Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Induction of Viable but Non-culturable (VBNC) State in Shigella flexneri Under Osmotic and Nutritional Stresses at Low Temperature

Author(s):
Ali Nouri BaghiAli Nouri BaghiAli Nouri Baghi ORCID1,*, Mohammad Roayaei ArdakaniMohammad Roayaei ArdakaniMohammad Roayaei Ardakani ORCID1, Elham RezatofighiElham RezatofighiElham Rezatofighi ORCID1
1Department of Biology, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran

Jundishapur Journal of Microbiology:Vol. 17, issue 7; e147096
Published online:Sep 23, 2024
Article type:Research Article
Received:Apr 16, 2024
Accepted:Aug 03, 2024
How to Cite:Nouri Baghi A, Roayaei Ardakani M, Rezatofighi E. Induction of Viable but Non-culturable (VBNC) State in Shigella flexneri Under Osmotic and Nutritional Stresses at Low Temperature.Jundishapur J Microbiol.2024;17(7):e147096.https://doi.org/10.5812/jjm-147096.

Abstract

Background:

Viable but non-culturable (VBNC) is a specific physiological state in which living bacteria lose the ability to grow and form colonies on conventional bacterial growth media; however, these cells remain metabolically active.

Objectives:

Considering the importance of the pathogenicity of Shigella flexneri and the possibility of its transmission through contaminated water and food, we aimed to study the possibility of this bacterium entering the VBNC state under osmotic and nutritional stresses at low temperature (4°C).

Methods:

Shigella flexneri was inoculated in distilled water and NaCl solutions with concentrations of 0, 5, 10, 15, 20, 25, and 30% at 4°C. The cultivability of the bacteria was checked daily. After observing the loss of cultivability, entry into the VBNC state was assessed using RT-PCR, flow cytometry, and fluorescence microscopy.

Results:

After cultivation of S. flexneri in different concentrations of salt solution, the time of non-cultivability was observed at concentrations of 0, 5, 10, 15, 20, 25, and 30%, respectively, on days 19, 20, 21, 22, 22, 24, and 24. Expression results of ipaH and ipaD genes using RT-PCR, along with the presence of live cells detected by flow cytometry and fluorescent staining, indicated that the cells had entered the VBNC state.

Conclusions:

Shigella flexneri can survive and enter the VBNC state under nutritional and osmotic stresses at low temperatures (4°C). In this state, although the bacterium is alive, it cannot be detected by conventional culture-dependent methods. Due to the potential risk of bacterial recovery, conventional techniques may be insufficient to detect the presence of pathogens in the VBNC state when evaluating water and food.

1. Background

The viable but non-culturable (VBNC) state is a microbial survival strategy in response to unfavorable physicochemical conditions, characterized by the loss of culturability of microbial cells in standard culture media while maintaining their metabolic activity (1). Bacterial cells are capable of entering the VBNC state in response to various physicochemical stresses, including starvation (2), incubation outside the natural growth temperature range (3-5), elevated and lowered osmotic concentrations (6, 7), mineral salts (8), exposure to UV radiation (9), heavy metals (10), food preservatives (11, 12), etc. Unlike laboratory conditions, bacteria in nature spend most of their lives starved or nutrient-limited. Over the past two decades, microbial ecologists have stated that less than 1% of all bacteria present in nature can grow on conventional bacterial culture media. Some believe that one reason for this is the entry of bacteria into the VBNC state (13).

Shigella flexneri is highly host-adapted and only infects humans and some other mammals. Shigella flexneri is the main agent of shigellosis (bacillary dysentery), a clinical syndrome caused by the invasion of Shigella species into the epithelial lining of the distal ileum, colon, and rectum (14). The World Health Organization's analysis of foodborne diseases showed that annually 600 million cases are attributed to 31 etiological agents from 2007 to 2015. Approximately 51 million people are infected with Shigella (15). Shigella flexneri is the most common species isolated worldwide (16) and accounts for 65.9% of all cases of shigellosis in a multicenter global study (17). One of the main challenges related to this pathogen is its very low infectious dose; in humans, approximately 10-100 Shigella cells can cause shigellosis. However, 9 × 108 organisms are required to produce shigellosis in rats, which indicates that humans are highly sensitive to this pathogen (18).

Shigella flexneri has a relatively stable genome and acquired the virulence plasmid (Virulence plasmid pINV) early in its evolution (19). The majority of the important virulence factors involved in the Shigella life cycle are localized to a 30 kb region termed the “entry region” on the pINV plasmid (20). This region encodes the type 3 secretion system (T3SS) and Invasion plasmid antigen (Ipa) proteins, which play a key role in initiating the invasion process and pathogenesis of Shigella (21, 22). Ipa proteins are identified as key virulence factors for Shigella infection. The T3SS injects effector proteins into host cells to manipulate the host cell machinery for the benefit of the bacterium (22). At the tip of the T3SS apparatus (T3SA) needle, the IpaD effector protein is polymerized as a homopentamer and is necessary for the control of virulence and secretion of effector proteins (23). Studies have shown that deletion of ipaD not only leads to excessive secretion of other effector proteins but also results in a non-invasive Shigella phenotype (24).

The ipaD gene is highly conserved among Shigella serotypes (ipaD: 96%) (25). The pINV plasmid contains other important genes located outside the “entry region”. The ipaH gene family plays a key role in the pathogenesis of Shigella and is responsible for post-invasion events (15). For example, the IpaH protein encoded by ipaH 7.8 gene helps induce pyroptosis and escape of Shigella from the macrophage phagosome (26, 27). Cultivation of food is one of the main ways to detect and control microbial load, but when the bacteria enter the VBNC state, this method loses its effectiveness (28). In recent years, concerns have been raised about the possibility of regeneration and pathogenicity of VBNC bacteria. Many foods are stored for extended periods in the refrigerator (4°C), and contamination of these foods with the VBNC form of pathogens can pose risks to consumers.

2. Objectives

The purpose of this study was to investigate the possibility of S. flexneri entering the VBNC state under osmotic and nutritional stresses at 4°C.

3. Methods

3.1. Bacterial Strain

Shigella flexneri with PTCC number 1865 (ATCC 12022) was purchased from the Iranian Research Organization for Science and Technology (IROST).

3.2. Viable but Non-culturable Induction

To investigate the possibility of S. flexneri entering the VBNC state, different salt (NaCl) solutions with concentrations of 0, 5, 10, 15, 20, 25, and 30% were prepared. A suspension of S. flexneri with a turbidity of 0.5 McFarland was prepared, and 100 μL of the suspension was added to 4.9 mL of each salt solution, then incubated at 4°C. Each experiment was performed in six replicates. Cultivability was tested by daily inoculation (one loop) of each solution onto BHI (Merck; Germany) medium enriched with 0.6% yeast extract and 1% sodium pyruvate. Inoculated media were incubated at 37°C for 16 - 24 hours. Cultivation of the solutions continued until no bacterial colonies were observed on the BHI medium, which was considered the point at which the bacteria had potentially entered the VBNC state.

3.3. Reverse Transcriptase (RT)-PCR Method

Considering that the half-life of bacterial mRNA is 3 to 5 minutes, the expression of mRNA in the non-cultivable state indicates the survival of bacteria and their entry into the VBNC state (29). Therefore, we investigated the presence of ipaH and ipaD gene mRNA. To achieve this, 1.5 mL of each solution containing VBNC bacteria was centrifuged at 7000 rpm for 5 minutes. The supernatant was removed, and the bacterial pellets were washed three times at 7000 rpm for 5 minutes.

3.3.1. RNA Extraction and cDNA Synthesis

RNA was extracted from the pellets using the DENA Zist Asia RNA extraction kit (Iran) according to the manufacturer's instructions. cDNA was synthesized using the DENA Zist Asia cDNA synthesis kit (Iran), following the manufacturer's recommendations.

3.3.2. PCR Assay

A PCR assay was performed to detect ipaD and ipaH. The primer sequences used in this assay are provided in Table 1. PCR amplification was carried out in a 20 μL reaction mixture containing 5 - 7 ng of template cDNA, 10 μL Master Mix (Ampliqon; Denmark), 0.3 μM of each forward and reverse primer, and distilled water up to 20 μL. The reaction conditions for both genes were as follows: Initial denaturation at 95°C for 4 minutes, followed by 34 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, and a final extension at 72°C for 5 minutes. After amplification, the products were analyzed by electrophoresis on a 2% agarose gel.

Table 1.Sequence of Primers Designed for RT-PCR
Primer NameSequence 5'→ 3'TmProduct Length (bp)
ipaH5895
FGTTGCTGCTGATGCCACTG
RCCTTCTGATGCCTGATGGAC
ipaD58206
FCGCTGTTCTTTCCAGTCTTGC
RCCTTGCCGATTGTTCCACCT

3.4. Fluorescent Staining Assay

To evaluate the entry of S. flexneri into the VBNC state using a fluorescence microscope, the non-cultivable bacterial samples were centrifuged at 13,000 rpm for 10 minutes and washed three times with PBS. Untreated bacteria served as the positive control, while bacteria treated with 70% ethyl alcohol were used as the negative control. After resuspending the bacterial pellets in 100 μL of PBS, 10 μL of bacteria were stained with 5 µL of fluorescent dyes, including 0.05 mg/mL acridine orange (AO, Merck) and 0.05 mg/mL propidium iodide (PI, Merck), in PBS under dark conditions for 20 minutes. Smears were prepared from the stained bacteria and observed under a fluorescence microscope (Olympus, Japan).

3.5. Flow Cytometry Assay

To evaluate the entry of S. flexneri into the VBNC state using a flow cytometry assay, the non-cultivable samples were centrifuged at 13,000 rpm for 10 minutes and washed three times with PBS. S. flexneri in the logarithmic phase were used to prepare negative and positive control samples, with the negative control containing live bacteria and the positive control containing dead bacteria (in terms of PI dye absorption and red fluorescence emission). Untreated bacteria served as the negative control, while bacteria treated with 70% ethyl alcohol were used as the positive control. The bacterial pellets were then resuspended in 100 µL of PBS, and 0.5 µL of PI were added to the cells and incubated at room temperature for 20 minutes in the dark. Samples were analyzed using a flow cytometer (BD FACSCalibur; USA) with a single laser emitting excitation light at 488 nm (30).

4. Results

4.1. Non-cultivable State

After the cultivation of S. flexneri in different concentrations of salt solutions, the time at which the bacteria became non-cultivable was observed at salt concentrations of 0, 5, 10, 15, 20, 25, and 30%, respectively, on days 19, 20, 21, 22, 22, 24, and 24. As the salt concentration increased, the time to non-cultivability was delayed.

4.2. RT-PCR

RT-PCR was performed to differentiate the non-cultivable state from bacterial death. For all treatments, the presence of mRNA related to the ipaH and ipaD genes was observed, indicating that the bacteria had entered the VBNC state (Figures 1 and 2).

Image of <i>ipaH</i> gene electrophoresis of <i>Shigella flexneri</i>. From right to left, negative control sample, treatments 0, 5, 10, 15, 20, 25 and 30% salt, positive control sample and marker 50 pairs, respectively
Figure 1.

Image of ipaH gene electrophoresis of Shigella flexneri. From right to left, negative control sample, treatments 0, 5, 10, 15, 20, 25 and 30% salt, positive control sample and marker 50 pairs, respectively

Image of <i>ipaD</i> gene electrophoresis of <i>Shigella flexneri.</i> From left to right, negative control sample, treatments 0, 5, 10, 15, 20, 25 and 30% salt, positive control sample and marker 50 pairs, respectively
Figure 2.

Image of ipaD gene electrophoresis of Shigella flexneri. From left to right, negative control sample, treatments 0, 5, 10, 15, 20, 25 and 30% salt, positive control sample and marker 50 pairs, respectively

4.3. Fluorescence Microscopic Results

Fluorescent staining of the samples on the 33rd day indicated the presence of living cells. In this case, living cells take up acridine orange (AO) and appear green, while dead cells take up propidium iodide (PI) and appear red. The presence of green cells confirms that S. flexneri has entered the VBNC state (Figure 3).

Florescent staining of <i>S. flexneri</i> in logarithmic phase (A) and VBNC state (B). The bacterial cells that appeared green (AO)/red (PI) when visualized under fluorescence microscopy were considered live/dead, respectively.
Figure 3.

Florescent staining of S. flexneri in logarithmic phase (A) and VBNC state (B). The bacterial cells that appeared green (AO)/red (PI) when visualized under fluorescence microscopy were considered live/dead, respectively.

4.4. Flow Cytometry Results

After S. flexneri became non-cultivable in the investigated treatments, flow cytometry was used to evaluate the bacteria's entry into the VBNC state. The analysis of the flow cytometry data revealed the presence of living S. flexneri cells on the 26th and 96th days of exposure to different salt concentrations (Table 2). These findings also indicated that the number of viable S. flexneri cells was higher in the presence of salt compared to when salt was absent.

Table 2.The Results of Flow Cytometry on the 26th and 96th Days After the Beginning of the Study. All, the Total Number of Cells Counted. M1, Cells Labeled with PI dye (Selective Labeling of Dead Cells)
Sample and Marker26th Day96th Day
Events% GatedEvents% Gated
Positive control
All10000100.0010000100.00
M1388238.82410641.06
NaCl 0%
All3472100.00475100.00
M197027.9410.21
NaCl 5%
All1031100.00198100.00
M1666.4000.00
NaCl 10%
All1967100.00169100.00
M11326.7100.00
NaCl 15%
All2870100.0026100.00
M12227.7400.00
NaCl 20%
All3837100.0015100.00
M13037.9000.00
NaCl 25%
All1564100.008100.00
M11489.4600.00
NaCl 30%
All3625100.0053100.00
M12687.3911.89
Negative control
All6235100.0010000100.00
M11121.801761.76

5. Discussion

After decades of research, the VBNC state has been recognized as an important bacterial survival strategy. A comprehensive understanding of the VBNC state and its underlying mechanisms is critical for ensuring the safety of drinking water and food. This study investigated the survival and viability of S. flexneri PTCC 1865 (ATCC 12022) under osmotic stress in nutrient-depleted conditions at 4°C, as food and water are typically stored at this temperature and may become contaminated from other contents in the refrigerator. The findings of this study indicated that S. flexneri is capable of surviving for extended periods in high NaCl concentration solutions at 4°C. Eventually, it enters the VBNC state and remains in this state for a prolonged duration.

The expression of the ipaD and ipaH genes, which are crucial for the pathogenicity of S. flexneri, following the bacteria's loss of cultivability, suggests their transition into the VBNC state. Moreover, the expression of ipaD in the VBNC state indicates the presence of the virulence plasmid pINV and the retention of pathogenic potential. Additionally, flow cytometry and microscopy results indicate that S. flexneri gradually transitions into the death phase of growth, even when exposed to high salt stress. Shigella flexneri can remain in the VBNC state for an extended period before entering the death phase. The results of the present study are consistent with those of other studies on this subject.

Oliveira et al. reported that S. flexneri 2a does not completely lose cultivability under long-term induction; however, a portion of its population enters the VBNC state. They found that short-term induction resulted in the rapid entry of S. flexneri cells into the VBNC state. They also suggested that low temperatures (4°C) used in nutritional and osmotic stresses can induce the VBNC state while allowing cells to maintain cultivability and viability for a longer period (31). In another study, researchers detected significant quantities of VBNC pathogenic bacteria, including Shigella sp., Escherichia coli, Salmonella sp., Enterococcus faecalis, and Pseudomonas aeruginosa in full-scale drinking water treatment plants. They emphasized that traditional culture-based methods are insufficient for detecting VBNC bacteria (32). Islam et al. (1993) observed that after inoculation of S. dysenteriae type 1 into laboratory microsomes, the bacteria became uncultivable after 2 - 3 weeks, while they entered the VBNC state and remained alive until the sixth week after the start of the study (33).

Islam et al. demonstrated that S. flexneri survived at pH 7.0 and 4°C in 0, 0.5, and 1% salt solutions for 27, 39, and 34 days, respectively (34). In another study, researchers revealed that after inoculating S. dysenteriae type 1 on some inanimate objects, the bacteria entered the VBNC state after 1.5 - 4 hours and remained detectable in this state for five days (35). Rahman et al. (1996) showed that S. dysenteriae type 1 can express the stx gene after entering the VBNC state, and the synthesized Shiga toxin retains its biological activity (36). Scientists explained that the activation of the type II toxin-antitoxin (TA) system in Shigella could partially maintain cell viability in the VBNC state. The TA system halts cell growth and helps Shigella persist under various mild stresses, such as osmotic, temperature, and nutritional stresses (37).

5.1. Conclusions

The results of the present study revealed that S. flexneri could survive and enter the VBNC state under nutritional and osmotic stresses at low temperature (4°C). In this state, although the bacteria are alive, they cannot be detected by conventional culture-dependent methods. The infectious dose of the enteropathogen S. flexneri is very low. The entry of S. flexneri into the VBNC state, coupled with the expression of the ipaD and ipaH genes and the presence of the virulence plasmid pINV, suggests that the bacteria retain their pathogenicity in this state. Furthermore, if the bacteria resuscitate from the VBNC state, it poses a potential risk to food safety and public health.

Acknowledgments

Footnotes

References

  • 1.
    Liu J, Yang L, Kjellerup BV, Xu Z. Viable but nonculturable (VBNC) state, an underestimated and controversial microbial survival strategy. Trends Microbiol. 2023;31(10):1013-23. [PubMed ID: 37225640]. https://doi.org/10.1016/j.tim.2023.04.009.
  • 2.
    Cook KL, Bolster CH. Survival of Campylobacter jejuni and Escherichia coli in groundwater during prolonged starvation at low temperatures. J Appl Microbiol. 2007;103(3):573-83. [PubMed ID: 17714390]. https://doi.org/10.1111/j.1365-2672.2006.03285.x.
  • 3.
    Li Y, Huang TY, Mao Y, Chen Y, Shi F, Peng R, et al. Study on the viable but non-culturable (VBNC) state formation of Staphylococcus aureus and its control in food system. Front Microbiol. 2020;11:599739. [PubMed ID: 33324380]. [PubMed Central ID: PMC7726111]. https://doi.org/10.3389/fmicb.2020.599739.
  • 4.
    Besnard V, Federighi M, Declerq E, Jugiau F, Cappelier JM. Environmental and physico-chemical factors induce VBNC state in Listeria monocytogenes. Vet Res. 2002;33(4):359-70. [PubMed ID: 12199363]. https://doi.org/10.1051/vetres:2002022.
  • 5.
    Wong HC, Wang P, Chen SY, Chiu SW. Resuscitation of viable but non-culturable Vibrio parahaemolyticus in a minimum salt medium. FEMS Microbiol Lett. 2004;233(2):269-75. [PubMed ID: 15063495]. https://doi.org/10.1016/j.femsle.2004.02.015.
  • 6.
    Li Y, Huang TY, Ye C, Chen L, Liang Y, Wang K, et al. Formation and control of the viable but non-culturable state of foodborne pathogen Escherichia coli O157:H7. Front Microbiol. 2020;11:1202. [PubMed ID: 32612584]. [PubMed Central ID: PMC7308729]. https://doi.org/10.3389/fmicb.2020.01202.
  • 7.
    Asakura H, Kawamoto K, Haishima Y, Igimi S, Yamamoto S, Makino S. Differential expression of the outer membrane protein W (OmpW) stress response in enterohemorrhagic Escherichia coli O157:H7 corresponds to the viable but non-culturable state. Res Microbiol. 2008;159(9-10):709-17. [PubMed ID: 18824229]. https://doi.org/10.1016/j.resmic.2008.08.005.
  • 8.
    Robben C, Fister S, Witte AK, Schoder D, Rossmanith P, Mester P. Induction of the viable but non-culturable state in bacterial pathogens by household cleaners and inorganic salts. Sci Rep. 2018;8(1):15132. [PubMed ID: 30310128]. [PubMed Central ID: PMC6181970]. https://doi.org/10.1038/s41598-018-33595-5.
  • 9.
    Xu L, Zhang C, Xu P, Wang XC. Mechanisms of ultraviolet disinfection and chlorination of Escherichia coli: Culturability, membrane permeability, metabolism, and genetic damage. J Environ Sci (China). 2018;65:356-66. [PubMed ID: 29548407]. https://doi.org/10.1016/j.jes.2017.07.006.
  • 10.
    Aurass P, Prager R, Flieger A. EHEC/EAEC O104:H4 strain linked with the 2011 German outbreak of haemolytic uremic syndrome enters into the viable but non-culturable state in response to various stresses and resuscitates upon stress relief. Environ Microbiol. 2011;13(12):3139-48. [PubMed ID: 21951606]. https://doi.org/10.1111/j.1462-2920.2011.02604.x.
  • 11.
    Cunningham E, O'Byrne C, Oliver JD. Effect of weak acids on Listeria monocytogenes survival: Evidence for a viable but nonculturable state in response to low pH. Food Control. 2009;20(12):1141-4.
  • 12.
    Quirós C, Herrero M, García LA, Díaz M. Quantitative approach to determining the contribution of viable-but-nonculturable subpopulations to malolactic fermentation processes. Appl Environ Microbiol. 2009;75(9):2977-81. [PubMed ID: 19270138]. [PubMed Central ID: PMC2681708]. https://doi.org/10.1128/aem.01707-08.
  • 13.
    Hassanshahian M, Kasra Kermanshahi R. [Introduce of Viable But Nonculturable Bacteria]. J Water Wastewater. 2008;19(1):54-62. FA.
  • 14.
    Kotloff KL, Riddle MS, Platts-Mills JA, Pavlinac P, Zaidi AKM. Shigellosis. Lancet. 2018;391(10122):801-12. [PubMed ID: 29254859]. https://doi.org/10.1016/s0140-6736(17)33296-8.
  • 15.
    Bliven K, Lampel KA. Shigella. In: Dodd CER, Aldsworth T, Stein R, Cliver DO, Riemann HP, editors. Foodborne Diseases. London: Academic Press; 2017. p. 171-88.
  • 16.
    Lampel KA. Shigella: Introduction and detection by classical cultural and molecular techniques. In: Batt CA, Tortorello ML, editors. Encyclopedia of Food Microbiology. 2. 2nd ed. United States: Academic Press; 2014. p. 408-14.
  • 17.
    Caitlin E. Gabor, Tracy H. Hazen, BreOnna C. Delaine-Elias, David A. Rasko, Eileen M. Barry. Genomic, transcriptomic, and phenotypic differences among archetype Shigella flexneri strains of serotypes 2a, 3a, and 6. mSphere. 2023;8(6):e00408-23. https://doi.org/10.1128/msphere.00408-23.
  • 18.
    Kamgang R, Pouokam KE, Fonkoua MC, Penlap NB, Biwolé SM. Shigella dysenteriae type 1-induced diarrhea in rats. Jpn J Infect Dis. 2005;58(6):335-7. [PubMed ID: 16377862].
  • 19.
    Pilla G, Arcari G, Tang CM, Carattoli A. Virulence plasmid pINV as a genetic signature for Shigella flexneri phylogeny. Microb Genom. 2022;8(6). [PubMed ID: 35759406]. [PubMed Central ID: PMC9455713]. https://doi.org/10.1099/mgen.0.000846.
  • 20.
    Mattock E, Blocker AJ. How Do the Virulence Factors of Shigella Work Together to Cause Disease? Front Cell Infect Microbiol. 2017;7:64. [PubMed ID: 28393050]. [PubMed Central ID: PMC5364150]. https://doi.org/10.3389/fcimb.2017.00064.
  • 21.
    Li S, Han X, Upadhyay I, Zhang W. Characterization of Functional B-Cell Epitopes at the Amino Terminus of Shigella Invasion Plasmid Antigen B (IpaB). Appl Environ Microbiol. 2022;88(15). e0038422. [PubMed ID: 35856689]. [PubMed Central ID: PMC9361828]. https://doi.org/10.1128/aem.00384-22.
  • 22.
    Muthuramalingam M, Whittier SK, Picking WL, Picking WD. The The Shigella type III secretion system: An overview from top to bottom. Microorganisms. 2021;9(2). [PubMed ID: 33671545]. [PubMed Central ID: PMC7926512]. https://doi.org/10.3390/microorganisms9020451.
  • 23.
    Espina M, Olive AJ, Kenjale R, Moore DS, Ausar SF, Kaminski RW, et al. IpaD localizes to the tip of the type III secretion system needle of Shigella flexneri. Infect Immun. 2006;74(8):4391-400. [PubMed ID: 16861624]. [PubMed Central ID: PMC1539624]. https://doi.org/10.1128/iai.00440-06.
  • 24.
    Hearn PD. Secretion regulation of invasion plasmid antigens C and D (IpaC and IpaD) of Shigella flexneri. University of Kansas, Molecular Bioscience; 2003. 156 p.
  • 25.
    Lu T, Das S, Howlader DR, Jain A, Hu G, Dietz ZK, et al. Impact of the TLR4 agonist BECC438 on a novel vaccine formulation against Shigella spp. Front Immunol. 2023;14:1194912. [PubMed ID: 37744341]. [PubMed Central ID: PMC10512073]. https://doi.org/10.3389/fimmu.2023.1194912.
  • 26.
    Ashida H, Mimuro H, Sasakawa C. Shigella manipulates host immune responses by delivering effector proteins with specific roles. Front Immunol. 2015;6:219. [PubMed ID: 25999954]. [PubMed Central ID: PMC4423471]. https://doi.org/10.3389/fimmu.2015.00219.
  • 27.
    Suzuki S, Mimuro H, Kim M, Ogawa M, Ashida H, Toyotome T, et al. Shigella IpaH7.8 E3 ubiquitin ligase targets glomulin and activates inflammasomes to demolish macrophages. Proc Natl Acad Sci U S A. 2014;111(40):E4254-63. [PubMed ID: 25246571]. [PubMed Central ID: PMC4210038]. https://doi.org/10.1073/pnas.1324021111.
  • 28.
    Ramamurthy T, Ghosh A, Pazhani GP, Shinoda S. Current perspectives on viable but non-culturable (VBNC) pathogenic bacteria. Front Public Health. 2014;2:103. [PubMed ID: 25133139]. [PubMed Central ID: PMC4116801]. https://doi.org/10.3389/fpubh.2014.00103.
  • 29.
    Conway T, Gary K. Microarray expression profiling: capturing a genome-wide portrait of the transcriptome. Molecular Microbiology. 2003;47(4):879-89. https://doi.org/10.1046/j.1365-2958.2003.03338.x.
  • 30.
    Kuthati Y, Kankala RK, Busa P, Lin SX, Deng JP, Mou CY, et al. Phototherapeutic spectrum expansion through synergistic effect of mesoporous silica trio-nanohybrids against antibiotic-resistant gram-negative bacterium. J Photochem Photobiol B. 2017;169:124-33. [PubMed ID: 28319867]. https://doi.org/10.1016/j.jphotobiol.2017.03.003.
  • 31.
    Oliveira MM, De Almeida FA, Baglinière F, De Oliveira LL, Vanetti MCD. Behavior of Salmonella Enteritidis and Shigella flexneri during induction and recovery of the viable but nonculturable state. FEMS Microbiol Lett. 2021;368(14). [PubMed ID: 34227668]. https://doi.org/10.1093/femsle/fnab087.
  • 32.
    Guo L, Wan K, Zhu J, Ye C, Chabi K, Yu X. Detection and distribution of vbnc/viable pathogenic bacteria in full-scale drinking water treatment plants. J Hazard Mater. 2021;406:124335. [PubMed ID: 33160785]. https://doi.org/10.1016/j.jhazmat.2020.124335.
  • 33.
    Islam MS, Hasan MK, Miah MA, Sur GC, Felsenstein A, Venkatesan M, et al. Use of the polymerase chain reaction and fluorescent-antibody methods for detecting viable but nonculturable Shigella dysenteriae type 1 in laboratory microcosms. Appl Environ Microbiol. 1993;59(2):536-40. [PubMed ID: 8434918]. [PubMed Central ID: PMC202139]. https://doi.org/10.1128/aem.59.2.536-540.1993.
  • 34.
    Islam MS, Rezwan FB, Khan SI. Survival of Shigella flexneri in artificial aquatic environment: effects of different physicochemical stress factors. J Diarrhoeal Dis Res. 1996;14(1):37-40. [PubMed ID: 8708331].
  • 35.
    Islam MS, Hossain MZ, Khan SI, Felsenstein A, Sack RB, Albert MJ. Detection of non-culturable Shigella dysenteriae 1 from artificially contaminated volunteers' fingers using fluorescent antibody and PCR techniques. J Diarrhoeal Dis Res. 1997;15(2):65-70. [PubMed ID: 9360343].
  • 36.
    Rahman I, Shahamat M, Chowdhury MA, Colwell RR. Potential virulence of viable but nonculturable Shigella dysenteriae type 1. Appl Environ Microbiol. 1996;62(1):115-20. [PubMed ID: 8572688]. [PubMed Central ID: PMC167780]. https://doi.org/10.1128/aem.62.1.115-120.1996.
  • 37.
    Yang QE, Walsh TR. Toxin-antitoxin systems and their role in disseminating and maintaining antimicrobial resistance. FEMS Microbiol Rev. 2017;41(3):343-53. [PubMed ID: 28449040]. [PubMed Central ID: PMC5812544]. https://doi.org/10.1093/femsre/fux006.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles