Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Molecular Characterization of Enterobacter cloacae Isolated from Urinary Tract Infections

Author(s):
Elahe Barzam DehkordiElahe Barzam Dehkordi1, Elahe TajbakhshElahe Tajbakhsh1,*, Hassan MomtazHassan Momtaz1
1Department of Micrbiology, Faculty of Basic Siences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran

Jundishapur Journal of Microbiology:Vol. 15, issue 5; e122718
Published online:Jul 05, 2022
Article type:Research Article
Received:Jan 18, 2022
Accepted:Jun 01, 2022
How to Cite:Barzam Dehkordi E, Tajbakhsh E, Momtaz H. Molecular Characterization of Enterobacter cloacae Isolated from Urinary Tract Infections. Jundishapur J Microbiol. 2022;15(5):e122718. doi: https://doi.org/10.5812/jjm-122718

Abstract

Background:

Urinary tract infections represent a major expensive, common public health problem worldwide due to their high prevalence and the difficulties associated with their management.

Objectives:

This study aimed to characterize the Enterobacter cloacae strains isolated from urinary tract infections in the medical diagnostic laboratories of Shahrekord, Iran.

Methods:

Urine samples from patients with urinary tract infections from the Shahrekord medical diagnostic laboratories located in Chaharmahal and Bakhtiari Province, Iran, were collected from June 2019 to February 2020. When the samples were cultured, the different isolates of E. cloacae were identified by biochemical tests. Biofilm production capacity was evaluated. Bacterial susceptibility to antibiotics was determined using the Kirby Bauer method, and antibiotic resistance genes were researched by the multiplex PCR technique.

Results:

In this study, 65 isolates of E. cloacae were obtained. The highest percentage of resistance was observed for co-trimoxazole (84.62%), ampicillin (76.93%), tetracycline (73.85%), and above half of the E. cloacae strain isolates (53,85%) were strongly involved in biofilm production. Some genes, including qnr A, qnr B, qnr S, tetA, tet B, sul1, bla CTXM, bla SHV, and(2)la, ant(3)la, and aac(3)IIa, were detected in the genome of these isolates.

Conclusions:

The strains are multi-resistant, and their resistance has already reached the carbapenem class. This requires further investigation, and urgent measures must be adopted.

1. Background

Urinary tract infection (UTI), which involves many organs of the body, is one of the most common diseases in hospitals and the community (1). They can affect adults, youth, and children (2, 3). Urinary tract infections affect women much more frequently than men because of the anatomical configuration of the female genital tract, particularly the proximity of the urinary meatus to the anus (4). Urinary tract infections represent a major expensive (5) and common public health problem worldwide due to their high prevalence, difficulties associated with their management, and their complications (6). This concerns all outpatients and inpatients (7). Every year, above 200 million people are globally diagnosed with UTI, accounting for the global economy above $6 billion (6, 7).
The most isolated specie is Gram-negative (enterobacteria) (3), such as Escherichia coli, Enterobacter spp., Klebsiella spp. (8), Pseudomonas aeruginosa, and Serratia marcescens with high resistance rates (9). Among the strains, E. coli, Klebsiella pneumoniae, and Enterobacter cloacae are three significant pathogens involved in UTIs with important resistance phenotypes (10). These bacterial species have identified the most developed resistance mechanisms in enterobacteria. The World Health Organization (WHO) continues to raise the alarm about the severe handicap of antimicrobial resistance in managing infections such as UTIs. Some evidence shows an increasing resistance to conventional drugs among urinary tract pathogens (11, 12). The high rates of resistance to antimicrobials often used to treat common infections such as UTIs indicate the limited number of effective ways to control these infections. The situation is more alarming because infections induced by resistant bacteria often lead to a prolonged disease state and an increased mortality rate (9).
According to recent statistics reported by the WHO, the rate of resistance to ciprofloxacin used to treat UTIs ranged from 8.4% to 92.9% in 33 countries (13). Enterobacter cloacae isolates involved in UTIs have been characterized as multidrug-resistant for many years (14). Due to various intrinsic and acquired resistance mechanisms, it possesses; E. cloacae presents a real therapeutic challenge (7). Many studies have indicated antimicrobial resistance in E. cloacae strains isolated from UTIs (7, 15). The antimicrobial resistance of bacteria is one of the major problems in the world (3). However, few studies have focused on detecting the genetic elements of resistance in this bacterium (16). The present study was to fill this gap and provide usable scientific data on the resistance level of E. cloacae isolates in Shahrekord, Iran. This study would improve the treatment and management of UTIs because of using the multidrug-resistant strains of E. cloacae.

2. Objectives

This study aimed to provide information about the molecular profile of E. cloacae strains isolated from UTIs.

3. Methods

3.1. Study Setting

In this cross-sectional study, about 786 urine samples from male and female patients of different age ranges and history of UTI, who referred to the medical diagnostic laboratories in Shahrekord were collected from June 2019 to February 2020. Informed consent was obtained from the patients before collecting the samples. Moreover, ethical approval was obtained from the ethics committee. Bacterial strains were identified based on their culture and biochemical characteristics (6).

3.2. Antibiotic Susceptibility Study

The antibiotic sensitivity of the isolated strains was determined using the Kirby Bauer disk diffusion method. The antibiotic disc (Padtanteb, Iran) containing the following antibiotics was used: Amikacin (30 μg/AN30), kanamycin (K/30 μg), erythromycin (E15/15 μg), tetracycline (TE30/30 µg), gentamicin (GM10/10 μg), chloramphenicol (C) ampicillin (AM10/10 µg), ceftriaxone (CRO30/30 μg), ciprofloxacin (CP5/30 μg), cephalothin (CF30/30 μg), imipenem (IPM10/10 μg), nitrofurantoin (FM300/10 μg), nalidixic acid (NA30/30 μg), norfloxacin (NOR10/30 µg), and co-trimoxazole (SXT25/30 μg). The obtained inhibition zone diameters (IZDs) were recorded and interpreted according to the CLSI guidelines (6).

3.3. DNA Extraction and PCR Reactions

The DNA extraction kit (CinnaGen, Iran) was used according to the manufacturer’s instructions to obtain Genomic DNA from bacterial colonies. The selected isolates were subjected to multiplex PCR using previously described Enterobacter primers (CinnaGen, Iran) and conditions set by Tajbakhsh et al. (17) (Table 1).
Table 1.Primer Sequence for Enterobacter
Primer Sequences (5′-3′)
F: ATGTCTGGGAAACTGCCTGATG
R: CGGGTAACGTCAATAGACAAGG

3.4. Detection of Antibiotic Resistance Genes

PCR was performed for antibiotic resistance genes using the primers (CinnaGen, Iran) described in Table 2 (18-22). Hybridization temperatures and PCR conditions vary from gene to gene. The PCR conditions for each gene are presented in Table 3. DNA sequencing was performed with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST) to confirm resistance gene variants.
Table 2.Primer Sequence and Amplicon Size
Gene and Primer Sequence (5’-3’)Size of Product (bp)
qnr A360
F: CAGCAAGAGGATTTCTCACG
R: AATCCGGCAGCACTATTACTC
qnr B488
F: GGCTGTCAGTTCTATGATCG
R: GAGCAACGATGCCTGGTAG
qnr S428
F: GCAAGTTCATTGAACAGGGT
R: TCTAAACCGTCGAGTTCGGCG
ant (2)Ia572
F: CGCCGTGGGTCGATGTTTGATG
R: TTTTCCGCCCCGAGTGAGGTG
ant (3)Ia245
F: TCGACTCAACTATCAGAGG
R ACAATCGTGACTTCTACAGCG
aac(3)IIa563
F: GCAATAACGGAGGCGCTTCAAAA
R: TTCCAGGCATCGGCATCTCATACG
Sul 1433
F: CGGCGTGGGCTACCTGAACG
R: GCCGATCGCGTGAAGTTCCG
Bla SHV231
F: AAG ATC CAC TAT CGC CAG CAG
R: ATT CAG TTC CGT TTC CCA GCG G
Bla CITM850
F: GGT TAA AAA ATC ACT GCG TC
R: TTG GTG ACG ATT TTA GCC GC
tet A927
F: GTAATTCTGAGCACTGTCGC
R: CTGCCTGGACAACATTGCTT
tet B659
F: TTGGTTAGGGGCAAGTTTTG
R: GTAATGGGCCAATAACACCG
Table 3.PCR Conditions for Antibiotic Resistance Genes
GenePCR ProgramPCR Condition
qnr A1 cycle: 94°C---6 min; 33 cycles: 95°C---70 s, 55°C---65s, 72°C---90 s, 1 cycle: 72°C---8 min.5 μL PCR buffer 10X, 2.5 mm MgCl2, 200 μM dNTP (Fermentas), 0.5 μm of each primers F & R.
qnr B
qnr S1 cycle: 95°C---5 min; 31 cycles: 95°C---45s, 59°C---60s, 72°C---60s, 1 cycle: 72°C---5 min.
ant (2)Ia1 cycle: 95°C---4 min; 30 cycles: 95°C---45s, 58°C---60s, 72°C---40s, 1 cycle: 72°C---5min.
ant (3)Ia
aac(3)IIa1 cycle: 94°C---5 min; 32 cycles: 94°C---60 s, 55°C---60 s, 72°C---2 min, 1 cycle: 72°C---10 min.
Sul 11 cycle: 94°C---5 min; 32 cycles: 94°C---60s, 60°C---60s, 72°C---2 min, 1 cycle: 72°C---5min.
Bla SHV1 cycle: 95°C---4min; 30 cycles: 94°C---45s, 59°C---60s, 72°C---40s, 1 cycle: 72°C---5min.
Bla CTX-M
tet A1 cycle: 95°C---5min; 32 cycles: 94°C---60s, 59°C---60s, 72°C---2min, 1 cycle: 72°C---10min.
tet B

3.5. Biofilm Formation Assay

The ability of the isolates to form biofilms was investigated by a method previously described by Naves et al. (23). It is based on the assay in minimum and enriched media of E. cloacae strains and the mathematical determination of the patterns and quantity of biofilm formed.

3.6. Statistical Analysis

Descriptive analyses, including the mean value and variability (standard deviation) and descriptive tables, were used. Chi-squared and Fisher’s exact tests were used to evaluate the significance of differences between the different parameters evaluated with EpiData software (P < 0.05).

4. Results

This study aimed to characterize the molecular level of E. cloacae strains involved in the urinary tract of infected patients. To this end, 65 E. cloacae were isolated from 786 urine samples obtained from medical diagnostic laboratories, Shahrekord, Iran. Of the 65 E. cloacae isolates, 55 isolates were female, and 10 isolates were male. For each isolate, characteristic tests were performed.

4.1. Antibiotic Susceptibility Study

The results of the sensitivity test of the strains to different antibiotics are presented in Table 4. This table shows that half of the E. cloacae isolates are multidrug-resistant to ampicillin, tetracycline, amikacin, kanamycin, erythromycin, chloramphenicol, gentamicin, co-trimoxazole, and nalidixic acid, which are antibiotics from various classes. Resistance to imipenem, ceftriaxone, ciprofloxacin, cephalothin, and norfloxacin was also observed for above 30% of the strains. Only 20% of the strains were sensitive to imipenem. The highest resistance percentage was observed for co-trimoxazole (84.62%), ampicillin (76.93%), and tetracycline (73.85%), respectively. On the other hand, the resistance percentages were only 23.08% for Nitrofurantoin and 30.77% for imipenem and cephalothin.
Table 4.Antibiotic Susceptibility of Enterobacter cloacae Strain Isolates a
AntibioticRIS
Ampicillin50 (76.93)10 (15.38)5 (7.69)
Tetracycline48 (73.85)11 (16.92)6 (9.23)
Amikacin45 (69.23)15 (23.08)5 (7.69)
Kanamycin40 (61.54)15 (23.08)10 (15.38)
Erythromycin43 (66.16)12 (18.46)10 (15.38)
Chloramphenicol40 (61.54)10 (15.38)15 (23.08)
Gentamicin35 (53.84)15 (23.08)15 (23.08)
Co-Trimoxazole55 (84.62)5 (7.69)5 (7.69)
Nalidixic Acid45 (69.23)15 (23.08)5 (7.69)
Ciprofloxacin30 (46.15)15 (23.08)20 (30.77)
Norfloxacin25 (38.46)20 (30.77)20 (30.77)
Cephalothin20 (30.77)15 (23.08)30 (46.15)
Ceftriaxone25 (38.46)20 (30.77)20 (30.77)
Imipenem20 (30.77)25 (38.46)20 (30.77)
Nitrofurantoin15 (23.08)17 (26.15)33 (50.77)

a Values are expressed as No. (%).

4.2. Biofilm Production Study

Regarding the biofilm production by E. cloacae, above half of the E. cloacae strain isolates (53.85%) were strongly involved in biofilm production. Moreover, 53.85% had high biofilm production activity, 30.77% had moderate production, and 15.38% had low production.

4.3. Antibiotic Resistance Based on Biofilm Production

The relationship between biofilm production and the antibiotic resistance of E. cloacae strains is presented in Table 5. According to this table, the majority of strains with a high capacity for biofilm production were resistant to ampicillin (100%), amikacin (94.29%), tetracycline (97,14%), erythromycin (97.14%), co-trimoxazole (100%) (P < 0.05), and the half of these strains were resistant to most of the used antibiotic. Moreover, half of the strains with moderate biofilm production reaction showed resistance to several classes of antibiotics, including ampicillin (75%), tetracycline (55%), amikacin, erythromycin (50%), co-trimoxazole (55%), ciprofloxacin (70%), and ceftriaxone (85%). Antibiotic resistance was observed for strains with low biofilm production capacity, however, to a lesser extent.
Table 5.Antibiotic Resistance Evaluation Based on Biofilm Reaction a
AntibioticBiofilm ReactionP-Value
High n = 35Moderate n = 20Weak n = 10
RSRSRS
Ampicillin35 (100)0 (0)15 (75)5 (25)5 (50)5 (50)0.000 b
Tetracycline34 (97.14)1 (2.86)11 (55)9 (45)3 (30)7 (70)0.000 c
Amikacin33 (94.29)2 (5.71)10 (50)10 (50)6 (60)4 (40)0.001 b
Kanamycin30 (85.71)5 (14.29)15 (75)5 (25)6 (60)4 (40)0.243 b
Erythromycin34 (97.14)1 (2.86)10 (50)10 (50)6 (60)4 (40)0.000 b
Chloramphenicol29 (82.86)6 (17.14)13 (65)7 (35)7 (70)3 (30)0.298 b
Gentamicin25 (71.43)10 (28.57)12 (60)8 (40)6 (60)4 (40)0.624 c
Co-Trimoxazole35 (100)0 (0)11 (55)9 (45)7 (70)3 (30)0.000 b
Nalidixic Acid32 (91.83)3 (8.57)15 (75)5 (25)8 (80)2 (20)0.256 b
Ciprofloxacin10 (28.57)25 (71.43)14 (70)1 (30)5 (50)5 (50)0.000 c
Norfloxacin20 (57.14)15 (42.86)12 (60)8 (40)7 (70)3 (30)0.765 c
Cephalothin19 (54.29)16 (45.71)16 (80)4 (20)7 (70)3 (30)0.147 c
Ceftriaxone16 (45.71)19 (54.29)17 (85)3 (15)6 (60)4 (40)0.017 c
Imipenem20 (57.14)15 (42.86)15 (75)5 (25)7 (70)3 (30)0.388 b
Nitrofurantoin13 (37.14)22 (62.86)13 (65)7 (35)5 (50)5 (50)0.136 c

a Values are expressed as No. (%).

b Fisher’s exact test

c Chi-squared test

4.4. Detection of Antibiotic Resistance Genes

Resistance genes were searched to understand the phenotypic data related to strain resistance (Table 6). This table showed that 60% of the strains that developed resistance to antibiotics such as norfloxacin, nalidixic, and ciprofloxacin, as the antibiotics of the quinolone and fluoroquinolone family, possessed the resistance genes qnrA, qnrB, qnrS with the characteristic of quinolones (P < 0.05). Similarly, above 60% of the strains resistant to ampicillin, cephalothin, and imipenem had resistance genes belonging to the beta-lactamase family, including blaSHV and blaCTX-M. Thus, these results show that the different resistance genes present in the genomes of E. cloacae strains were expressed. These strains are multi-resistant, and these resistances already reach the carbapenem class. This requires important surveillance.
Table 6.Frequency of Antibiotic Resistance Genes by Type of Antibiotic
Antibiotic/ GeneqnrAqnrBqnrStet Atet Bsul1ant (2)Iaant (3)Iaaac(3)IIablaSHVBla CTX-M
NA; n = 45; (P-value = 0.000*)2795
602011.11
CP; n = 30; (P-value = 0.000*)2082
66.6726.676.67
NOR; n = 25; (P-value = 0.000*)1561
60244
TE; n = 48; (P-value = 0.275*)3530
72.9262.5
SXT; n = 5540
72.72
K; n = 40; (P-value = 0.822*)1817
4542.5
AN; n = 45; (P-value = 0.67*)2018
44.4440
GM; n = 3515
42.86
AM; n = 50; (P-value = 0.309*)3227
6454
CF; n = 20; (P-value = 0151)1619
8095
IMP; n = 20; (P-value = 0.342*)129
6045

5. Discussion

The present study aimed to specify the molecular characterization of E. cloacae strains involved in UTIs. Out of the 65 E. cloacae strain isolates, above half of the strains were resistant to several classes of antibiotics. This reflects the bacterial multi-resistance characterizing the strains involved in UTIs (24). The bacterial multi-resistanceinclude aminoglycosides, tetracyclines, quinolones, penicillin, macrolides, and sulfonamides. The management processes are thus limited (25). Thus, this constitutes a break from the cure by antibiotic therapy. The resistance to beta-lactam antibiotics, especially carbapenems, shows that the antibiotics of last resort are minimal. In the case of UTIs with multidrug-resistant bacteria, physicians will be faced with a significant lack of solutions in a short period.
This issue shows the real public health problem with the antibiotic resistance of uropathogenic bacteria. This confirms the finding of earlier studies by Hryniewicz et al. (11) on the increasing extent of resistance among pathogens in UTIs to conventional drugs. A few years ago, during epidemiological surveillance, there was a significant decrease in the antibiotic susceptibility of strains involved in UTIs. These observations would be due to the acquisition and transmission of resistance genes between bacteria through plasmids by conjugation or transformation. Self-medication and non-compliance with dosage would also be factors, which could have considerably increased resistance in E. cloacae strains. However, in contrast to the findings of our study, in which the sensitivity to imipenem of the strains was only 20%, the sensitivity was above 80% in their study (12). According to Matsumoto and Muratani (26), imipenem has high antimicrobial activity against fresh urinary isolates such as E. cloacae. This strain is and remains an important opportunistic and multi-resistant pathogen for humans, which can create the epidemics of nosocomial infections (16). Nevertheless, the minimum inhibitory concentrations of different antibiotics tested should have been determined.
All isolated E. cloacae strains were biofilm producers, and above half of the isolates were strongly associated with biofilm production. Moreover, these findings corroborate with those reported by Sabir et al. (27). They also found that E. cloacae species had the highest biofilm production (87.5%) among pathogens isolated from catheter-associated UTIs with bacterial biofilm. Biofilm formation is one important characteristic of E. cloacae and other Enterobacteriaceae, which has been used in the rapid bioremoval of hydrocarbons in diesel fuel. In other words, the presence of this species in the urinary tract is a real threat to the patient. This study demonstrated the predominant role of biofilm production in increasing the resistance trait developed by E. cloacae. It showed that biofilm production increases antibiotic resistance in E. cloacae isolates.
Moreover, this finding is in line with the findings of Sabir et al. and Maheshwari et al. (27, 28). Sabir et al. (27) showed that biofilm-producing strains were highly resistant to antibiotics due to their slow penetration, a resistant phenotype, and an altered microenvironment. Maheshwari et al. (28) also documented that the presence of biofilm was a factor affecting the several-fold increase of antibiotic resistance. The biofilm formation represents a means of protection for E. cloacae and defense against antibiotics.
The different resistance genes were expressed in the genomes of E. cloacae strains isolated from our samples. The bla SHV genes were more frequent (64%, 80%, 60%) than the bla CTX-M genes (54%, 95%, 45%). Furthermore, this result does not confirm the findings of Cabral et al. (29), who claimed that the CTX-M genes were most expressed. According to a study conducted in Brazil in 2017, the bla CTX-M was more frequent in isolates from infection sites (16). As the phenotypic expression is only the result of the composition of the genetic material, the PCR results can be simply understood. Furthermore, no relationship was detected between quinolone resistance genes and the presence of beta-lactam genes. Azargun et al. (30) reported a significant association between the prevalence of plasmid resistance to quinolones and ESBL-producing isolates. No carbapenem resistance gene (NDM, VIM, OXA-48) was searched, while the susceptibility test considered carbapenem class antibiotics. This means that this study was limited in terms of molecular characterization. Since we are witnessing the emergence of the mcr-1 positive strains of Enterobacteriaceae worldwide, this gene could have been searched to study its epidemiology (31).

5.1. Conclusions

UTIs are a genuine public health concern due to the involvement of multi-resistant strains such as E. cloacae. The potentials to produce biofilm and antibiotic resistance genes are essential elements giving this strain a multi-resistant and defensive strength. Accordingly, the management of these infections is difficult since antibiotic therapy is severely limited.

Footnotes

References

  • 1.
    Mach F, Marchandin H, Bichon F. [Treatment and prevention of urinary tract infections]. Actual Pharm. 2020;59(598):48-52. French. https://doi.org/10.1016/j.actpha.2020.06.023.
  • 2.
    Ishikawa K, Matsumoto T, Yasuda M, Uehara S, Muratani T, Yagisawa M, et al. The nationwide study of bacterial pathogens associated with urinary tract infections conducted by the Japanese Society of Chemotherapy. J Infect Chemother. 2011;17(1):126-38. [PubMed ID: 21174142]. https://doi.org/10.1007/s10156-010-0174-1.
  • 3.
    Rajabi Z, Soltan Dallal MM. Study on bacterial strains causing blood and urinary tract infections in the neonatal intensive care unit and determination of their antibiotic resistance pattern. Jundishapur J Microbiol. 2015;8(8). e19654. [PubMed ID: 26468359]. [PubMed Central ID: PMC4601293]. https://doi.org/10.5812/jjm.19654v2.
  • 4.
    Folliero V, Caputo P, Della Rocca MT, Chianese A, Galdiero M, Iovene MR, et al. Prevalence and antimicrobial susceptibility patterns of bacterial pathogens in urinary tract infections in university hospital of Campania "Luigi Vanvitelli" between 2017 and 2018. Antibiotics (Basel). 2020;9(5). [PubMed ID: 32354050]. [PubMed Central ID: PMC7277346]. https://doi.org/10.3390/antibiotics9050215.
  • 5.
    Sybesma W, Zbinden R, Chanishvili N, Kutateladze M, Chkhotua A, Ujmajuridze A, et al. Bacteriophages as potential treatment for urinary tract infections. Front Microbiol. 2016;7:465. [PubMed ID: 27148173]. [PubMed Central ID: PMC4826877]. https://doi.org/10.3389/fmicb.2016.00465.
  • 6.
    Delcaru C, Podgoreanu P, Alexandru I, Popescu N, Marutescu L, Bleotu C, et al. Antibiotic resistance and virulence phenotypes of recent bacterial strains isolated from urinary tract infections in elderly patients with prostatic disease. Pathogens. 2017;6(2). [PubMed ID: 28561794]. [PubMed Central ID: PMC5488656]. https://doi.org/10.3390/pathogens6020022.
  • 7.
    Gajdacs M, Urban E. Resistance trends and epidemiology of citrobacter-enterobacter-serratia in urinary tract infections of inpatients and outpatients (RECESUTI): A 10-year survey. Medicina (Kaunas). 2019;55(6). [PubMed ID: 31216725]. [PubMed Central ID: PMC6630883]. https://doi.org/10.3390/medicina55060285.
  • 8.
    Guermazi-Toumi S, Boujlel S, Assoudi M, Issaoui R, Tlili S, Hlaiem ME. Susceptibility profiles of bacteria causing urinary tract infections in Southern Tunisia. J Glob Antimicrob Resist. 2018;12:48-52. [PubMed ID: 28918351]. https://doi.org/10.1016/j.jgar.2017.09.004.
  • 9.
    Rosana Y, Ocviyanti D, Halim M, Harlinda FY, Amran R, Akbar W, et al. Urinary tract infections among Indonesian pregnant women and its susceptibility pattern. Infect Dis Obstet Gynecol. 2020;2020:9681632. [PubMed ID: 32372856]. [PubMed Central ID: PMC7191430]. https://doi.org/10.1155/2020/9681632.
  • 10.
    Xu J, He F. Genomic analysis of two bacterial strains co-isolated from a urinary tract infection: NDM-1-producing Enterobacter cloacae accompanied by extended-spectrum beta-lactamase-producing Escherichia coli. J Glob Antimicrob Resist. 2019;17:198-200. [PubMed ID: 31005730]. https://doi.org/10.1016/j.jgar.2019.04.007.
  • 11.
    Hryniewicz K, Szczypa K, Sulikowska A, Jankowski K, Betlejewska K, Hryniewicz W. Antibiotic susceptibility of bacterial strains isolated from urinary tract infections in Poland. J Antimicrob Chemother. 2001;47(6):773-80. [PubMed ID: 11389109]. https://doi.org/10.1093/jac/47.6.773.
  • 12.
    Jimenez-Guerra G, Borrego-Jimenez J, Gutierrez-Soto B, Exposito-Ruiz M, Navarro-Mari JM, Gutierrez-Fernandez J. Susceptibility evolution to antibiotics of Enterobacter cloacae, Morganella morganii, Klebsiella aerogenes and Citrobacter freundii involved in urinary tract infections: an 11-year epidemiological surveillance study. Enferm Infecc Microbiol Clin (Engl Ed). 2020;38(4):166-9. [PubMed ID: 31606242]. https://doi.org/10.1016/j.eimc.2019.07.010.
  • 13.
    World Health Organization. [Record number of countries contribute data revealing disturbing rates of antimicrobial resistance]. Geneva, Switzerland: World Health Organization; 2020. French. Available from: https://www.who.int/fr/news/item/01-06-2020-record-number-of-countries-contribute-data-revealing-disturbing-rates-of-antimicrobial-resistance.
  • 14.
    Kaminska W, Patzer J, Dzierzanowska D. Urinary tract infections caused by endemic multi-resistant Enterobacter cloacae in a dialysis and transplantation unit. J Hosp Infect. 2002;51(3):215-20. [PubMed ID: 12144801]. https://doi.org/10.1053/jhin.2002.1236.
  • 15.
    Zhang Y, Wang Q, Yin Y, Chen H, Jin L, Gu B, et al. Epidemiology of Carbapenem-Resistant Enterobacteriaceae Infections: Report from the China CRE Network. Antimicrob Agents Chemother. 2018;62(2). [PubMed ID: 29203488]. [PubMed Central ID: PMC5786810]. https://doi.org/10.1128/AAC.01882-17.
  • 16.
    Davin-Regli A, Pages JM. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment. Front Microbiol. 2015;6:392. [PubMed ID: 26042091]. [PubMed Central ID: PMC4435039]. https://doi.org/10.3389/fmicb.2015.00392.
  • 17.
    Tajbakhsh E, Tajbakhsh S, Khamesipour F. Isolation and molecular detection of gramnegative bacteria causing urinary tract infection in patients referred to Shahrekord hospitals, Iran. Iran Red Crescent Med J. 2015;17(5). e24779. [PubMed ID: 26082853]. [PubMed Central ID: PMC4464383]. https://doi.org/10.5812/ircmj.17(5)2015.24779.
  • 18.
    Banihashem M, majidpour A, Boustanshenas M, Mazar-Atabaki S. Tetracycline resistance associated with tet genes or integrons among Enterobacter cloacae strains isolated from patients with urinary tract infections. Infection Epidemiology and Microbiology. 2020;6(1):1-9. https://doi.org/10.29252/iem.6.1.1.
  • 19.
    Ciesielczuk H, Hornsey M, Choi V, Woodford N, Wareham DW. Development and evaluation of a multiplex PCR for eight plasmid-mediated quinolone-resistance determinants. J Med Microbiol. 2013;62(Pt 12):1823-7. [PubMed ID: 24000223]. https://doi.org/10.1099/jmm.0.064428-0.
  • 20.
    Ghotaslou R, Yeganeh Sefidan F, Akhi MT, Asgharzadeh M, Mohammadzadeh Asl Y. Dissemination of genes encoding aminoglycoside-modifying enzymes and arma among Enterobacteriaceae isolates in northwest Iran. Microb Drug Resist. 2017;23(7):826-32. [PubMed ID: 28151044]. [PubMed Central ID: PMC5665088]. https://doi.org/10.1089/mdr.2016.0224.
  • 21.
    Kerrn MB, Klemmensen T, Frimodt-Moller N, Espersen F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J Antimicrob Chemother. 2002;50(4):513-6. [PubMed ID: 12356795]. https://doi.org/10.1093/jac/dkf164.
  • 22.
    Salimian Rizi K, Najar Peerayeh S, Bakhshi B, Rahbar M. Prevalence of integrons and antimicrobial resistance genes among clinical isolates of Enterobacter spp. from hospitals of Tehran. Int J Enteric Pathog. 2015;3(1). https://doi.org/10.17795/ijep22531.
  • 23.
    Naves P, del Prado G, Huelves L, Gracia M, Ruiz V, Blanco J, et al. Measurement of biofilm formation by clinical isolates of Escherichia coli is method-dependent. J Appl Microbiol. 2008;105(2):585-90. [PubMed ID: 18363684]. https://doi.org/10.1111/j.1365-2672.2008.03791.x.
  • 24.
    Ahmed SS, Shariq A, Alsalloom AA, Babikir IH, Alhomoud BN. Uropathogens and their antimicrobial resistance patterns: Relationship with urinary tract infections. Int J Health Sci (Qassim). 2019;13(2):48-55. [PubMed ID: 30983946]. [PubMed Central ID: PMC6436442].
  • 25.
    Bader MS, Loeb M, Brooks AA. An update on the management of urinary tract infections in the era of antimicrobial resistance. Postgrad Med. 2017;129(2):242-58. [PubMed ID: 27712137]. https://doi.org/10.1080/00325481.2017.1246055.
  • 26.
    Matsumoto T, Muratani T. Newer carbapenems for urinary tract infections. Int J Antimicrob Agents. 2004;24 Suppl 1:S35-8. [PubMed ID: 15364304]. https://doi.org/10.1016/j.ijantimicag.2004.03.001.
  • 27.
    Sabir N, Ikram A, Zaman G, Satti L, Gardezi A, Ahmed A, et al. Bacterial biofilm-based catheter-associated urinary tract infections: Causative pathogens and antibiotic resistance. Am J Infect Control. 2017;45(10):1101-5. [PubMed ID: 28629757]. https://doi.org/10.1016/j.ajic.2017.05.009.
  • 28.
    Maheshwari M, Ahmad I, Althubiani AS. Multidrug resistance and transferability of blaCTX-M among extended-spectrum beta-lactamase-producing enteric bacteria in biofilm. J Glob Antimicrob Resist. 2016;6:142-9. [PubMed ID: 27530857]. https://doi.org/10.1016/j.jgar.2016.04.009.
  • 29.
    Cabral AB, Maciel MAV, Barros JF, Antunes MM, Barbosa de Castro CMM, Lopes ACS. Clonal spread and accumulation of beta-lactam resistance determinants in Enterobacter aerogenes and Enterobacter cloacae complex isolates from infection and colonization in patients at a public hospital in Recife, Pernambuco, Brazil. J Med Microbiol. 2017;66(1):70-7. [PubMed ID: 27902398]. https://doi.org/10.1099/jmm.0.000398.
  • 30.
    Azargun R, Sadeghi MR, Soroush Barhaghi MH, Samadi Kafil H, Yeganeh F, Ahangar Oskouee M, et al. The prevalence of plasmid-mediated quinolone resistance and ESBL-production in Enterobacteriaceae isolated from urinary tract infections. Infect Drug Resist. 2018;11:1007-14. [PubMed ID: 30087570]. [PubMed Central ID: PMC6061675]. https://doi.org/10.2147/IDR.S160720.
  • 31.
    Zeng KJ, Doi Y, Patil S, Huang X, Tian GB. Emergence of the Plasmid-Mediated mcr-1 Gene in Colistin-Resistant Enterobacter aerogenes and Enterobacter cloacae. Antimicrob Agents Chemother. 2016;60(6):3862-3. [PubMed ID: 26976876]. [PubMed Central ID: PMC4879368]. https://doi.org/10.1128/AAC.00345-16.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles