Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Genotyping and Antifungal Susceptibility Testing of Aspergillus flavus Isolated from Clinical Specimens

Author(s):
Leila DehqanLeila Dehqan1, Ayatollah Nasrollahi OmranAyatollah Nasrollahi OmranAyatollah Nasrollahi Omran ORCID1,*, Mojtaba Taghizadeh ArmakiMojtaba Taghizadeh ArmakiMojtaba Taghizadeh Armaki ORCID2, Masoud  Hashemi KarouiMasoud Hashemi KarouiMasoud  Hashemi Karoui ORCID3, Saeid Mahdavi OmranSaeid Mahdavi OmranSaeid Mahdavi Omran ORCID2
1Department of Mycology, Faculty of Medical Sciences, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran
2Infectious Disease and Tropical Medicine Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran
3Department of Veterinary Medicine, Babol Branch, Islamic Azad University, Babol, Iran

Jundishapur Journal of Microbiology:Vol. 17, issue 10; e150338
Published online:Oct 27, 2024
Article type:Research Article
Received:Jun 30, 2024
Accepted:Oct 10, 2024
How to Cite:Dehqan L, Nasrollahi Omran A, Taghizadeh Armaki M, Hashemi Karoui M, Mahdavi Omran S. Genotyping and Antifungal Susceptibility Testing of Aspergillus flavus Isolated from Clinical Specimens. Jundishapur J Microbiol. 2024;17(10):e150338. doi: https://doi.org/10.5812/jjm-150338

Abstract

Background:

After Aspergillus fumigatus, A. flavus is the second leading cause of invasive and non-invasive aspergillosis. These fungi are of significant epidemiological importance in provinces with dry and hot climates.

Objectives:

In the present study, antifungal susceptibility testing (AFST) and genotyping of sixty-five A. flavus clinical isolates originating from patients in Mazandaran and Tehran were performed.

Methods:

Antifungal susceptibility testing of 65 clinical isolates of A. flavus was conducted against amphotericin B (AMB), itraconazole (ITR), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA), luliconazole (LUL), lanoconazole (LAN), and 5-fluorocytosine according to the Clinical Laboratory Standards Institute (CLSI) method (M38-A2). The minimum inhibitory concentrations (MICs) were determined for each antifungal drug against all strains. Additionally, microsatellite typing using six variable number tandem repeat (VNTR) markers was performed to assess the genetic diversity and potential relationships among the clinical strains.

Results:

Luliconazole had the lowest geometric mean MIC (0.020 μg/mL), followed by LAN (0.021 μg/mL), POS (0.089 μg/mL), ISA (0.115 μg/mL), ITR (0.220 μg/mL), VOR (0.244 μg/mL), AMB (0.870 μg/mL), and 5-fluorocytosine (58.76 μg/mL). Microsatellite typing revealed sixty-five distinct sequence genotypes. Statistically, there was no significant relationship between genotypes and AFST profiles (P ≥ 0.05).

Conclusions:

Luliconazole and lanoconazole demonstrated the greatest in vitro activity among all tested antifungals. However, most A. flavus strains exhibited reduced sensitivity to AMB. Microsatellite genotyping indicated no genetic similarity among the clinical strains, revealing high genetic diversity among A. flavus isolates obtained from clinical samples.

1. Background

The genus Aspergillus comprises more than 339 species of filamentous fungi, but only a few, including Aspergillus fumigatus, A. flavus, A. niger, A. terreus, and A. nidulans, are recognized as human pathogens (1, 2). Six species of the Aspergillus section Flavi, which are closely related both morphologically and phylogenetically, include A. flavus, A. parasiticus, A. nomius, A. oryzae, A. sojae, and A. tamarii (3, 4). The most common causative agent of aspergillosis is A. fumigatus; however, A. flavus is the second leading cause of invasive and non-invasive aspergillosis (5-9).
Aspergillus flavus can cause various clinical forms of infections, including otomycosis, keratitis, onychomycosis, sinusitis, bronchiectasis, and invasive aspergillosis (10). Whether specific isolates are preferentially associated with certain clinical manifestations of aspergillosis remains a critical unresolved question (11, 12). Molecular species typing methods, such as random amplification of polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), and multiple-locus variable number tandem repeat analysis (MLVA), are effective tools in microbiology laboratories and for monitoring hospital infections to determine genetic diversity (12, 13). The MLVA method identifies closely related strains for analyzing disease outbreaks and provides data on genetic diversity profiles (11, 14).
In recent years, antifungal agents such as itraconazole (ITR), amphotericin B (AMB), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA), and caspofungin (CAS) have been approved for the treatment of invasive and non-invasive aspergillosis (8, 15). However, triazole resistance is increasingly reported in clinical and environmental isolates of Aspergillus species worldwide (16). Luliconazole (LUL) and lanoconazole (LAN) are two new imidazole antifungals with broad-spectrum activity against common human fungal pathogens, including Malassezia spp., Trichophyton spp., Candida spp., and A. fumigatus (15). These antifungals have been approved by the US Food and Drug Administration (FDA) for the topical treatment of dermatophytosis (17). Antifungal susceptibility testing (AFST) procedures, following the guidelines of the European Committee on Antibiotic Susceptibility Testing (EUCAST) and the Clinical Laboratory Standards Institute (CLSI), are essential for detecting drug resistance and determining optimal therapies for invasive and non-invasive aspergillosis (8, 15).

2. Objectives

There is limited data on the genetic diversity and antifungal susceptibility profiles of clinical isolates of A. flavus from Iran. As a result the aim of the current study was to perform in vitro AFST and genotyping of clinical A. flavus strains using the MLVA method.

3. Methods

3.1. Sample Collection

This descriptive cross-sectional study was conducted over a period of 24 months (2021 - 2023). A total of 65 isolates of A. flavus were collected from clinical samples, including otomycosis (24 isolates, 36.92%), onychomycosis (17 isolates, 26.15%), bronchoalveolar lavage (BAL) (13 isolates, 20%), and sinus samples (11 isolates, 16.93%), from hospitals in Mazandaran and Tehran.

3.2. DNA Extraction

DNA extraction of A. flavus strains was performed using a glass bead and phenol:Chloroform:Isoamyl alcohol method (25:24:1, v/v) (Sigma-Aldrich, Germany). A fresh colony of A. flavus (2 - 5 days old, incubated at 35°C) was used. In each sterile microtube (1.5 mL), 200 microliters of lysis buffer (containing Triton X-100, 1% sodium dodecyl sulfate, 100 mM sodium chloride, 10 mM Tris-hydrochloric acid with pH = 8, 1 mM ethylenediaminetetraacetic acid (EDTA) with pH = 8) and 300 mg of glass beads (diameter 0.4 - 0.6 mm) were added.
A swab exposed to sterile distilled water was used to collect spores of A. flavus. The contents of the microtube were vortexed for 30 seconds and then incubated at 70°C for 30 minutes. Subsequently, 200 μL of the phenol:chloroform:isoamyl alcohol mixture was added. The microtube was incubated at 25°C for 5 minutes and centrifuged at 14,000 rpm for 10 minutes at 4°C. The optical density (OD) of the DNA samples (to measure the amount of DNA) was then determined using a spectrophotometric method. The extracted DNA was stored in a freezer at -20°C (18).

3.3. Strain Identification and PCR Sequencing

The strains were identified based on macroscopic and microscopic morphological features and confirmed through β-tubulin region sequence analysis, as described previously (19).

3.4. Multiple-Locus Variable Number Tandem Repeat Analysis Typing of Aspergillus flavus by Multiplex PCR Method

Multiple-locus variable number tandem repeat analysis typing was performed on all A. flavus strains using six VNTR markers (AFLA1, AFLA3, AFLA7, AFPM3, AFPM4, and AFPM7), as previously described by Hadrich et al. (11). The PCR amplification reaction, with a final volume of 25 µL, was prepared by combining 1 μL of extracted DNA, 1 μL of each primer at a concentration of 10 pmol/μL (Table 1), 12.5 μL of Taq DNA Polymerase 2x master mix red (Amplicon, Denmark), and 9.5 μL of distilled water.
Table 1.Characteristics of the Six Variable Number of Tandem Repeats Loci in the Aspergillus flavus Isolates
VNTR MarkersPrimer Sequences (5' to 3')Repeat UnitRange of Repeat NumberFragment Size
AFLA1F:CGTTGGCATGTTATCGTCACAC14180 - 290
R:CTACTGAATGGCGGGACCTA
AFLA3F:CTGAAAGGGTAAGGGGAAGGTAGG11164 - 272
R:CACGCGAACTTATGGGACTT
AFLA7F:GCGGACACTGGATGAATAGCTAG13121 - 293
R:AACAAATCGGTGGTTGCTTC
AFPM3F:CCTTTCGCACTCCGAGAC(AT)6AAGGGCG(GA)10188 - 274
R:CACCACCAGTGATGAGGG
AFPM4F:AGCGATACAGTTTTAACACCCA7184 - 210
R:TCTTGCTATACATATCTTCACC
AFPM7F:TTGAGGCTGCTGTGGAACGCAC13188 - 256
R:CAAATACCAATTACGTCCAACAAGGG

Abbreviations: VNTR, variable number of tandem repeats; F, forward; R, reverse.

The multiplex PCR reaction was carried out in a thermal cycler (Applied Biosystems Simpliamp, USA) following a specified thermal program: An initial denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 30 seconds, with a final extension step at 72°C for 15 minutes. The PCR products were electrophoresed on a 1.5% agarose gel, and the resulting gel electrophoresis was photographed and recorded under UV light.
After identifying the VNTR loci of the A. flavus isolates, a dendrogram was created using PHYLOViZ version 2.0 software. The Simpson's Index of Diversity (SID) for each locus across all tested isolates was calculated using the Comparing Partitions online software (20).

3.5. Antifungal Susceptibility Testing

The broth microdilution method, as described by CLSI-M38A2, was used to determine the minimum inhibitory concentrations (MICs) of AMB, ITR, VOR, POS, ISA, luliconazole (LUL), and lanoconazole (LAN) (Sigma-Aldrich, USA) (21). The final concentrations of polyene and triazole antifungals were prepared in the range of 0.032 - 16 µg/mL. For flucytosine (5-FC), the concentration range was 0.125 - 64 µg/mL, and for LAN and LUL, it was 0.016 - 8 µg/mL.
Conidial suspensions were obtained from sporulated A. flavus grown on Sabouraud dextrose agar (SDA) culture (HiMedia, India). The turbidity of the conidia was adjusted spectrophotometrically to optical densities between 0.09 and 0.11 at 530 nm and diluted 1:50 in RPMI 1640 broth (Sigma-Aldrich, USA). In each well of a microplate, 100 µL of the final conidial suspension was added to 100 µL of each antifungal concentration.
The MIC was defined as the lowest drug concentration that inhibited growth by 100% after 48 hours, compared to the growth of the controls. Candida parapsilosis ATCC22019 and C. krusei ATCC6258 isolates were used as quality control strains (22).

4. Results

The mean age in the present study was 53.4 years (range: 27 - 79 years). Of the participants, 38 (58.46%) were male, and 27 (41.54%) were female. The β-tubulin gene sequences for all A. flavus strains were deposited in GenBank and registered under the National Center for Biotechnology Information (NCBI) accession numbers PQ415656, PQ415659–PQ415711 and PQ422102–PQ422113.
The results of AFST for eight antifungal drugs across all A. flavus strains are shown in Table 2. The geometric mean minimum inhibitory concentration (GM-MIC), from lowest to highest, was obtained as follows: LUL (0.020 μg/mL), LAN (0.021 μg/mL), POS (0.089 μg/mL), ISA (0.115 μg/mL), ITR (0.220 μg/mL), VOR (0.244 μg/mL), AMB (0.870 μg/mL), and 5-fluorocytosine (58.76 μg/mL) (Table 2).
Table 2.MIC50, MIC90, Geometric Mean Minimum Inhibitory Concentration, and MIC Ranges Values of 65 Clinical Aspergillus flavus Isolates to Eight Antifungal Agents
CriteriaAntifungal Drugs
AMBITCVRCPSCISALULLAN5 - FC
MIC50 (μg/mL)10.250.250.0630.1250.0160.01664
MIC90 (μg/mL)20.50.50.250.250.0320.03264
GM0.8700.2200.2440.0890.1150.0200.02158.766
MIC Range (μg/mL)0.125 - 40.032 - 0.50.063 - 0.50.032 - 0.250.032 - 0.50.016 - 0.250.016 - 0.2564.0 - 64.0

Abbreviations: AMB, amphotericin B; ITC, itraconazole; VRC, voriconazole; PSC, posaconazole; ISA, isavuconazole; LUL, luliconazole; Lan, lanoconazole; 5-FC, 5-flucytosine; MIC, minimum inhibitory concentration; GM, geometric mean.

Multiple-locus variable number tandem repeat analysis analysis performed with PHYLOViZ software identified 65 genotypes (sequence types). None of the A. flavus isolates were identical in terms of allelic profiles (Figure 1). Based on a cut-off value of 1.5, 19 clusters and 4 singleton were determined for the 65 clinical isolates of A. flavus. According to the goeBURST phylogenetic tree, out of the 65 isolates, only 5 (7.7%) differed in 2 loci, while the remaining isolates differed in at least 3 or 4 loci.
Simpson's VNTR diversity index indicated that the AFPM7 marker, with SID = 0.901, was the most effective marker for differentiating among all strains.
Evolutionary phylogenetic tree creating from the analysis of six variable number tandem repeat (VNTR) marker gene loci of <i>Aspergillus flavus</i> isolates. In the tree, none of isolates has completely similar in Multiple locus variable-number tandem-repeat analysis (MVLA) patterns, as a result, these isolates are completely dissimilar.
Figure 1.

Evolutionary phylogenetic tree creating from the analysis of six variable number tandem repeat (VNTR) marker gene loci of Aspergillus flavus isolates. In the tree, none of isolates has completely similar in Multiple locus variable-number tandem-repeat analysis (MVLA) patterns, as a result, these isolates are completely dissimilar.

5. Discussion

Epidemiologically, the prevalence of A. flavus is more frequently reported in countries with dry and semi-arid climates, such as India, Iran, Saudi Arabia, Qatar, and Sudan (10, 15, 23, 24). A retrospective study in Iran showed that the prevalence of A. flavus exceeds that of other Aspergillus species (10). Our results indicated that the MIC50 of 65 isolates of A. flavus was as follows: Amphotericin B (1 µg/mL), ITR (0.25 µg/mL), VOR (0.25 µg/mL), POS (0.063 µg/mL), ISA (0.125 µg/mL), luliconazole (0.016 µg/mL), lanoconazole (0.016 µg/mL), and 5-fluocytosine (64 µg/mL). The in vitro AFST data indicated that all the tested antifungals demonstrated good activity, except for AMB and 5-fluocytosine.
Gheith et al. reported MIC50 values for clinical isolates of A. flavus isolated from patients with hematologic malignancies in Tunisia as follows: Amphotericin B (6 μg/mL), ITR (0.5 μg/mL), VOR (0.19 μg/mL), POS (0.19 μg/mL), and CAS (0.64 μg/mL) (25). Pfaller et al. reported MIC50 values of ITR (0.5 μg/mL), POS (0.25 μg/mL), ravuconazole (0.5 μg/mL), and VOR (0.5 μg/mL) against 76 A. flavus isolates (26).
Shivaparkash et al. analyzed the AFST profiles of triazoles against 188 isolates of A. flavus collected from India using the CLSI method. Posaconazole exhibited the highest activity (GM MIC, 0.123 mg/L), followed by ITR (GM MIC, 0.177 mg/L), ISA (GM MIC, 0.697 mg/L), and VOR (GM MIC, 1.167 mg/L) (27). In the study by Vanathi et al., MICs against A. flavus were reported as follows: Amphotericin B (0.5 - 16 μg/mL), VOR (0.025 - 4 μg/mL), ITR (0.125 - 8 μg/mL), and POS (0.047 - 0.25 μg/mL) (28).
Although no drug susceptibility breakpoints exist for A. flavus, there is a consensus on the epidemiological cutoff values (ECVs) for A. flavus strains: Posaconazole 0.5 mg/L, ITR 1 mg/L, VOR 1 mg/L, ISA 1 mg/L, and AMB 4 mg/L (19). In the present study, all azoles tested showed good activity against all A. flavus strains, consistent with previous reports (29-32). Our AFST results indicated that luliconazole and lanoconazole demonstrated low MICs (GM = 0.020 μg/mL, with a range of MIC = 0.016 - 0.25 μg/mL) against all A. flavus strains. Similarly, in a study by Abastabar et al. (33), luliconazole and lanoconazole exhibited the lowest MICs against sensitive and resistant A. fumigatus isolates compared to those of other antifungal drugs. The analysis of our AFST data revealed that the GM MIC value of luliconazole was lower than that of lanoconazole against all tested strains.
Although no preparation for systemic administration of these antifungals is currently available, in vivo studies in animal models have demonstrated that these antifungals are highly effective for managing invasive aspergillosis compared to other drugs (34). Our results indicated that the MICs for AMB were higher than those for other antifungals, consistent with the study by Moslem and Zarei Mahmoudabadi, which reported MICs of AMB ≥ 8 μg/mL (35). These findings align with previous studies conducted in Europe (36, 37) and the Middle East (8, 38, 39). These differences may be attributed to variations in strains isolated from different specimens, the sample sizes of investigated strains, antifungal treatments, different AFST guidelines, and varying breakpoints applied for MIC determination.
In the present study, all clinical strains were found to be dissimilar, with distinctive genotype profiles. The strains were collected from different patients in two separate regions of Iran. Consistent with our findings, high genetic diversity in A. flavus has been observed in clinical isolates obtained from humans (9) and animal infections (40). Moreover, a prior study by Mohammadi et al. indicated that clinical and environmental A. fumigatus isolates clustered separately from each other (41). In line with the present study, Hadrich et al. used a suitable microsatellite marker for typing 63 isolates of A. flavus, employing a combination of 12 markers with a discriminatory power of 0.97, while a combination of 5 markers (AFM7, AFM3, AFLA7, AFLA3, AFLA1) showed a discriminatory power of 0.952 (42). Rudramurthy et al. genotyped 162 clinical isolates of A. flavus using 9 microsatellite markers, reporting a polymorphic rate of 33 alleles for these markers. The discriminatory power of each marker ranged from 0.954 to 0.657. Similar to the present study, their genotyping results did not show a significant relationship between the existing genotypes and different clinical forms (43).
Guarro et al., using the microsatellite technique for genotyping Aspergillus spp. from a hospital infection, reported 28 genotypes of A. fumigatus and 23 genotypes of A. flavus (44). Khodavaisy et al. reported the genotyping of 143 clinical and environmental isolates of A. flavus using nine microsatellite markers, identifying 118 different genotypes. The discriminatory power of these nine markers for all isolates ranged from 0.9457 to 0.4812 (9).
The differences between our results and those of other studies may be attributed to factors such as the type of strain, geographical region, source of samples, and the number and type of microsatellite markers used. A limitation of the present study is that AFST for echinocandin groups against A. flavus strains was not performed. Understanding the associations between the genotypes of strains and clinical disease (12)—which may vary across regions—and therapeutic modalities, including AFST patterns of causative agents against a panel of systemic drug compounds (45), is an important advantage for clinicians, mycology laboratories, and healthcare specialists. Such insights may help guide personalized treatment.

5.1. Conclusions

In conclusion, our results demonstrated that A. flavus isolates were highly sensitive to luliconazole, lanoconazole, and POS, whereas AMB did not exhibit strong activity against A. flavus. Typing of isolates collected from clinical samples revealed that A. flavus possesses a wide genetic diversity. The microsatellite typing method (MLVA assay) showed very high discriminatory power for studying the molecular epidemiology of clinical isolates of A. flavus. Additionally, no significant relationship was observed between the different genotypes of A. flavus and their AFST profiles.

Acknowledgments

Footnotes

References

  • 1.
    Hoang TNM, Cseresnyes Z, Hartung S, Blickensdorf M, Saffer C, Rennert K, et al. Invasive aspergillosis-on-chip: A quantitative treatment study of human Aspergillus fumigatus infection. Biomaterials. 2022;283:121420. [PubMed ID: 35245733]. https://doi.org/10.1016/j.biomaterials.2022.121420.
  • 2.
    Abdel-Azeem AM, Salem FM, Abdel-Azeem MA, Nafady NA, Mohesien MT, Soliman EA. Biodiversity of the genus Aspergillus in different habitats. In: Gupta VG, editor. New and Future Developments in Microbial Biotechnology and Bioengineering. Amsterdam, Netherlands: Elsevier; 2016. p. 3-28. https://doi.org/10.1016/b978-0-444-63505-1.00001-4.
  • 3.
    El-Dawy E, Gherbawy YA, Hussein MA. Characterization of Aspergillus section Flavi associated with stored grains. Mycotoxin Res. 2024;40(1):187-202. [PubMed ID: 38231446]. [PubMed Central ID: PMC10834605]. https://doi.org/10.1007/s12550-023-00514-1.
  • 4.
    Nargesi S, Jafarzadeh J, Najafzadeh MJ, Nouripour-Sisakht S, Haghani I, Abastabar M, et al. Molecular identification and antifungal susceptibility of clinically relevant and cryptic species of Aspergillus sections Flavi and Nigri. J Med Microbiol. 2022;71(4). [PubMed ID: 35451946]. https://doi.org/10.1099/jmm.0.001480.
  • 5.
    Bandegani A, Abastabar M, Sharifisooraki J, Abtahian Z, Vaseghi N, Khodavaisy S, et al. High prevalence of azole-resistant Aspergillus fumigatus among iranian cystic fibrosis patients: Should we be concerned? Mycoses. 2024;67(9). e13791. [PubMed ID: 39239666]. https://doi.org/10.1111/myc.13791.
  • 6.
    Nabili M, Shokohi T, Moazeni M, Khodavaisy S, Aliyali M, Badiee P, et al. High prevalence of clinical and environmental triazole-resistant Aspergillus fumigatus in Iran: Is it a challenging issue? J Med Microbiol. 2016;65(6):468-75. [PubMed ID: 27008655]. https://doi.org/10.1099/jmm.0.000255.
  • 7.
    Badali H, Shokohi T, Khodavaisy S, Moazeni M, Farhadi M, Nabili M. Molecular typing of clinical and environmental Aspergillus fumigatus isolates from Iran using microsatellites. Curr Med Mycol. 2021;7(1):25-30. [PubMed ID: 34553094]. [PubMed Central ID: PMC8443879]. https://doi.org/10.18502/cmm.7.1.6180.
  • 8.
    Taghizadeh-Armaki M, Hedayati MT, Ansari S, Omran SM, Saber S, Rafati H, et al. Genetic diversity and in vitro antifungal susceptibility of 200 clinical and environmental Aspergillus flavus isolates. Antimicrob Agents Chemother. 2017;61(5). [PubMed ID: 28264849]. [PubMed Central ID: PMC5404543]. https://doi.org/10.1128/AAC.00004-17.
  • 9.
    Khodavaisy S, Badali H, Rezaie S, Nabili M, Moghadam KG, Afhami S, et al. Genotyping of clinical and environmental Aspergillus flavus isolates from Iran using microsatellites. Mycoses. 2016;59(4):220-5. [PubMed ID: 26756650]. https://doi.org/10.1111/myc.12451.
  • 10.
    Hedayati MT, Pasqualotto AC, Warn PA, Bowyer P, Denning DW. Aspergillus flavus: Human pathogen, allergen and mycotoxin producer. Microbiol (Reading). 2007;153(Pt 6):1677-92. [PubMed ID: 17526826]. https://doi.org/10.1099/mic.0.2007/007641-0.
  • 11.
    Hadrich I, Neji S, Drira I, Trabelsi H, Mahfoud N, Ranque S, et al. Microsatellite typing of Aspergillus flavus in patients with various clinical presentations of aspergillosis. Med Mycol. 2013;51(6):586-91. [PubMed ID: 23336695]. https://doi.org/10.3109/13693786.2012.761359.
  • 12.
    Hadrich I, Makni F, Neji S, Cheikhrouhou F, Sellami H, Ayadi A. A review molecular typing methods for Aspergillus flavus isolates. Mycopathologia. 2011;172(2):83-93. [PubMed ID: 21369748]. https://doi.org/10.1007/s11046-011-9406-x.
  • 13.
    de Valk HA, Klaassen CH, Meis JF. Molecular typing of Aspergillus species. Mycoses. 2008;51(6):463-76. [PubMed ID: 18793268]. https://doi.org/10.1111/j.1439-0507.2008.01538.x.
  • 14.
    Wang DY, Hadj-Henni L, Thierry S, Arne P, Chermette R, Botterel F, et al. Simple and highly discriminatory VNTR-based multiplex PCR for tracing sources of Aspergillus flavus isolates. PLoS One. 2012;7(9). e44204. [PubMed ID: 23028503]. [PubMed Central ID: PMC3444452]. https://doi.org/10.1371/journal.pone.0044204.
  • 15.
    Omran SM, Taghizadeh-Armaki M, Zarrinfar H, Hedayati MT, Abastabar M, Moqarabzadeh V, et al. In-vitro antifungal susceptibility testing of lanoconazole and luliconazole against Aspergillus flavus as an important agent of invasive aspergillosis. J Infect Chemother. 2019;25(2):157-60. [PubMed ID: 30241879]. https://doi.org/10.1016/j.jiac.2018.07.018.
  • 16.
    Garcia-Rubio R, Cuenca-Estrella M, Mellado E. Triazole resistance in Aspergillus species: An emerging problem. Drugs. 2017;77(6):599-613. [PubMed ID: 28236169]. https://doi.org/10.1007/s40265-017-0714-4.
  • 17.
    Baghi N, Shokohi T, Badali H, Makimura K, Rezaei-Matehkolaei A, Abdollahi M, et al. In vitro activity of new azoles luliconazole and lanoconazole compared with ten other antifungal drugs against clinical dermatophyte isolates. Med Mycol. 2016;54(7):757-63. [PubMed ID: 27118804]. https://doi.org/10.1093/mmy/myw016.
  • 18.
    Hedayati MT, Taghizadeh-Armaki M, Zarrinfar H, Hoseinnejad A, Ansari S, Abastabar M, et al. Discrimination of Aspergillus flavus from Aspergillus oryzae by matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry. Mycoses. 2019;62(12):1182-8. [PubMed ID: 31556203]. https://doi.org/10.1111/myc.13010.
  • 19.
    Alcazar-Fuoli L, Mellado E, Alastruey-Izquierdo A, Cuenca-Estrella M, Rodriguez-Tudela JL. Aspergillus section Fumigati: Antifungal susceptibility patterns and sequence-based identification. Antimicrob Agents Chemother. 2008;52(4):1244-51. [PubMed ID: 18212093]. [PubMed Central ID: PMC2292508]. https://doi.org/10.1128/AAC.00942-07.
  • 20.
    Honarvar Bakeshloo P, Pournajaf A, Taghizadeh Armaki M, Hejazi Amiri F, Alhooei S, Rajabnia M. Multiple-locus variable-number tandem repeat analysis of helicobacter pylori strains isolated from biopsy samples. Jundishapur J Microbiol. 2024;17(6). https://doi.org/10.5812/jjm-147543.
  • 21.
    Sabino R, Goncalves P, Martins Melo A, Simoes D, Oliveira M, Francisco M, et al. Trends on Aspergillus epidemiology-perspectives from a national reference laboratory surveillance program. J Fungi (Basel). 2021;7(1). [PubMed ID: 33418997]. [PubMed Central ID: PMC7825284]. https://doi.org/10.3390/jof7010028.
  • 22.
    Rezaei E, Didehdar M, Mirhoseini SH. Study of fungal contamination intensive care units of Arak educational hospitals and determining drug sensitivity profiles of isolated species. J Arak Univ Med Sci. 2021;24(3):348-59. https://doi.org/10.32598/jams.24.3.5931.2.
  • 23.
    Zanganeh E, Zarrinfar H, Rezaeetalab F, Fata A, Tohidi M, Najafzadeh MJ, et al. Predominance of non-fumigatus Aspergillus species among patients suspected to pulmonary aspergillosis in a tropical and subtropical region of the Middle East. Microb Pathog. 2018;116:296-300. [PubMed ID: 29410233]. https://doi.org/10.1016/j.micpath.2018.01.047.
  • 24.
    Zarrinfar H, Mirhendi H, Fata A, Khodadadi H, Kordbacheh P. Detection of Aspergillus flavus and A. fumigatus in bronchoalveolar lavage specimens of hematopoietic stem cell transplants and hematological malignancies patients by real-time polymerase chain reaction, nested PCR and mycological assays. Jundishapur J Microbiol. 2015;8(1). e13744. [PubMed ID: 25763133]. [PubMed Central ID: PMC4344768]. https://doi.org/10.5812/jjm.13744.
  • 25.
    Gheith S, Saghrouni F, Bannour W, Ben Youssef Y, Khelif A, Normand AC, et al. In vitro susceptibility to amphotericin B, itraconazole, voriconazole, posaconazole and caspofungin of Aspergillus spp. isolated from patients with haematological malignancies in Tunisia. Springerplus. 2014;3:19. [PubMed ID: 26034655]. [PubMed Central ID: PMC4447766]. https://doi.org/10.1186/2193-1801-3-19.
  • 26.
    Pfaller MA, Messer SA, Boyken L, Rice C, Tendolkar S, Hollis RJ, et al. In vitro survey of triazole cross-resistance among more than 700 clinical isolates of Aspergillus species. J Clin Microbiol. 2008;46(8):2568-72. [PubMed ID: 18562581]. [PubMed Central ID: PMC2519461]. https://doi.org/10.1128/JCM.00535-08.
  • 27.
    Shivaprakash MR, Geertsen E, Chakrabarti A, Mouton JW, Meis JF. In vitro susceptibility of 188 clinical and environmental isolates of Aspergillus flavus for the new triazole isavuconazole and seven other antifungal drugs. Mycoses. 2011;54(5):e583-9. [PubMed ID: 21518026]. https://doi.org/10.1111/j.1439-0507.2010.01996.x.
  • 28.
    Vanathi M, Naik R, Sidhu N, Ahmed NH, Gupta N, Tandon R. Evaluation of antifungal susceptibility and clinical characteristics in fungal keratitis in a tertiary care center in North India. Indian J Ophthalmol. 2022;70(12):4270-83. [PubMed ID: 36453329]. [PubMed Central ID: PMC9940598]. https://doi.org/10.4103/ijo.IJO_855_22.
  • 29.
    Lass-Florl C. Susceptibility testing in Aspergillus species complex. Clin Microbiol Infect. 2014;20 Suppl 6:49-53. [PubMed ID: 24372722]. https://doi.org/10.1111/1469-0691.12514.
  • 30.
    Pfaller MA, Diekema DJ, Ghannoum MA, Rex JH, Alexander BD, Andes D, et al. Wild-type MIC distribution and epidemiological cutoff values for Aspergillus fumigatus and three triazoles as determined by the Clinical and Laboratory Standards Institute broth microdilution methods. J Clin Microbiol. 2009;47(10):3142-6. [PubMed ID: 19692559]. [PubMed Central ID: PMC2756953]. https://doi.org/10.1128/JCM.00940-09.
  • 31.
    Espinel-Ingroff A, Chowdhary A, Gonzalez GM, Lass-Florl C, Martin-Mazuelos E, Meis J, et al. Multicenter study of isavuconazole MIC distributions and epidemiological cutoff values for Aspergillus spp. for the CLSI M38-A2 broth microdilution method. Antimicrob Agents Chemother. 2013;57(8):3823-8. [PubMed ID: 23716059]. [PubMed Central ID: PMC3719700]. https://doi.org/10.1128/AAC.00636-13.
  • 32.
    Espinel-Ingroff A, Fothergill A, Fuller J, Johnson E, Pelaez T, Turnidge J. Wild-type MIC distributions and epidemiological cutoff values for caspofungin and Aspergillus spp. for the CLSI broth microdilution method (M38-A2 document). Antimicrob Agents Chemother. 2011;55(6):2855-9. [PubMed ID: 21422219]. [PubMed Central ID: PMC3101428]. https://doi.org/10.1128/AAC.01730-10.
  • 33.
    Abastabar M, Rahimi N, Meis JF, Aslani N, Khodavaisy S, Nabili M, et al. Potent activities of novel imidazoles lanoconazole and luliconazole against a collection of azole-resistant and -susceptible Aspergillus fumigatus strains. Antimicrob Agents Chemother. 2016;60(11):6916-9. [PubMed ID: 27572389]. [PubMed Central ID: PMC5075107]. https://doi.org/10.1128/AAC.01193-16.
  • 34.
    Niwano Y, Kuzuhara N, Goto Y, Munechika Y, Kodama H, Kanai K, et al. Efficacy of NND-502, a novel imidazole antimycotic agent, in experimental models of Candida albicans and Aspergillus fumigatus infections. Int J Antimicrob Agents. 1999;12(3):221-8. [PubMed ID: 10461840]. https://doi.org/10.1016/s0924-8579(99)00076-x.
  • 35.
    Moslem M, Zarei Mahmoudabadi A. The high efficacy of luliconazole against environmental and otomycosis Aspergillus flavus strains. Iran J Microbiol. 2020;12(2):170-6. [PubMed ID: 32494352]. [PubMed Central ID: PMC7244823].
  • 36.
    Colozza C, Posteraro B, Santilli S, De Carolis E, Sanguinetti M, Girmenia C. In vitro activities of amphotericin B and AmBisome against Aspergillus isolates recovered from Italian patients treated for haematological malignancies. Int J Antimicrob Agents. 2012;39(5):440-3. [PubMed ID: 22429723]. https://doi.org/10.1016/j.ijantimicag.2012.01.013.
  • 37.
    Yamamoto M, Matsuyama S, Li X, Takeda M, Kawaguchi Y, Inoue JI, et al. Identification of nafamostat as a potent inhibitor of Middle East respiratory syndrome coronavirus s protein-mediated membrane fusion using the split-protein-based cell-cell fusion assay. Antimicrob Agents Chemother. 2016;60(11):6532-9. [PubMed ID: 27550352]. [PubMed Central ID: PMC5075056]. https://doi.org/10.1128/AAC.01043-16.
  • 38.
    Xu X, Naseri A, Houbraken J, Akbari F, Wang X, Zhao R, et al. Identification and in vitro antifungal susceptibility of causative agents of onychomycosis due to Aspergillus species in Mashhad, Iran. Sci Rep. 2021;11(1):6808. [PubMed ID: 33762586]. [PubMed Central ID: PMC7991633]. https://doi.org/10.1038/s41598-021-86038-z.
  • 39.
    Al-Wathiqi F, Ahmad S, Khan Z. Molecular identification and antifungal susceptibility profile of Aspergillus flavus isolates recovered from clinical specimens in Kuwait. BMC Infect Dis. 2013;13:126. [PubMed ID: 23496810]. [PubMed Central ID: PMC3599693]. https://doi.org/10.1186/1471-2334-13-126.
  • 40.
    Hadrich I, Drira I, Neji S, Mahfoud N, Ranque S, Makni F, et al. Microsatellite typing of Aspergillus flavus from clinical and environmental avian isolates. J Med Microbiol. 2013;62(Pt 1):121-5. [PubMed ID: 22977077]. [PubMed Central ID: PMC3541757]. https://doi.org/10.1099/jmm.0.047803-0.
  • 41.
    Mohammadi F, Hashemi SJ, Zoll J, Melchers WJ, Rafati H, Dehghan P, et al. Quantitative Analysis of single-nucleotide polymorphism for rapid detection of TR34/L98H- and TR46/Y121F/T289A-positive Aspergillus fumigatus isolates obtained from patients in Iran from 2010 to 2014. Antimicrob Agents Chemother. 2016;60(1):387-92. [PubMed ID: 26525787]. [PubMed Central ID: PMC4704245]. https://doi.org/10.1128/AAC.02326-15.
  • 42.
    Hadrich I, Makni F, Ayadi A, Ranque S. Microsatellite typing to trace Aspergillus flavus infections in a hematology unit. J Clin Microbiol. 2010;48(7):2396-401. [PubMed ID: 20410353]. [PubMed Central ID: PMC2897480]. https://doi.org/10.1128/JCM.01269-09.
  • 43.
    Rudramurthy SM, de Valk HA, Chakrabarti A, Meis JF, Klaassen CH. High resolution genotyping of clinical Aspergillus flavus isolates from India using microsatellites. PLoS One. 2011;6(1). e16086. [PubMed ID: 21264229]. [PubMed Central ID: PMC3022034]. https://doi.org/10.1371/journal.pone.0016086.
  • 44.
    Guarro J, Sole M, Castany R, Cano J, Teixido A, Pujol I, et al. Use of random amplified microsatellites to type isolates from an outbreak of nosocomial aspergillosis in a general medical ward. Med Mycol. 2005;43(4):365-71. [PubMed ID: 16110783]. https://doi.org/10.1080/13693780400005809.
  • 45.
    Seyedmousavi S, Rafati H, Ilkit M, Tolooe A, Hedayati MT, Verweij P. Systemic antifungal agents: Current status and projected future developments. Methods Mol Biol. 2017;1508:107-39. [PubMed ID: 27837500]. https://doi.org/10.1007/978-1-4939-6515-1_5.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles