling (2, 3). Protein phosphorylation is one of the important steps that helps regulate some physiological and biochemical reactions. PPs carry out dephosphorylation. Plant protein phosphatase 2Cs (PP2Cs) are important in plant hormone signaling, growth processes, and environmental stress responses (4). The high proportion of PP2C genes reveals their evolutionary consequence, prerequisite, and participation in various plant and cellular functions. For instance, it is demonstrated that TaPP2C genes are associated with wheat's developmental stages and stress responses (5). The high proportion of PP2C genes indicates their evolutionary significance, requirement, and involvement in diverse plant cellular functions (6). The PP2C genes have been termed a regulator of water deficit tolerance and act as a negative regulator in the ABA-signaling in plants (7). Transgenic studies confirmed the expression level of the ZmPP2C10 gene as a negative regulator in drought stress tolerance in maize (5). Evaluating two mutants, abi1-1 and abi2-1, indicated that two PP2C genes are involved in different physiological processes after exposure to abiotic stimuli containing salt, drought, and cold (8).
Gene duplication, critical for gene family development, is considered a type of genome expansion formed through block and tandem duplication (9). Paralogous gene pairs located on the same chromosome are considered as tandem duplication. Gene duplicates are prevalent in plants and, in some cases, contribute to evolutionary novelty. Gene duplication allows the detection of paralogs, where their presence in the genome leads to identifying the gene family.

2. Objectives

This study identified 61 HvPP2C genes from the barley genome and grouped them into 12 subfamilies. Comprehensive analyses of functional annotation, gene duplications, chromosomal distribution, and phylogeny of these HvPP2Cs were further carried out. To validate in silico analysis, their expression profiles were also investigated by qRT-PCR under cold and heat treatments in 3 different tissues (root, stem, leaf). The results presented here provide a foundation for further functional characterization of HvPP2C genes in this model species.

3. Methods

3.1. Physicochemical Characteristics, Functional Annotation, Phylogenetic Analysis, and Chromosomal Distribution of the HvPP2C Genes

As explained earlier, two techniques were utilized to detect putative HvPP2C genes in barley. In the first technique, a protein homology search with accessible PP2C proteins from Arabidopsis and rice was performed. The second technique included retrieving the PP2C protein sequence using hidden Markov model (HMM) analysis, with Pfam number PF00481 containing the tubule normal domain from the Pfam HMM library. The Arabidopsis and rice protein sequences were taken from TAIR and RAP-DB databases. The known Arabidopsis PP2C protein sequences were taken from NCBI and utilized as query sequences for the tBLASTn program in barley to search for similar protein sequences. All putative sequences were approved with the SMART database and interproscan. The remaining 10 non-redundant candidates were recognized as HvPP2C proteins. The ExPASy protoparam (www.expasy.org) was used to calculate the theoretical isoelectric point (pI) and molecular weight (Mw) of each HvPP2C protein. The protein sequences of HvPP2Cs were uploaded to the online annotation tool of Mapman (www.plabipd.de/portal/mercator-sequence-annotation) for functional annotation and categorization using default parameters. HvPP2C protein sequences were aligned using the ClustalW function of MEGA 7.0. Then, the phylogenetic tree between barley, rice, field mustard, and Arabidopsis was determined using the neighbor joining (NJ) algorithm with 1000 repeated bootstrap test parameters. To locate HvPP2C genes on barley chromosomes, HvPP2C genes were placed on each chromosome. HvPP2C genes were mapped on all chromosomes with MapChart (10).

3.2. Detection of Paralogous and Prediction of TFBS HvPP2C Genes in Barley

Similar gene pairs to HvPP2C proteins were identified by Blastp with more than 85% identity from Ensembl Plants. Similar genes to HvPP2C were visualized using the Circos program (http://mkweb.bcgsc.ca/tableviewer/visualize/). After determining the genomic sequence of each gene, 2000 bp upstream of the transcription start region of HvPP2C was recovered. Transcription factor binding site (TFBS) prediction was also done using the PlantCARE website.

3.3. Barley Growth Under Heat and Cold Treatments

To study the gene expression of HvPP2Cs genes under abiotic stress, seeds of Azaran and Jolge cultivars were grown in peat moss-filled pots and were kept under greenhouse conditions: Day/night temperatures were maintained at 25°C, with a 16/8 h light/dark period. Young root stems and leaves from the 2-week-old seedlings were harvested for tissue-specific expression analysis under cold and heat stresses and treated for four hours at cold (4°C) and heat stress (42°C). Different plant tissues were harvested 4 hours after abiotic stresses and immediately stored at −80°C for further analysis. Barley cultivars that grew normally were used as normal replicates. All experiments were repeated 3 times.

3.4. RNA Extraction and Quantitative Real-time PCR Analysis

Total RNA was extracted from roots, stems, and leaves of cold and heat under stress conditions at the seedling stage four hours after heat and cold treatments using the RNA-Plus kit (Sinaclone, Iran). The purity and concentration of RNA were determined by NanoDrops, and its quality was confirmed using 1% agarose gel analysis. Then, cDNA synthesis was performed according to the instructions of the Easy cDNA Synthesis Kit, Iran. Three replicates were performed to analyze each gene. Barley actin gene was used as a reference gene. Gene expression of five HvPP2C were analyzed under cold and heat stresses. All primers used in gene expression analysis are listed in Table 1. Primers were designed based on HvPP2C genes using the Oligo program. Real-time PCR (qPCR) was performed on an ABI 7500 using SYBR Green Supermix as described in the manufacturer's instructions. Relative expression was determined through the delta-delta 2-∆∆Ct technique. RT-qPCR was performed to determine the expression profile of five HvPP2C genes using different tissues under heat and cold stresses.
Table 1.Primers and Their Sequences Were Used for This Study's Gene Expression Analysis of HvPP2C
Primer NameSequence (5' - 3')Annealing Temperature
Hvpp2c1658
FCAGGGACGGGGATCAAGTTGT
RGCCAGAGTCACTTGCACGA
Hvpp2c3760
FTGCCGTGCTCCTACCATGA
RCATCCCTCTCTGTCCTCTGTC
Hvpp2c7059
FTGTGGCAAATGCCGGGGATTC
RCCACCAGCGTTCTGAATCCTCTC
Hvpp2c4159
FCACACTGCTGAGCTAGTTGTCC
RCTTCACGAGTTACCTGCAAC
HvPP2C4260
FTGTGCGTAGAACCACCGCA
RCGACTGCATGGCTCATAGGATTC
HvActin58
FGGTCCATCCTAGCCTCACTC
RGATAACAGCAGTGGAGCGCT

4. Results and Discussion

Based on the bioinformatics analysis, the 61 HvPP2C genes were detected. These proteins' detailed information (biochemical properties) are listed in Table 2. Sequence analysis showed that the deduced HvPP2C proteins' length varied from 51 amino acids (HvPP2C6a) to 1266 amino acids (HvPPC61). The predicted MW and pI ranged from 4.56 kDa (HvPP2C36) to 141.01 kDa (HvPP2C61) and from 4.6 (HvPP2C6) to 9.26 (HvPP2C56), respectively (Table 2). When the domain and motifs of HVPP2C proteins are similar, they will be located in the same subfamily, suggesting functional similarities for the genes in the same subfamily (9).
Table 2.Characteristics of HvPP2C Proteins Found in the Barley Genome
Uniprot accessionProtein NameNumber of Amino AcidsMolecular Weight (MW: kDa)Theoretical pIGenome LocationDuplication
M0USW5HvPP2C4658263.336.36chr1H:11138897-11142264Tandem duplicate
F2EHQ5HvPP2C4729832.764.71chr1H:54286009-54288770No duplication
A0A287FKC7HvPPC1339943.096.67chr1H:386658800-386662971No duplication
A0A287FL77HvPP2C7239243.328.23chr1H:390690911-390698376No duplication
A0A287FT97HvPP2C4824827.259.51chr1H:431534223-431538146Tandem duplicate
F2DJX7HvPP2C5139541.586.32chr1H:545790189-545793081No duplication
A0A287GS68HvPP2C5253457.954.89chr1H:552521506-552527955No duplication
A0A287IKQ2HvPP2C4139943.198.68chr2H:573578815-573582822Tandem duplicate
AK357653HvPP2C41a30533.176.34chr2H:573626499-573629830Tandem duplicate
AK357622HvPP2C4238641.887.1chr2H:622771403-622774870Block duplicate
A0A287JAG6HvPP2C6839042.86.9chr2H:704204949-704207601No duplication
M0Y7N6HPP2C4526829.304.93chr2H:722484027-722488008Tandem duplicate
M0Y7N6HPP2C45a28430.914.93chr2H:722563005-722566934Tandem duplicate
A0A287KAQ4HvPP2C0135337.425.68chr3H:46958934-46961758No duplication
A0A287KXD0HvPP2C0333335.677.99chr3H:291032153-291037688No duplication
A0A287KZD6HvPP2C5733135.726.67chr3H:340435807-340459284No duplication
A0A287L0C7HvPP2C640041.414.6chr3H:360092700-360098013No duplication
A0A287L3R5HvPP2C739045.936.7chr3H:407373335-407383431No duplication
A0A287LGB2HvPP2C6a515.519.81chr3H:511604930-511605643No duplication
A0A287LGC6HvPP2C1824125.795.35chr3H:511676340-511679818No duplication
M0ZC70HvPP2C1639341.865.78chr3H:614881000-614883250Block duplicate
A0A287MS52HvPP2C1731134.376.42chr3H:690155525-690157207No duplication
A0A287MUL9HvPPC17a38542.748.97chr3H:699024910-699050008No duplication
A0A287NGV0HvPP2C363174.567.59chr4H:98736380-98739103No duplication
A0A287NWL4HvPP2C7539443.476.07chr4H:358054764-358061365No duplication
A0A287P371HvPP2C21a40244.045.26chr4H:449217161-449223939No duplication
M0UT12HvPP2C3336238.595.61chr4H:456797020-456800448No duplication
A0A287P934HvPP2C3040043.065.68chr4H:507379979-507384625No duplication
M0YIW1HvPP2C2839943.789.3chr4H:616241933-616249757No duplication
M0VSN9HvPP2C3161367.356.25chr4H:645763892-645766806No duplication
A0A287QIS3HvPP2C7838341.999.06chr5H:79975025-79980048No duplication
A0A287RMK2HvPP2C6942946.865.78chr5H:519091103-519096484No duplication
A0A287S6R9HvPP2C7039642.704.96chr5H:582294665-582301638Block duplicate
A0A287SF58HvPP2C3426528.558.85chr5H:603081538-603088903No duplication
A0A287SKH9HvPP2C2127330.225.43chr5H:620396504-620402041No duplication
A0A287SPR2HvPP2C5842346.876.1chr5H:632185424-632196887No duplication
BAJ98729.1HvPP2C611266141.0157.54chr5H:640812970-640820023Tandem duplicate
A0A287SS11HvPPC3551854.965.3chr5H:641283216-641287419No duplication
A0A287SV91HvPP2C36a28631.555.36chr5H:648725477-648728034No duplication
A0A287TI85HvPP2C5532333.944.72chr6H:54801305-54811859No duplication
A0A287TKK2HvPP2C1036038.324.98chr6H:67703547-67706602No duplication
F2E5E2HvPP2C1138041.895.58chr6H:117906254-117913932Block duplicate
M0ZD44HvPP2C1235437.865.5chr6H:210762786-210767184Tandem duplicate
A0A287U0S8HvPP2C6553759.845.35chr6H:219263779-219288759Tandem duplicate
A0A287U288HvPP2C1451555.4006.53chr6H:246534205-246538678No duplication
A0A287U425HvPP2C1544947.876.07chr6H:290392640-290399019No duplication
A0A287U5N1HvPP2C1339141.875.25chr6H:307794396-307808554No duplication
A0A287UBR2HvPP2C2331734.335.48chr6H:393388996-393389949No duplication
F2EHY7HvPP2C2659765.125.34chr6H:463066303-463070536No duplication
A0A287VGJ4HvPP2C3737238.864.85chr7H:11079479-11102169Tandem duplicate
A0A287VW12HvPP2C6b29332.336.72chr7H:54028669-54033782Tandem duplicate
A0A287VVL1HvPP2C5435338.475.48chr7H:55007477-55011109Tandem duplicate
M0VNX5HvPP2C6652156.675.21chr7H:172453523-172458271No duplication
A0A287X173HvPP2C5636739.469.26chr7H:467679707-467683931No duplication
A0A287X5E1HvPP2C2236539.194.93chr7H:512082503-512087461No duplication
A0A287X703HvPP2C2431933.925.44chr7H:524549530-524550486Tandem duplicate
A0A287X703HvPP2C24a32033.935.45chr7H:524639090-524640046Tandem duplicate
A0A287X703HvPP2C24b33033.925.65chr7H:524814869-524815825Tandem duplicate
A0A287XCZ5HvPP2C7684896.845.74chr7H:570046163-570059714No duplication
F2D7E1HvPP2C5839142.554.97chr7H:636403133-636408251No duplication
F2E1Q6HvPP2C6039243.538.52chr7H:646432525-646437065No duplication

4.1. Phylogenetic Analysis, Chromosomal Distribution, and Duplication of HvPP2C Genes

To assess the phylogenetic relationships of the 61 HvPP2C proteins in barley, we performed a phylogenetic analysis using MEGA7 software (Figure 1). The phylogenetic tree showed that the PP2C genes can be divided into 12 subgroups. Previous studies showed that MtPP2C genes in Arabidopsis and rice were divided into 13 subfamilies (9, 11, 12). Some researchers have revealed that HvPP2C genes from monocots can be grouped into 13 subfamilies based on their domains (9, 13). The results show that the exact function of the genes of the subfamilies is due to the conserved motifs.
Phylogenetic tree of <i>HvPP2C</i> genes constructed by the neighbor-joining (NJ) method (A) in MEGA7.0 and conserved motifs using TBtools (B).
Figure 1.

Phylogenetic tree of HvPP2C genes constructed by the neighbor-joining (NJ) method (A) in MEGA7.0 and conserved motifs using TBtools (B).

Most HvPP2C proteins were classified in the same subfamily (Figure 1B). Most proteins from different species were placed in the same cluster, had similar conserved motifs and functional activity, and were paralogous (14). Motifs 1, 2, and 3 were available in most subfamilies, and motif 1 was present in 61 HvPP2C proteins except for HvPP2C58 and HvPP2C60 (Figure 1B). These outcomes propose that the precise functions of various subfamily genes may result from conserved motifs.
Afterward, the 61 HvPP2C genes were drawn using the MapChart software, and sixty-one HvPP2C genes were located across all seven chromosomes, ranging from 3 to 12 per chromosome (Figure 2). The number of HvPP2Cs on each chromosome varied, and chromosome 7 contained the largest number of HvPP2C members with 12 genes. However, the least number of genes was detected on chromosome 6, containing only three HvPP2C genes. In addition, seven HvPP2C were located on chromosomes 1 and 4. The 6 and 10 HvPP2C genes were located on chromosomes 2 and 3, respectively. Finally, nine HvPP2C were distributed on chromosome 5. Based on the research on rice, Arabidopsis, and B. distachyon, it has been shown that PP2C gene families mainly expanded through whole-genome and chromosomal segment duplications (9, 15). As shown in Fig 2, these 19 pairs of duplicated HvPP2C genes are distributed on chromosomes 1, 2, 3, 5, 6, and 7 but not on chromosome 4 (Figure 2).
Chromosomal Location and Expansion Patterns of <i>HvPP2C</i> Genes Identified in Barley.
Figure 2.

Chromosomal Location and Expansion Patterns of HvPP2C Genes Identified in Barley.

4.2. Paralogous Genes Study and Gene Duplication in HvPP2C

This study used synteny analysis to detect paralogous HvPP2C genes in the barley genome (Figure 3). Based on the results, five barley genes showed high similarity (identity 80%) and were implicated in paralogous. The analysis of synteny revealed that HvPP2C24b with HvPP2C24a, HvPP2C24 with HvPP2C24a and HvPP2C24b, HvPP2C5 with HvPP2C5a, and HvPP2C41 with HvPP2C41a were paralogous. It was observed that tandem duplicates occurred within HvPP2C24b, HvPP2C24, HvPP2C24a, HvPP2C37, HvPP2C6b, HvPP2C12, HvPP2C61, HvPP2C65, HvPP2C46, HvPP2C45, HvPP2C45a, HvPP2C48 and HvPP2C54 genes. Also, block duplication occurred within HvPP2C11, HvPP2C16, HvPP2C42, and HvPP2C60 genes. Analysis of HvPP2C indicated that genome duplication and tandem duplication play key roles in barley genome enlargement (16).
Paralogous relationships of <i>HvPP2C</i> genes visualized by Circos database using 61 <i>HvPP2C</i> genes.
Figure 3.

Paralogous relationships of HvPP2C genes visualized by Circos database using 61 HvPP2C genes.

4.3. Prediction of TFBS in the HvPP2C Genes

In the promoter regions of HvPP2C genes in barley, TFBs, TCA, and ARE-responsive elements were investigated. In this study, TFBS included ARE (anaerobic responsive elements), TCA elements, TATA-box, and CAAT-box in promoter regions (Appendix 1). HvPP2C17a and HvPP2C37a genes had the highest TFB in their promoter regions (Appendix 1). Previous studies have shown that HvPP2C responds to various stresses (which stress) and stimuli in Arabidopsis, tomato, and soybean (9, 17). ARE regulatory elements are important for the induction of anaerobic respiration (11). Enrichment of the TCA element in the promoter regions of most HvPP2C genes suggests comprehensive transcriptional regulation by HvPP2C itself, indicating a complex regulatory network among them. According to a previous report, TCA elements (salicylic acid elements) have also been associated with abiotic stresses (18). This may be due to the presence of cis-elements in the promoter region of these genes (19). Our findings demonstrated that HvPP2C, HvPP2C37, and HvPP2C37 genes have multiple binding sites in the promoter regions and play key roles in response to various environmental stresses. Results also showed that HvPP2C genes regulate many important developmental processes in plants, such as seedling and reproductive stages, and are involved in abiotic resistance, such as heat and cold stresses.

4.4. Functional Annotation

In barley, the largest percentage of detected proteins was implicated in protein metabolism (80%), and the second largest class was involved in hormone metabolism (8.57 %) (Figure 4). The percentage of mitochondrial 2-oxoglutarate/malate carrier protein (misc) was 7.14%. Most of the HvPP2C genes in the barley were involved in protein metabolism (protein degradation, post-translational modification, and protein synthesis) and hormone metabolism. Different kinds of HvPP2Cs were involved in protein degradation-related proteins, implying that the PP2Cs might play major roles in protein degradation during the barley seedling stage. Our findings showed that HvPP2C genes play a key role in abiotic stresses like cold and heat stresses. The HvPP2C had TFBs responsive to hormonal stress, indicating its role in response to abiotic stresses.
Functional annotation significantly enriched pathways involving the <i>HvPP2C</i> proteins in barley. Four BIN codes (17, 29, 26, and 35) were assigned to the functional annotation of <i>HvPP2Cs</i>.
Figure 4.

Functional annotation significantly enriched pathways involving the HvPP2C proteins in barley. Four BIN codes (17, 29, 26, and 35) were assigned to the functional annotation of HvPP2Cs.

4.5. Expression Profiles of HvPP2C Genes 3 Tissues Under Cold and Heat Stress Conditions

In Azaran and Jolge cultivars, the expression levels of five HvPP2C were determined under heat and cold stress conditions, most of which show a wide range of expression. To evaluate the expression profile of 5 PP2C genes and to evaluate the expression profile under heat and cold stress conditions, we utilized qRT-PCR analysis in different tissues: root, stem, and leaf. In the Azaran cultivar, HvPP2C37 and HvPP2C70 genes showed low expression in the root under cold stress conditions (Figure 5A), whereas HvPP2C16 and HvPP2C42 genes showed increased expression in the stem tissue (Figure 5A). In the leaf tissue, an increased expression of HvPP2C37, HvPP2C41, HvPP2C42, and HvPP2C70 genes was also shown (Figure 5A). Similarly, the expression levels of MtPP2C genes, such as MtPP2C37, were altered significantly during cold stress (9). In the Azaran cultivar, the HvPP2C gene showed decreased expression, except for the gene HvPP2C70, which showed increased expression in the stem tissue under cold stress (Figure 5A). Also, HvPP2C37 and HvPP2C41 genes were up-regulated in stem tissue under heat stress (Figure 5B). All HvPP2C genes showed reduced expression in leaves under heat stress (Figure 5B). Maximum expression was observed for the HvPP2C16 gene in the root compared with the other genes. It has been reported that among the BdPP2Cs studied, BdPP2C37 was increased under heat and cold stresses. Previous study has shown that BdPP2C70 strongly enhanced expression levels in response to abiotic stress, indicating that they may contribute in response to ABA (10). These results showed that the HvPP2C16 gene can be used as a molecular marker in barley improvement.
Differential gene expressions under cold (A) and heat (B) stress conditions in Azaran cultivar. The Jolge cultivar shows gene expression under cold (C) and heat (D) stress conditions. Blue and red indicate up and down-regulated genes, respectively. The yellow color indicates no significant expression under stress conditions.
Figure 5.

Differential gene expressions under cold (A) and heat (B) stress conditions in Azaran cultivar. The Jolge cultivar shows gene expression under cold (C) and heat (D) stress conditions. Blue and red indicate up and down-regulated genes, respectively. The yellow color indicates no significant expression under stress conditions.

The expression profiles of HvPP2C genes under heat and cold stresses revealed differential and overlapping expression patterns. In the Jolge cultivar, only the HvPP2C42 gene showed increased expression in response to cold stress in the root (Figure 5C), whereas the HvPP2C70 gene showed increased expression in response to heat stress in the shoot tissue (Figure 5D). Further, HvPP2C16, HvPP2C41, and HvPP2C42 genes were expressed in the leaves (Figure 5D). On the other hand, HvPP2C16, HvPP2C41, and HvPP2C42 genes were increased in the root in response to heat stress (Figure 5D). In the leaf tissue of the Jolge cultivar, HvPP2C16, HvPP2C41, HvPP2C42, and HvPP2C70 genes showed increased expression under heat stress (Figure 5D). Various expression patterns of HvPP2C genes may suggest their various roles in response to heat and cold stress conditions. In contrast to our results, the MtPP2C41 gene was decreased in response to the cold stress in Medicago truncatula (9).

5. Conclusions

In this study, 61 HvPP2C genes were detected in barley, and we surveyed their phylogenetic relationships, chromosomal locations, gene duplications, functional annotation, and prediction of TFBS. Also, bioinformatics analysis of these HvPP2C genes and their gene expression profiles were performed. Our results showed that the genes and groups with similar protein motifs had similar origins and possibly similar functions. These results provided insights into the evolutionary relationships of HvPP2C in the barley. HvPPT2C genes had different functions, indicating the presence of conserved domains in these genes. Based on the HvPP2C gene expression pattern, the HvPP2Cs gene showed different patterns in response to abiotic stresses. These results showed that the HvPP2C16 gene can be used as a molecular marker in barley improvement. However, the function of other subfamily PP2C in plant resistance to abiotic stress is poorly understood and needs further investigation. The results of our study establish a foundation for future studies on the functions of HvPP2C genes in plant’s response to abiotic stresses and provide a basic understanding that may allow us to elucidate the potential functions of HvPP2C genes under cold and heat stress conditions in barley.

Footnotes

References

  • 1.
    Yu X, Han J, Wang E, Xiao J, Hu R, Yang G, et al. Genome-wide identification and homoeologous expression analysis of PP2C genes in wheat (triticum aestivum l.). Front Genet. 2019;10:561. [PubMed ID: 31249596]. [PubMed Central ID: PMC6582248]. https://doi.org/10.3389/fgene.2019.00561.
  • 2.
    Luan S. Protein phosphatases and signaling cascades in higher plants. Trends Plant Sci. 1998;3(7):271-5. https://doi.org/10.1016/s1360-1385(98)01258-8.
  • 3.
    Shazadee H, Khan N, Wang J, Wang C, Zeng J, Huang Z, et al. Identification and expression profiling of protein phosphatases (PP2C) gene family in gossypium hirsutum l. Int J Mol Sci. 2019;20(6). [PubMed ID: 30897702]. [PubMed Central ID: PMC6471114]. https://doi.org/10.3390/ijms20061395.
  • 4.
    Wu P, Wang W, Li Y, Hou X. Divergent evolutionary patterns of the MAPK cascade genes in Brassica rapa and plant phylogenetics. Hortic Res. 2017;4:17079. [PubMed ID: 29285397]. [PubMed Central ID: PMC5744264]. https://doi.org/10.1038/hortres.2017.79.
  • 5.
    Xiang Y, Sun X, Gao S, Qin F, Dai M. Deletion of an endoplasmic reticulum stress response element in a ZmPP2C-A gene facilitates drought tolerance of maize seedlings. Mol Plant. 2017;10(3):456-69. [PubMed ID: 27746300]. https://doi.org/10.1016/j.molp.2016.10.003.
  • 6.
    Sugimoto H, Kondo S, Tanaka T, Imamura C, Muramoto N, Hattori E, et al. Overexpression of a novel arabidopsis PP2C isoform, AtPP2CF1, enhances plant biomass production by increasing inflorescence stem growth. J Exp Bot. 2014;65(18):5385-400. [PubMed ID: 25038254]. [PubMed Central ID: PMC4400540]. https://doi.org/10.1093/jxb/eru297.
  • 7.
    Saez A, Apostolova N, Gonzalez-Guzman M, Gonzalez-Garcia MP, Nicolas C, Lorenzo O, et al. Gain-of-function and loss-of-function phenotypes of the protein phosphatase 2C HAB1 reveal its role as a negative regulator of abscisic acid signalling. Plant J. 2004;37(3):354-69. [PubMed ID: 14731256]. https://doi.org/10.1046/j.1365-313x.2003.01966.x.
  • 8.
    Murata Y, Pei ZM, Mori IC, Schroeder J. Abscisic acid activation of plasma membrane Ca(2+) channels in guard cells requires cytosolic NAD(P)H and is differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 protein phosphatase 2C mutants. Plant Cell. 2001;13(11):2513-23. [PubMed ID: 11701885]. [PubMed Central ID: PMC139468]. https://doi.org/10.1105/tpc.010210.
  • 9.
    Yang Q, Liu K, Niu X, Wang Q, Wan Y, Yang F, et al. Genome-wide identification of PP2C genes and their expression profiling in response to drought and cold stresses in medicago truncatula. Sci Rep. 2018;8(1):12841. [PubMed ID: 30150630]. [PubMed Central ID: PMC6110720]. https://doi.org/10.1038/s41598-018-29627-9.
  • 10.
    Voorrips RE. MapChart: Software for the graphical presentation of linkage maps and QTLs. J Hered. 2002;93(1):77-8. [PubMed ID: 12011185]. https://doi.org/10.1093/jhered/93.1.77.
  • 11.
    Singh A, Giri J, Kapoor S, Tyagi AK, Pandey GK. Protein phosphatase complement in rice: genome-wide identification and transcriptional analysis under abiotic stress conditions and reproductive development. BMC Genomics. 2010;11:435. [PubMed ID: 20637108]. [PubMed Central ID: PMC3091634]. https://doi.org/10.1186/1471-2164-11-435.
  • 12.
    Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M. The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol. 2002;129(2):908-25. [PubMed ID: 12068129]. [PubMed Central ID: PMC161711]. https://doi.org/10.1104/pp.004002.
  • 13.
    Khan N, Ke H, Hu CM, Naseri E, Haider MS, Ayaz A, et al. Genome-wide identification, evolution, and transcriptional profiling of PP2C gene family in brassica rapa. Biomed Res Int. 2019;2019:2965035. [PubMed ID: 31073524]. [PubMed Central ID: PMC6470454]. https://doi.org/10.1155/2019/2965035.
  • 14.
    Altenhoff AM, Dessimoz C. Phylogenetic and functional assessment of orthologs inference projects and methods. PLoS Comput Biol. 2009;5(1). e1000262. [PubMed ID: 19148271]. [PubMed Central ID: PMC2612752]. https://doi.org/10.1371/journal.pcbi.1000262.
  • 15.
    Xue T, Wang D, Zhang S, Ehlting J, Ni F, Jakab S, et al. Genome-wide and expression analysis of protein phosphatase 2C in rice and Arabidopsis. BMC Genomics. 2008;9:550. [PubMed ID: 19021904]. [PubMed Central ID: PMC2612031]. https://doi.org/10.1186/1471-2164-9-550.
  • 16.
    Saidi A, Hajibarat Z, Hajibarat Z. Identification of responsive genes and analysis of genes with bacterial-inducible cis-regulatory elements in the promoter regions in Oryza sativa L. Acta agriculturae Slovenica. 2020;116(1). https://doi.org/10.14720/aas.2020.116.1.1035.
  • 17.
    Saidi A, Hajibarat Z, Hajibarat Z. Phylogeny, gene structure and GATA genes expression in different tissues of solanaceae species. Biocatal Agric Biotechnol. 2021;35. https://doi.org/10.1016/j.bcab.2021.102015.
  • 18.
    Qin YX, Qin F. Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation. Plant Physiol Biochem. 2016;99:142-9. [PubMed ID: 26756791]. https://doi.org/10.1016/j.plaphy.2015.12.011.
  • 19.
    Schweighofer A, Kazanaviciute V, Scheikl E, Teige M, Doczi R, Hirt H, et al. The PP2C-type phosphatase AP2C1, which negatively regulates MPK4 and MPK6, modulates innate immunity, jasmonic acid, and ethylene levels in Arabidopsis. Plant Cell. 2007;19(7):2213-24. [PubMed ID: 17630279]. [PubMed Central ID: PMC1955703]. https://doi.org/10.1105/tpc.106.049585.

Similar Articles

25
Jan
2026
Gene Cell Tissue

Identification of Candidate Downstream Genes in the Glucose-TOR Pathway Involved in Root Growth Under Salt Stress in the Halophyte Schrenkiella parvula Using Gene Co-expression Network Analysis

Mojtaba Lotfi,
Amin Mirshamsi Kakhki

Lotfi M, Mirshamsi Kakhki A. Identification of Candidate Downstream Genes in the Glucose-TOR Pathway Involved in Root Growth Under Salt Stress in the Halophyte Schrenkiella parvula Using Gene Co-expression Network Analysis. Gene Cell Tissue. 2026;13(1):e164955. doi: https://doi.org/10.5812/gct-164955

23
Jan
2018
Cloning and Expression of HP0242 Hypothetical Gene as a DNA Vaccine Candidate for <i>Helicobacter pylori</i> and Study of Its Immunoreactivity

Cloning and Expression of HP0242 Hypothetical Gene as a DNA Vaccine Candidate for Helicobacter pylori and Study of Its Immunoreactivity

Zahra Bagheri,
Abdolmajid Ghasemian,
Seyyed Khalil Shokouhi Mostafavi,
Abbas Doosti

Bagheri Z, Ghasemian A, Shokouhi Mostafavi SK, Doosti A. Cloning and Expression of HP0242 Hypothetical Gene as a DNA Vaccine Candidate for Helicobacter pylori and Study of Its Immunoreactivity. Arch Clin Infect Dis. 2018;13(1):e57487. doi: https://doi.org/10.5812/archcid.57487

19
Dec
2005

Purification and Partial Characterization of Barley Oxalate Oxidase

H Rahi,
A Mostafaee,
B Nemanpour

Rahi H, Mostafaee A, Nemanpour B. Purification and Partial Characterization of Barley Oxalate Oxidase. J Kermanshah Univ Med Sci. 2005;9(3):e81575. doi:

24
Jun
2024
Gene Cell Tissue

Increase Expression of HBsAg in Transgenic Potato Plants and Challenges of Vaccine Production in Transgenic Plants

Seyed Abolghassem Mohammadi Bondarkhilli,
Alireza Khabiri,
Hamideh Ofoghi,
Parastoo Ehsani,
Mohammad Kordkatouli

Mohammadi Bondarkhilli SA, Khabiri A, Ofoghi H, Ehsani P, Kordkatouli M. Increase Expression of HBsAg in Transgenic Potato Plants and Challenges of Vaccine Production in Transgenic Plants. Gene Cell Tissue. 2024;11(3):e146020. doi: https://doi.org/10.5812/gct-146020

21
Jan
2015

Comparison of PCR-RFLP Based on Ribosomal Regions and SSR Markers in Genetic Diversity of Pistachio Die-Back Caused by Paecilomyces variotii

Fatemeh Rostami,
Fatemeh Khosravi Moghaddam,
Seyed Kazem Sabbagh,
Saeide Saeidi

Rostami F, Khosravi Moghaddam F, Sabbagh SK, Saeidi S. Comparison of PCR-RFLP Based on Ribosomal Regions and SSR Markers in Genetic Diversity of Pistachio Die-Back Caused by Paecilomyces variotii. Gene Cell Tissue. 2015;2(1):e24340. doi: https://doi.org/10.17795/gct-24340


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC