Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Effect of Peganum harmala Extract on Biofilm and Involved Gene Expression in Biofilm Production of Candida albicans

Author(s):
Maryam ErfaninejadMaryam ErfaninejadMaryam Erfaninejad ORCID1, Elham AboualigalehdariElham AboualigalehdariElham Aboualigalehdari ORCID2, Mahnaz FatahiniaMahnaz FatahiniaMahnaz Fatahinia ORCID3,*
1Department of Medical Mycology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Department of Parasitology, Ilam University of Medical Sciences, Ilam, Iran
3Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

Jundishapur Journal of Microbiology:Vol. 16, issue 2; e132692
Published online:May 08, 2023
Article type:Research Article
Received:Oct 26, 2022
Accepted:Mar 17, 2023
How to Cite:Erfaninejad M, Aboualigalehdari E, Fatahinia M. Effect of Peganum harmala Extract on Biofilm and Involved Gene Expression in Biofilm Production of Candida albicans. Jundishapur J Microbiol. 2023;16(2):e132692. doi: https://doi.org/10.5812/jjm-132692

Abstract

Background:

Since common drug therapies cannot eradicate Candida biofilm, extensive studies are required to develop more effective antifungal compounds and identify their mechanism of action against Candida biofilm. Peganum harmala L. is a traditional medicinal plant, the seeds of which have been used to treat various diseases.

Objectives:

This study aimed to investigate the anti-biofilm mechanisms of P. harmala extract (PHE) and the expression of CAT1, EFG1, and BCR1 genes involved in oxidative stress response and biofilm formation in Candida albicans.

Methods:

Anti-biofilm activity of PHE was evaluated by crystal violet assay to determine biofilm formation on 33 C. albicans isolates. Finally, a real-time polymerase chain reaction was performed to analyze the effect of PHE on the expression of CAT1, EFG1, and BCR1 genes in C. albicans.

Results:

This study determined the minimum biofilm eradication concentration (MBEC) of 15 isolates in concentrations between 0.49 - 3.9 μg/mL of P. harmala extract. Statistical analysis showed that the exposure of C. albicans biofilm to PHE significantly reduced the expression of CAT1 mRNA in C. albicans isolates (P = 0.0068). However, no significant difference was observed in the expression of EFG1 and BCR1 genes.

Conclusions:

The results demonstrated that PHE significantly decreased CAT1 expression in C. albicans cells treated with the herbal extract. PHE is likely to accumulate hydrogen peroxide (H2O2) by reducing CAT1 expression and disrupting the pro-oxidant/antioxidant balance that leads to the overproduction of reactive oxygen species (ROS) and can cause damage to cellular components and eventually destroy C. albicans biofilm.

1. Background

Oropharyngeal candidiasis (OPC) is one of the most common infections among the HIV-infected population (1). Oropharyngeal candidiasis is a useful indicator of HIV progression following the failure of highly active antiretroviral therapy (HAART) (2). Candida albicans is the most frequent Candida species causing OPC in these patients (3), and the oral cavity can act as a potential source of systemic fatal candidiasis (4). The pathogenesis of Candida is mediated by several virulence factors, including biofilm formation and oxidative stress response (5).
Catalase, superoxide dismutase (SOD), and glutathione peroxidase (GPX) are three enzymes involved in protecting cells from the harmful effects of reactive oxygen species (ROS) (6, 7). Reactive oxygen species are especially important in pathogenic fungi and have been emphasized in C. albicans because oxidative stress is a tense condition more likely to be encountered in vivo (8). The activity of SOD produces hydrogen peroxide (H2O2), and the capacity of yeast to develop tolerance against H2O2 depends upon catalase encoded by the CAT1 gene (9). Also, six master transcriptional regulators, including BCR1, EFG1, TEC1, NDT80, ROB1, and BRG1, regulate the formation of C. albicans biofilm (10). Biofilm acts as a source for chronic and recurrent infections and is responsible for the emergence of antifungal drug resistance, which is caused by an extracellular matrix limiting the penetration of drugs; only the surface cells of a biofilm are exposed to an effective dose of the antifungal agent (11, 12). There is a need to develop newer anti-biofilm compounds and modify the existing antifungals that affect the biofilm formation by Candida species to make them more effective.
Peganum harmala L. is among the traditional medicinal plants growing in semi-arid climates, steppe areas, and sandy soils. Capsules containing > 50 small black-brown triangular seeds constitute this plant’s fruit. For a long time, different parts of P. harmala, especially its seeds, have been used in Iran as a traditional medicine for various diseases (13). The main medicinal properties of P. harmala are attributed to the production of alkaloids in different parts of this herb, especially seeds, and roots (14).

2. Objectives

Since the results of our previous study confirmed the theory of the effect of P. harmala extract (PHE) on biofilm formation (15), in the present study, an attempt was made for the first time to identify the mechanism of anti-biofilm properties of PHE by investigating the expression of CAT1 gene, which is involved in oxidative stress response pathway, as well as morphogenetic regulator gene (EFG1) and cell wall regulator gene (BCR1) as key genes for biofilm formation.

3. Methods

3.1. Specimen Collection and Initial Identification

This research was conducted on 33 C. albicans strains isolated from HIV-positive individuals in the Behavioral Diseases Counseling Center affiliated to Ahvaz Jundishapur University of Medical Sciences. The inclusion criteria were: Oral candidiasis symptoms such as white patches, loss of taste, and a painful burning sensation in the mouth in HIV-positive patients. Samples were collected from the oral cavity of the participants using a sterile cotton swab. The swabs were then inoculated onto CHROMagar Candida plates (CHROMagar Candida, France) and incubated aerobically at 37°C for 48 hours. Patients with ≥ 10 CFU yeasts grown from each swab on the plate were considered to be colonized (16).

3.2. Molecular Identification

DNA was extracted from purified colonies by the boiling lysis method and subjected to polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The ITS1-5.8S rDNA-ITS2 region was amplified using universal fungal primers ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′) and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) (17). Subsequently, PCR products were digested by MspI restriction enzyme (Hpa III; Thermo Fisher Scientific, Waltham, MA, USA). After incubation for 16 hours at 37°C, the products were transferred to 1.8% agarose gel. Due to the inability of the MspI enzyme to distinguish between C. albicans and C. dubliniensis, the suspected C. albicans and C. dubliniensis isolates were differentiated by duplex PCR using CAL (F: 5′-TGG TAA GGC GGG ATC GCT T-3′, R: 5′-GGT CAA AGT TTG AAG ATA TAC-3′) and CDU (F: 5′AAA CTT GTC ACG AGA TTA TTT TT3′, R: 5′AAA GTT TGA AGA ATA AAA TGG C-3′) primers (18) as shown in Figure 1.
A, ITS-PCR products of <i>Candida albicans</i>; B, restriction digestion of PCR products of <i>C. albicans</i> with <i>Msp</i>1enzyme; M, 100 bp molecular size marker.
Figure 1.

A, ITS-PCR products of Candida albicans; B, restriction digestion of PCR products of C. albicans with Msp1enzyme; M, 100 bp molecular size marker.

3.3. Plant Preparation

Peganum harmala seeds were collected from Iran on December 2020, and a voucher specimen was deposited at the Medicinal Plant Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran (code no. A233230001sp). After collecting the plants, they were rinsed with distilled water and dried for investigation of antifungal activity.

3.4. Preparation of Plant Extract

We used the cold maceration method for extraction. Ten grams of fine powder from P. harmala seeds were macerated using 100 mL of 20% ethanol in a closed conical flask for each case on a rotary shaker (150 - 180 r.p.m) for 24 hours, which was then filtered using Whatman filter paper No.2. The solvent-free ethanol extract was after that evaluated (19).

3.5. In Vitro Biofilm Formation Assay

Tubes containing 1.0 mL of SDB medium (Sabouraud Dextrose Broth-Liofilchem, Italy) and C. albicans were incubated in a shaking incubator at 30°C overnight. After incubation, C. albicans cells were rinsed three times with phosphate-buffered saline (PBS), and the optical density of C. albicans cell suspension (1.0 × 106 cells/mL) was determined by spectrophotometry at 530 nm (Abs.530). In vitro, biofilm formation assay was performed on 96-well microplates based on the method described by Pierce et al. with minor modifications (20). In brief, all the standardized cell suspensions were diluted at a ratio of 1:10 in RPMI 1640 medium (with L- glutamine, without bicarbonate) (Bio Basic) and buffered to pH = 7.0 with 0.165 M solution of MOPS (Bio Basic). Afterward, 200 μL of cells (1.0 × 106 cells/mL) was seeded into 96 sterile flat-bottom well microplates and incubated at 37°C for 24 hours until mature biofilm formation.

3.5.1. Crystal Violet Assay for Determination of Biofilm Formation

To remove the planktonic cells, the plates were gently washed three times with PBS, and biofilm biomass was stained by adding 0.1% crystal violet (100 μL) for 15 minutes. The wells were then washed three times with PBS to remove the excess stain and dried at ambient temperature. Subsequently, 100 µL of ethanol was added to each well. After these steps, the biofilm biomass was measured with an ELISA Microplate Reader at 595 nm. Crystal violet assay was conducted in triplicates for C. albicans ATCC 10231 (the common positive control for evaluating anti-biofilm agents) and each clinical isolate.

3.6. Evaluation of the Anti-biofilm Activity of PHE

Following mature biofilm formation (24 h) and after washing the wells, as previously mentioned, serial dilutions of PHE were added to wells with concentrations of 0.245 - 62.5 ug/uL in RPMI 1640 medium. The plates were then incubated at 37°C for 24 h to determine the anti-biofilm effects of PHE (21) compared with 20 μg/mL Amphotericin B (AmB) and the negative control. After incubation, minimum biofilm eradication concentration (MBEC) was defined as the lowest PHE concentration required to eliminate 99.9% of biofilm-embedded yeast (3 log10 reductions in CFU/mL) compared to growth control and negative control (22, 23). For this purpose, a well in which no biofilm was observed compared to the growth control and the negative control was defined as MBEC.

3.7. RNA Extraction and Real-time PCR

A total of 15 isolates were selected for expression analysis of target genes based on the intensity of the effect of the herbal extract on the degradation of biofilm from Candida species. To compare the changes in expression levels of CAT1, BCR1, and EFG1 genes in C. albicans isolates before and after treatment with MBEC of PHE, the biofilm of C. albicans isolates was simultaneously formed in two separate plates (24-well, treated, flat-bottom, non-pyrogenic, sterile) for the selected isolates. In the first plate, the biofilm was collected without exposure to PHE in 1.5 mL microtubes. The biofilm was exposed to one concentration less than MBEC of PHE in the other plate and collected in 1.5 mL microtubes (23). Subsequently, total RNA was extracted from C. albicans isolates in RNase-free conditions using RNX-PlusTM solution following the Sinaclon total RNA isolation protocol. RNA concentrations were measured using a spectrophotometer (NanoDrop, Thermo Scientific). Synthesis of cDNA was performed by 2X RT Master Mix of No-ROX kit (BiofactTM) based on the manufacturer’s instructions, and the β-Actin gene was considered as the normalizing gene. The primer sequences of β-Actin, EFG1, CAT1, and BCR1 genes are shown in Table 1. Quantitative real-time PCR was performed in triplicate using real-time PCR Roche LightCycler® with the following parameters: A pre-incubation step at 95°C for 5 minutes, followed by 40-cycles of 95°C for 15 seconds (denaturation) and 60°C for 60 seconds (annealing and extension).
Table 1.The Nucleotide Sequence of the Primers for Real-time PCR Amplification
GenesPrimer Sequence (5′→3′)Size (bp)Gene BankGC%TMReferences
BCR1101NC_032096.1(24)
FCTTCAGCAGCTTCATTAACACCTA41.768
RTCTTGGATCAGGTGTACTTTTCAA37.566
EFG1100XM_709144.2(25)
FTGCCAATAATGTGTCGGTTG4558
RCCCATCTCTTCTACCACGTGTC5468
CAT1117NC_032089.1(26)
FGACTGCTTACATTCAAAC38.955.1
RAACTTACCAAATCTTCTCA31.955.1
ACT1166XM_019475182.1
FACTGCTTTGGCTCCATCTTCT4865
RTGTGGTGAACAATGGATGGAC4862

3.8. Statistical Analyses

Statistical analysis of quantitative real-time PCR was carried out using Microsoft Excel workbook, relative expression software (REST 2009), and Graph Pad PRISM 8. The mean Ct of EFG1, CAT1, and BCR1 genes before and after treatment by PHE was expressed as mean ± standard deviation. Then, using paired t-test, the levels of ΔCt of EFG1, CAT1, and BCR1 genes were compared separately before and after incubation with the herbal extract. A P-value of < 0.05 was considered statistically significant.

4. Results

4.1. Biofilm Formation

Candida albicans species were successfully isolated and identified. The ability of biofilm formation in C. albicans isolates was evaluated according to the crystal violet assay. The intensity of biofilm formation was 0.18 - 4.8 according to the absorbance values at 595 nm (Table 2).
Table 2.The Intensity of Biofilm Formation of 33 Candida albicans Isolates
Intensity of Biofilm Formation aNo. (%)
< 14 (12.1)
1 - 27 (21.2)
2 - 39 (27.3)
3 - 43 (9.1)
> 410 (30.3)

a According to the absorbance values at 595 nm.

4.2. Evaluation of the Anti-biofilm Effect of PHE

Peganum harmala extract showed a strong antifungal effect against C. albicans isolates. Biofilm reduction under the influence of PHE was observed macroscopically in all biofilms, and MBEC was obtained in 15 isolates (33%) in the n 0.49 - 7.8 μg/mL concentration range of PHE (Table 3). Also, for all tested isolates, biofilm reduction was achieved under the influence of 20 μg/mL AmB.
Table 3.The Intensity of Biofilm Formation of 15 Candida albicans Isolates and Anti-biofilm Activities of Peganum harmala Against These Isolates
Isolate NameBiofilm FormationMBEC (μg/mL)
H0074.71.95
H0314.70.98
H0244.60.98
H0284.00.98
H0723.73.9
H0253.47.8
H0212.71.95
H0432.50.49
H0791.93.9
H0261.40.98
H0781.13.9
H0461.00.98
H0590.771.95
H0750.71.95
H0080.183.9

Abbreviation: MBEC, minimum biofilm eradication concentration.

4.3. Expression evaluation of CAT1, EFG1, and BCR1 Genes in Candida albicans Isolates

RNA extraction from biofilm was successfully performed before and after the treatment with one concentration less than MBEC of PHE. Real-time PCR was run using specific primers (CAT1, EFG1, and BCR1) and β-Actin as the internal control gene. Statistical analysis showed that biofilm formation was reduced in C. albicans cells exposed to PHE, after which the expression of CAT1 mRNA in C. albicans isolates was significantly down-regulated (P = 0.05). Although these treatments indicated a reduction in the expression of EFG1 and BCR1 genes (Figure 2), this difference was not statistically significant (Table 4). The minimum and maximum fold change in genes treated with PHE was related to CAT1 (0.038) and EFG1 (0.922) genes, respectively.
Fold changes in expression of <i>CAT1</i>, <i>EFG1</i>, and <i>BCR1</i> genes
Figure 2.

Fold changes in expression of CAT1, EFG1, and BCR1 genes

Table 4.P-Value and Fold-Change Before and After the Treatment of Clinical Isolates
GeneFold-Change Before Treatment Clinical IsolateFold-Change After Treatment Clinical IsolateP-Value
CAT110.0380.0068
EFG110.9220.5754
BCR110.8720.529

5. Discussion

Previous studies have demonstrated that biofilm drug resistance is a multifactorial phenomenon influenced by factors such as the extent of matrix formation, biofilm composition, and the simultaneous presence of bacteria in the biofilm, which can lead to clinical complications in antifungal therapies (27). Treatment failure indicates the importance of research on new antifungal compounds (28). Natural products such as medicinal herbs appear to be the most promising antifungal treatments (23). Peganum harmala L. is a medicinal plant with numerous documented pharmacological properties (29, 30). The main β-carboline alkaloids of P. harmala seeds are harmine (7-methoxy-1-methyl-9H-pyrido [3, 4-b] indole) and harmaline (4, 9-dihydro-7-methoxy-1-methyl-3H-pyrido [3, 4-b] indole) that play an important role in pharmacological properties of P. harmala (31). Hitherto, Aboualigalehdari et al.'s study is the only research investigating the anti-biofilm properties of P. harmala against C. albicans (15). We aimed to identify the anti-biofilm mechanisms of PHE. Therefore, the effect of PHE was evaluated against the biofilm from 33 C. albicans clinical isolates. Anti-biofilm properties of PHE were confirmed in most isolates, consistent with previous studies’ results (15, 32).
Mean fold change in the expression of EFG1 and BCR1 genes decreased before and after the treatment with the extract; however, contrary to expectations, our results did not demonstrate significant differences with p-values of 0.5754 and 0.529, respectively. CAT1 expression was significantly reduced in C. albicans biofilm treated with PHE (P = 0.0068). CAT1, the gene encoding the catalase enzyme, is essential in enhancing the tolerance against oxidative stress (33) and is required for ROS detoxification in C. albicans (34). CAT1 is also involved in the initial stages of C. albicans attachment to surfaces. Therefore, CAT1 mutants are not able to form a biofilm (35). Previous investigations show that antifungals affecting Candida biofilm, such as miconazole and AMB, affect ROS. Several studies have demonstrated that as well as inhibiting ergosterol biosynthesis, miconazole induces accumulation of ROS in C. albicans planktonic cells, possibly due to the inhibition of the enzymes involved in the degradation of peroxide radicals and H2O2 by miconazole (33, 36). One of these enzymes is catalase, which is involved in the breakdown of H2O2 (9). Peganum harmala extract is likely to accumulate H2O2 by reducing CAT1 expression and hence disturbing the pro-oxidant/antioxidant balance that leads to the overproduction of ROS, causing damage to cellular components and eventual destruction of C. albicans biofilm. These results may indicate that P. harmala and miconazole have similar anti-biofilm mechanisms.
Amphotericin B is another fungicidal that leads to the accumulation of ROS and apoptosis in C. albicans biofilm through interaction with ergosterol and subsequent pore formation (37). De Brucker et al. used SOD inhibitors to reinforce AmB activity against C. albicans biofilm (37). To the best of our knowledge, this study is the first research to identify the anti-biofilm mechanism of P. harmala; therefore, future studies should investigate the synergistic effects of PHE and AMB to enhance the anti-biofilm activity and the expression of SOD genes before and after treatment of C. albicans biofilm with PHE.

5.1. Conclusions

Our results demonstrated that PHE significantly decreased CAT1 expression in C. albicans cells treated with the herbal extract. PHE appears to accumulate H2O2 by reducing CAT1 expression, thus impairing pro-oxidant/antioxidant balance and leading to the overproduction of ROS, which can damage cellular components and eventually eliminate the C. albicans biofilm.

Acknowledgments

Footnotes

References

  • 1.
    Traboulsi RS, Mukherjee PK, Chandra J, Salata RA, Jurevic R, Ghannoum MA. Gentian violet exhibits activity against biofilms formed by oral Candida isolates obtained from HIV-infected patients. Antimicrob Agents Chemother. 2011;55(6):3043-5. [PubMed ID: 21444708]. [PubMed Central ID: PMC3101405]. https://doi.org/10.1128/AAC.01601-10.
  • 2.
    Flint SR, Tappuni A, Leigh J, Schmidt-Westhausen AM, MacPhail L. (B3) Markers of immunodeficiency and mechanisms of HAART therapy on oral lesions. Adv Dent Res. 2006;19(1):146-51. [PubMed ID: 16672565]. https://doi.org/10.1177/154407370601900126.
  • 3.
    Patil S, Majumdar B, Sarode SC, Sarode GS, Awan KH. Oropharyngeal candidosis in HIV-infected patients-an update. Front Microbiol. 2018;9:980. [PubMed ID: 29867882]. [PubMed Central ID: PMC5962761]. https://doi.org/10.3389/fmicb.2018.00980.
  • 4.
    Puri S, Kumar R, Rojas IG, Salvatori O, Edgerton M. Iron chelator deferasirox reduces Candida albicans invasion of oral epithelial cells and infection levels in murine oropharyngeal candidiasis. Antimicrob Agents Chemother. 2019;63(4):e02152-18. [PubMed ID: 30718249]. [PubMed Central ID: PMC6437492]. https://doi.org/10.1128/AAC.02152-18.
  • 5.
    Lohse MB, Gulati M, Johnson AD, Nobile CJ. Development and regulation of single- and multi-species Candida albicans biofilms. Nat Rev Microbiol. 2018;16(1):19-31. [PubMed ID: 29062072]. [PubMed Central ID: PMC5726514]. https://doi.org/10.1038/nrmicro.2017.107.
  • 6.
    Bhattacharyya A, Chattopadhyay R, Mitra S, Crowe SE. Oxidative stress: an essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol Rev. 2014;94(2):329-54. [PubMed ID: 24692350]. [PubMed Central ID: PMC4044300]. https://doi.org/10.1152/physrev.00040.2012.
  • 7.
    Kuloyo O, Fourie R, Cason E, Albertyn J, Pohl CH. Transcriptome analyses of Candida albicans biofilms, exposed to arachidonic acid and fluconazole, indicates potential drug targets. G3 Genes Genomes Genet. 2020;10(9):3099-108. https://doi.org/10.1534/g3.120.401340.
  • 8.
    Enjalbert B, MacCallum DM, Odds FC, Brown AJ. Niche-specific activation of the oxidative stress response by the pathogenic fungus Candida albicans. Infect Immun. 2007;75(5):2143-51. [PubMed ID: 17339352]. [PubMed Central ID: PMC1865731]. https://doi.org/10.1128/IAI.01680-06.
  • 9.
    Fernandes PN, Mannarino SC, Silva CG, Pereira MD, Panek AD, Eleutherio EC. Oxidative stress response in eukaryotes: effect of glutathione, superoxide dismutase and catalase on adaptation to peroxide and menadione stresses in Saccharomyces cerevisiae. Redox Rep. 2007;12(5):236-44. [PubMed ID: 17925096]. https://doi.org/10.1179/135100007X200344.
  • 10.
    Nobile CJ, Fox EP, Nett JE, Sorrells TR, Mitrovich QM, Hernday AD, et al. A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell. 2012;148(1-2):126-38. [PubMed ID: 22265407]. [PubMed Central ID: PMC3266547]. https://doi.org/10.1016/j.cell.2011.10.048.
  • 11.
    Guevara-Lora I, Bras G, Karkowska-Kuleta J, Gonzalez-Gonzalez M, Ceballos K, Sidlo W, et al. Plant-derived substances in the fight against infections caused by candida species. Int J Mol Sci. 2020;21(17):6131. [PubMed ID: 32854425]. [PubMed Central ID: PMC7504544]. https://doi.org/10.3390/ijms21176131.
  • 12.
    Alam MZ, Ahmad Khan MS. Phytomedicine from Middle Eastern countries: An alternative remedy to modern medicine against Candida spp infection. Evid Based Complement Alternat Med. 2021;2021:6694876. [PubMed ID: 34335836]. [PubMed Central ID: PMC8298167]. https://doi.org/10.1155/2021/6694876.
  • 13.
    Moloudizargari M, Mikaili P, Aghajanshakeri S, Asghari MH, Shayegh J. Pharmacological and therapeutic effects of Peganum harmala and its main alkaloids. Pharmacogn Rev. 2013;7(14):199-212. [PubMed ID: 24347928]. [PubMed Central ID: PMC3841998]. https://doi.org/10.4103/0973-7847.120524.
  • 14.
    Motamedifar M, Khosropanah H, Dabiri S. Antimicrobial activity of Peganum harmala L. on Streptococcus mutans compared to 0.2% chlorhexidine. J Dent (Shiraz). 2016;17(3):213-8. [PubMed ID: 27602397]. [PubMed Central ID: PMC5006831].
  • 15.
    Aboualigalehdari E, Sadeghifard N, Taherikalani M, Zargoush Z, Tahmasebi Z, Badakhsh B, et al. Anti-biofilm properties of Peganum harmala against Candida albicans. Osong Public Health Res Perspect. 2016;7(2):116-8. [PubMed ID: 27169010]. [PubMed Central ID: PMC4850400]. https://doi.org/10.1016/j.phrp.2015.12.010.
  • 16.
    Lau AF, Kabir M, Chen SC, Playford EG, Marriott DJ, Jones M, et al. Candida colonization as a risk marker for invasive candidiasis in mixed medical-surgical intensive care units: development and evaluation of a simple, standard protocol. J Clin Microbiol. 2015;53(4):1324-30. [PubMed ID: 25673797]. [PubMed Central ID: PMC4365204]. https://doi.org/10.1128/JCM.03239-14.
  • 17.
    Abraham SB, Al Marzooq F, Himratul-Aznita WH, Ahmed HMA, Samaranayake LP. Prevalence, virulence and antifungal activity of C. albicans isolated from infected root canals. BMC Oral Health. 2020;20(1):347. [PubMed ID: 33256696]. [PubMed Central ID: PMC7708210]. https://doi.org/10.1186/s12903-020-01347-5.
  • 18.
    Mohammadi R, Mirhendi H, Rezaei-Matehkolaei A, Ghahri M, Shidfar MR, Jalalizand N, et al. Molecular identification and distribution profile of Candida species isolated from Iranian patients. Med Mycol. 2013;51(6):657-63. [PubMed ID: 23470036]. https://doi.org/10.3109/13693786.2013.770603.
  • 19.
    Abubakar AR, Haque M. Preparation of medicinal plants: Basic extraction and fractionation procedures for experimental purposes. J Pharm Bioallied Sci. 2020;12(1):1-10. [PubMed ID: 32801594]. [PubMed Central ID: PMC7398001]. https://doi.org/10.4103/jpbs.JPBS_175_19.
  • 20.
    Pierce CG, Uppuluri P, Tristan AR, Wormley Jr FL, Mowat E, Ramage G, et al. A simple and reproducible 96-well plate-based method for the formation of fungal biofilms and its application to antifungal susceptibility testing. Nat Protoc. 2008;3(9):1494-500. [PubMed ID: 18772877]. [PubMed Central ID: PMC2741160]. https://doi.org/10.1038/nport.2008.141.
  • 21.
    Manilal A, Sabu KR, Shewangizaw M, Aklilu A, Seid M, Merdikios B, et al. In vitro antibacterial activity of medicinal plants against biofilm-forming methicillin-resistant Staphylococcus aureus: efficacy of Moringa stenopetala and Rosmarinus officinalis extracts. Heliyon. 2020;6(1):e03303. [PubMed ID: 32051871]. [PubMed Central ID: PMC7002849]. https://doi.org/10.1016/j.heliyon.2020.e03303.
  • 22.
    Thieme L, Hartung A, Tramm K, Klinger-Strobel M, Jandt KD, Makarewicz O, et al. MBEC versus MBIC: The lack of differentiation between biofilm reducing and inhibitory effects as a current problem in biofilm methodology. Biol Proced Online. 2019;21:18. [PubMed ID: 31528123]. [PubMed Central ID: PMC6743098]. https://doi.org/10.1186/s12575-019-0106-0.
  • 23.
    Baghini GS, Sepahi AA, Tabatabaei RR, Tahvildari K. The combined effects of ethanolic extract of Artemisia aucheri and Artemisia oliveriana on biofilm genes expression of methicillin resistant Staphylococcus aureus. Iran J Microbiol. 2018;10(6):417-23. [PubMed ID: 30873270]. [PubMed Central ID: PMC6414741].
  • 24.
    Nikoomanesh F, Roudbarmohammadi S, Roudbary M, Bayat M, Heidari G. Investigation of bcr1 gene expression in Candida albicans isolates by RT-PCR technique and its impact on biofilm formation. Infect Epidemiol Med. 2016;2(1):22-4. https://doi.org/10.18869/modares.iem.2.1.22.
  • 25.
    Moazeni M, Khoramizadeh MR, Teimoori-Toolabi L, Noorbakhsh F, Rezaie S. The effect of EFG1 gene silencing on down-regulation of SAP5 gene, by use of RNAi technology. Acta Med Iran. 2014;52(1):9-14. [PubMed ID: 24658980].
  • 26.
    Alonso GC, Pavarina AC, Sousa TV, Klein MI. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples. J Microbiol Methods. 2018;147:1-13. [PubMed ID: 29454005]. https://doi.org/10.1016/j.mimet.2018.02.010.
  • 27.
    Aslani P, Roudbar Mohammadi S, Roudbary M. Novel formulated zinc oxide nanoparticles reduce Hwp1 Gene expression involved in biofilm formation in Candida albicans with minimum cytotoxicity effect on human cells. Jundishapur J Microbiol. 2018;11(10):e79562. https://doi.org/10.5812/jjm.79562.
  • 28.
    Khajeh E, Hosseini Shokouh SJ, Rajabibazl M, Roudbary M, Rafiei S, Aslani P, et al. Antifungal effect of Echinophora platyloba on expression of CDR1 and CDR2 genes in fluconazole-resistant Candida albicans. Br J Biomed Sci. 2016;73(1):44-8. [PubMed ID: 27182677]. https://doi.org/10.1080/09674845.2016.1155269.
  • 29.
    Jalali A, Dabaghian F, Zarshenas MM. Alkaloids of Peganum harmala: Anticancer biomarkers with promising outcomes. Curr Pharm Des. 2021;27(2):185-96. [PubMed ID: 33238864]. https://doi.org/10.2174/1381612826666201125103941.
  • 30.
    Nenaah G. Antibacterial and antifungal activities of (beta)-carboline alkaloids of Peganum harmala (L) seeds and their combination effects. Fitoterapia. 2010;81(7):779-82. [PubMed ID: 20398742]. https://doi.org/10.1016/j.fitote.2010.04.004.
  • 31.
    Li SP, Wang YW, Qi SL, Zhang YP, Deng G, Ding WZ, et al. Analogous beta-carboline alkaloids harmaline and harmine ameliorate scopolamine-induced cognition dysfunction by attenuating acetylcholinesterase activity, oxidative stress, and inflammation in mice. Front Pharmacol. 2018;9:346. [PubMed ID: 29755345]. [PubMed Central ID: PMC5932362]. https://doi.org/10.3389/fphar.2018.00346.
  • 32.
    Jalili M, Amraei M, Sadeghifard N, Ghafourian S. Evaluation of biofilm formation and anti-biofilm properties of Peganum harmala and crocus sativus in Shigella flexneri clinical isolates. Open Microbiol J. 2019;13(1):297-300. https://doi.org/10.2174/1874285801913010297.
  • 33.
    De Cremer K, De Brucker K, Staes I, Peeters A, Van den Driessche F, Coenye T, et al. Stimulation of superoxide production increases fungicidal action of miconazole against Candida albicans biofilms. Sci Rep. 2016;6:27463. [PubMed ID: 27272719]. [PubMed Central ID: PMC4895440]. https://doi.org/10.1038/srep27463.
  • 34.
    Komalapriya C, Kaloriti D, Tillmann AT, Yin Z, Herrero-de-Dios C, Jacobsen MD, et al. Integrative model of oxidative stress adaptation in the fungal pathogen Candida albicans. PLoS One. 2015;10(9):e0137750. [PubMed ID: 26368573]. [PubMed Central ID: PMC4569071]. https://doi.org/10.1371/journal.pone.0137750.
  • 35.
    Hinsa-Leasure SM, Koid C, Tiedje JM, Schultzhaus JN. Biofilm formation by Psychrobacter arcticus and the role of a large adhesin in attachment to surfaces. Appl Environ Microbiol. 2013;79(13):3967-73. [PubMed ID: 23603675]. [PubMed Central ID: PMC3697580]. https://doi.org/10.1128/AEM.00867-13.
  • 36.
    Bink A, Vandenbosch D, Coenye T, Nelis H, Cammue BP, Thevissen K. Superoxide dismutases are involved in Candida albicans biofilm persistence against miconazole. Antimicrob Agents Chemother. 2011;55(9):4033-7. [PubMed ID: 21746956]. [PubMed Central ID: PMC3165342]. https://doi.org/10.1128/AAC.00280-11.
  • 37.
    De Brucker K, Bink A, Meert E, Cammue BP, Thevissen K. Potentiation of antibiofilm activity of amphotericin B by superoxide dismutase inhibition. Oxid Med Cell Longev. 2013;2013:704654. [PubMed ID: 24078861]. [PubMed Central ID: PMC3774027]. https://doi.org/10.1155/2013/704654.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles