Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

First Case of Vulvovaginal Trichosporonosis Due to Trichosporon coremiiforme and Review of Recent Literature

Author(s):
Fatemeh Zahra Ranjbar GolafshaniFatemeh Zahra Ranjbar GolafshaniFatemeh Zahra Ranjbar Golafshani ORCID1, 2, Firoozeh KermaniFiroozeh KermaniFiroozeh Kermani ORCID1, 2, Soheila Abbaszadeh GodarziSoheila Abbaszadeh GodarziSoheila Abbaszadeh Godarzi ORCID3, Maryam AhangariMaryam Ahangari4, Saeid Mahdavi OmranSaeid Mahdavi OmranSaeid Mahdavi Omran ORCID1, 2,*
1Biomedical and Microbial Advanced Technologies (BMAT) Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran
2Department of Parasitology and Medical Mycology, Faculty of Medicine, Babol University of Medical Sciences, Babol, Iran
3Obstetrics and Gynecology Department, Faculty of Medicine, Babol University of Medical Sciences, Babol, Iran
4Midwifery Department, Ayatollah Rouhani Babol Medical Training Center, Babol, Iran
*Corresponding Author: Biomedical and Microbial Advanced Technologies (BMAT) Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 17, issue 12; e156659
Published online:Dec 31, 2024
Article type:Case Report
Received:Oct 02, 2024
Accepted:Dec 11, 2024
How to Cite:Ranjbar Golafshani FZ, Kermani F, Abbaszadeh Godarzi S, Ahangari M, Mahdavi Omran S. First Case of Vulvovaginal Trichosporonosis Due to Trichosporon coremiiforme and Review of Recent Literature. Jundishapur J Microbiol. 2024;17(12):e156659. doi: https://doi.org/10.5812/jjm-156659

Abstract

Introduction:

Trichosporon spp. are emerging basidiomycetous yeasts that can cause both superficial and invasive infections. Trichosporon coremiiforme is phylogenetically closely related to T. asahii. It has been isolated from various clinical samples; however, to date, there have been no reports of vulvovaginal infections caused by T. coremiiforme. This case report contributes to our understanding of T. coremiiforme infections and its potential to cause invasive infections in immunocompetent patients.

Case Presentation:

A 35-year-old woman with vulvovaginitis, a history of recurrent infections, and menorrhagia was referred to Babol Medical Center. The infection was confirmed through recultivation at two different sampling times, and the strain was identified as T. coremiiforme using ribosomal DNA sequencing. The patient was treated with voriconazole and miconazole.

Conclusions:

This is the first reported case of vulvovaginal trichosporonosis caused by T. coremiiforme in an immunocompetent patient. It underscores the importance of prompt and accurate identification of infections, even in immunocompetent individuals, for timely treatment.

Highlights

1. Introduction

The prevalence of invasive fungal infections caused by emerging fungal pathogens has increased significantly over the last two decades. This trend can be attributed to several factors, including the rising incidence of malignancies across various populations and the significant increase in the number of patients undergoing organ transplantation, immunosuppressive therapies, chemotherapy, broad-spectrum antibiotics, and invasive medical procedures (1). However, diagnosing these emerging fungal infections is often challenging due to their resistance to conventional antifungal drugs and their frequent association with higher mortality rates.
Trichosporon spp. are emerging basidiomycetous yeasts that can cause both superficial and invasive infections (2). Trichosporon asahii is the most commonly isolated species in invasive trichosporonosis (3). However, in recent years, several other Trichosporon spp. have been reported as causative agents of invasive infections. Trichosporon coremiiforme is phylogenetically closely related to T. asahii (3, 4). While it has been isolated from the bloodstream in clinical samples, T. coremiiforme has been recognized as an opportunistic agent of invasive infections (4), primarily affecting cancer patients and those exposed to invasive medical procedures.
Most invasive Trichosporon spp. infections are thought to begin with colonization of mucosal or cutaneous surfaces. A break in the integrity of these surfaces then leads to the seeding of the bloodstream (5, 6). Such breaks can result from epithelial damage caused by chemotherapy or intravascular catheters (6). Antibiotics may also increase the incidence and extent of colonization and may contribute to the risk of human infections. The ability of Trichosporon species to form biofilms on implanted devices, the presence of glucuronoxylomannan in their cell wall, and their production of proteolytic and lipolytic enzymes are factors likely contributing to the pathogenicity of this genus and, consequently, to the progression of invasive trichosporonemia (3).
Disseminated trichosporonosis is increasingly reported worldwide, posing challenges to both diagnosis and species identification. In this report, we describe a recurrent vulvovaginal infection caused by T. coremiiforme in an immunocompetent patient with menorrhagia, identified using molecular methods.

2. Case Presentation

In July 2023, a 35-year-old woman with a BMI of 39.54 was referred to Babol Medical Center due to recurrent vulvovaginitis. The patient presented with symptoms including inflammation, pruritus, dyspareunia, and discharge. Her medical history included a preterm cesarean delivery in 2020 and an ovarian cystectomy in 2021 due to the sudden onset of lower abdominal pain. Ultrasound observations indicated a 31 mm cyst in the left ovary and a Nabothian cyst in the cervical stroma. The patient had no history of underlying diseases.
In the clinical examination of the vagina, inflammation of the cervix was observed, along with abundant white and mucous discharge in the vagina and cervix. The patient was prescribed 250 mg azithromycin capsules, 500 mg metronidazole tablets, and clindamycin and clotrimazole vaginal cream (Dalavag C) for one week. The patient's history indicated that, three months prior, she had presented with symptoms of menorrhagia and recurrent infections and was referred to Babol Medical Center. An ultrasound examination revealed cervical hypertrophy and right ovarian atrophy. A gynecologist conducted a vaginal examination and observed severe inflammation of the cervix and vagina, along with severe tenderness of the uterus in the adnexa.
For clinical laboratory examination, the vaginal sample was stained with methylene blue and cultured on Sabouraud dextrose agar medium (Merk, Germany) containing chloramphenicol (Sc). The culture media were incubated at 25°C and 37°C. Microscopic examination of the stained slides and the germ tube test confirmed the presence of numerous arthroconidia. The specimen was re-cultured on CHROM agar Candida medium (Merk, Germany), resulting in dark green colonies with a dry appearance. For precise molecular identification, the Colony PCR (7) reaction of the ITS region amplification was performed using primers ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), and the DNA products were detected on a 1.5% agarose gel (Merk, Germany) (Figure 1). The PCR products were sequenced and then blasted using the NCBI database, with T. coremiiforme deposited in GenBank under accession number PP230939 (Figure 1). The closest matches to each sequence were determined using the BLASTN sequence similarity search tool in GenBank. Multiple alignments were performed with ClustalW using the default settings. Phylogenetic analyses were performed with MEGA11 using a maximum likelihood tree phylogram with the Tamura-Nei model. The confidence of branching was assessed through 500 bootstrap re-samplings. Candida albicans (GenBank accession number PP512565) was used as the outgroup (Figure 2).
A, <i>Trichosporon coremiiforme</i> on Sabouraud Dextrose Agar at 37°C after 4 days; B, arthroconidia and blastoconidia of <i>T. coremiiforme</i> in the sample inoculated with 0.5 mL of human serum; C, chains of arthroconidia from the hyphae and lateral blastoconidia at the sides of arthconidial chains or hyphae; D, electrophoresis results of the PCR products on 1.5% agarose gel.
Figure 1.

A, Trichosporon coremiiforme on Sabouraud Dextrose Agar at 37°C after 4 days; B, arthroconidia and blastoconidia of T. coremiiforme in the sample inoculated with 0.5 mL of human serum; C, chains of arthroconidia from the hyphae and lateral blastoconidia at the sides of arthconidial chains or hyphae; D, electrophoresis results of the PCR products on 1.5% agarose gel.

Maximum likelihood tree phylogram generated in Mega version11.0.13 of <i>Trichosporon coremiiforme</i> using Tamura-Nei model. The <i>Candida albicans</i> (PP512565) was used as the outgroup. The highlight accsision number refers to <i>T. coremiiforme</i> in this study.
Figure 2.

Maximum likelihood tree phylogram generated in Mega version11.0.13 of Trichosporon coremiiforme using Tamura-Nei model. The Candida albicans (PP512565) was used as the outgroup. The highlight accsision number refers to T. coremiiforme in this study.

In vitro, the antifungal susceptibility test was performed according to the recommendations stated in the Clinical and Laboratory Standards Institute (CLSI) M27-A4 guidelines (8, 9). The minimum inhibitory concentrations (MICs) were ≥ 8 μg/mL for amphotericin B, 4 μg/mL for ketoconazole, 0.03 μg/mL for voriconazole, 4 μg/mL for miconazole, 4 μg/mL for fluconazole, and 4 μg/mL for clotrimazole. The patient was prescribed voriconazole 200 mg tablets daily for 20 days, levofloxacin 750 mg tablets (Tavanex) daily for 1 week, and miconazole 2% vaginal ointment for nightly use over 1 week. The patient returned to Babol Medical Center for a follow-up visit 20 days later. There were no signs of inflammation or itching, and the menorrhagia had completely resolved. The uterine examination was normal, with no inflammation or abnormal discharge in the cervix or vagina. To confirm healing, a sample of vaginal and cervical mucus was collected with a sterile swab and placed in saline. A liquid cervical smear was also taken and sent to the laboratory. The microscopic examination showed no evidence of fungal organisms. Negative mycological results were obtained from both vaginal and cervical mucus cultures. The Pap smear was also reported as normal.

3. Discussion

Trichosporon spp. is an emerging basidiomycetous yeast that can cause both superficial and invasive infections. This yeast-like fungus is characterized by morphological and physiological complexity and exhibits similarities to C. albicans. Like other dimorphic fungi, Trichosporon has the ability to grow as a budding yeast and develop filaments, which produce septate hyphae containing numerous arthroconidia and blastoconidia (1). The ability of Trichosporon to infiltrate the skin and various tissues relies on several virulent characteristics, such as the transition from yeast to hyphae, biofilm formation, enzymatic actions of lipases and proteases, and changes in the composition of the cell wall (10) (Figure 2).
These infections are most commonly found in immunocompromised patients, particularly those with hematological malignancies and neutropenia. Surgery and antibiotic use have been found to have a statistically significant association with higher rates of trichosporonosis. The genus Trichosporon is known to cause a variety of conditions, including white piedra, summer-type hypersensitivity pneumonitis, and various types of invasive infections. These invasive infections primarily affect individuals with compromised immune systems and can pose a significant risk to their lives. Despite antifungal treatment, the mortality rates for invasive trichosporonosis range from 42% to 90% (3).
Recently, Trichosporon spp. has been reported to cause invasive infections in humans; however, studies on vaginitis caused by Trichosporon spp. remain limited. Previous studies have shown that T. inkin is occasionally found in vulvovaginal cultures, though it is usually considered a nonpathogenic agent. Trichosporon species, such as T. asahii, are more commonly associated with systemic and invasive skin diseases, while T. inkin has been isolated primarily from genital specimens (2). Instances of T. coremiiforme have been documented in non-clinical samples, as well as in cases of summer hypersensitivity pneumonitis (SHP) caused by Trichosporon species in animals, and in nail and skin samples. It has also been successfully isolated from soil samples in Iran (10, 11). However, clinical cases of trichosporonosis caused by T. coremiiforme remain relatively rare (Table 1).
Table 1.Reported Cases of Trichosporon coremiiforme
Clinical SpecimensMethodPatients Age or Age Range/GenderOriginAssociated Condition(s)TherapyOutcomeReference
Subcutaneous abscess/urineIGS1 region sequencingNAaSpainNA aNA aNA a(12)
Skin/nailsIGS1 and ITS region sequencingNAaBrazilNA aNA aNA a(13)
BloodstreamIGS1 region sequencing10 days/femaleBrazilPulmonary emphysema/pulmonary hypertensionFluconazoleSurvived(6)
BloodstreamMALDI-TOF MS15 - 49/maleChinNA aNA aNA a(3)
Catheter-related bloodstreamMALDI-TOF MS46/femaleArgentinHIV/pulmonary tuberculosis/leukopenia/thrombocytopeniaAmphotericin B and fluconazoleSurvived(6)
Vaginal dischargeITS region sequencing35/femaleIran_Voriconazole and miconazole (vaginal oinment)SurvivedCurrent study

a NA: Clinical and epidemiological data for patient were not available.

An important case report from 2019 documented the isolation of T. coremiiforme from a blood culture taken from an HIV-positive woman; however, there is no report of trichosporonosis caused by T. coremiiforme in vaginal samples. We report a case of vulvovaginal trichosporonosis in an immunocompetent patient. In this case, the resolution of symptoms was consistent with a previously positive vaginal culture for T. coremiiforme, which became negative after antifungal treatment. Transient colonization of Trichosporon species occurs mainly in African-American women with significant vaginal flora disturbances, such as bacterial vaginosis and increased trichomoniasis (14). The pathogenic consequences of Trichosporon colonization in the vagina appear to be very rare. Treatment should continue until a second culture shows persistence of Trichosporon species in a symptomatic patient in whom no other cause of symptoms has been identified (12). Accurate identification of opportunistic pathogens at the species level is crucial for understanding species-specific pathology and determining appropriate antifungal therapy (15).
Trichosporon species exhibit variations in their susceptibility to antifungal drugs, making precise identification necessary. Identifying the genus Trichosporon is essential for determining the best antifungal therapy because, like other Basidiomycete yeasts, it is intrinsically resistant to echinocandins (16). The fragment sequences of ITS1-5.8rRNA-ITS2 obtained in this study were found to be identical to sequences of T. coremiiforme and T. montevideense isolated from humans. This suggests that these isolates are pathogens that can be transmitted between humans. However, species identification in clinical laboratories remains a challenge because conventional identification methods are not reliable, and DNA-based methods are generally only available in reference laboratories (1, 2, 10).
In this study, the In vitro activity of six antifungal drugs on T. coremiiforme was tested, and azole drugs were found to be more effective than amphotericin B, which is consistent with other studies. Based on laboratory susceptibility, clinical eradication of T. coremiiforme should be followed by treatment with topical or oral azoles. According to Guo et al., voriconazole exhibited superior efficacy due to its requirement for the lowest concentration to inhibit growth (3) (Table 2).
Table 2.In Vitro Antifungal Susceptibility Profile of Trichosporon coremiiforme Compared to Other Clinical Studies a
Sources (Human)Minimium Inhibitory Concentration (μg/mL)Reference
AMB (S ≤ 1 μg/mL; R > 1 μg/mL)FLU (S ≤ 8 μg/mL; R ≥ 64 μg/mL)VOR (S ≤ 1 μg/mL; R ≥ 4 μg/mL)
Fecal material0.510.5(15)
Bloodstream110.03(6)
N/A 80.25-(1)
Blood0.540.06(3)
Blood and respiratory tract2 - 40.5 - 40.03 - 0.06(2)
N/A 0.511(16)
Urine, subcutaneous abscess4.0 - 4.02.0 - 2.00.06 - 0.12(12)
N/A0.50.50.03(16)
Vaginal discharge≥ 840.03Current study
TrichosporoncoremiiformeMIC range0.5 - 80.25 - 40.03 - 1-

Abbreviations: AMB, amphotericin B; FLU, fluconazole; VOR, voriconazole; R, resistance; S, sensitive; MIC, minimium inhibitory concentration.

a N/A: Clinical and epidemiological data for patient were not available.

3.1. Conclusions

To the best of our knowledge, this is the first description of a vulvovaginal T. coremiiforme infection worldwide. Early diagnosis using accurate methods, such as PCR sequencing, and treatment with antifungal drugs like voriconazole or amphotericin B, is effective in managing such infections in patients.

Acknowledgments

Footnotes

  • Authors' Contribution: Study concept and design: F. Z. R. G., S. M. O., and F. K.; Acquisition of data: F. Z. R. G., M. A., and S. A. G.; Analysis and interpretation of data: F. Z. R. G. and F. K.; Drafting of the manuscript: F. Z. R. G., S. M. O., and F. K.; Critical revision of the manuscript for important intellectual content: F. Z. R. G., S. A. G., M. A., and S. M. O.; Statistical analysis: F. K.; Administrative, technical, and material support: F. Z. R. G., S. M. O., S. A. G., M. A., and F. K.; Study supervision: S. M. O.; All authors read and approved the final manuscript.

  • Conflict of Interests Statement: The authors declare that they have no competing interests.

  • Data Availability: The data presented in this study are uploaded during submission as a supplementary file and are openly available for readers upon request.

  • Ethical Approval: The study was conducted by Babol University of Medical Sciences in compliance with the ethical guidelines specified under code IR.MUBABOL.REC.1403.004 .

  • Funding/Support: This paper is supported by the financial grant associated with the M.Sc. dissertation of F. Z. R. G. at Babol University of Medical Sciences, as indicated by approval letter number 724134118.

  • Informed Consent: Written informed consent was obtained from all patients prior to the commencement of this research.

References

  • 1.
    do Espirito Santo EPT, Monteiro RC, da Costa ARF, Marques-da-Silva SH. Molecular identification, genotyping, phenotyping, and antifungal susceptibilities of medically important Trichosporon, Apiotrichum, and Cutaneotrichosporon species. Mycopathol J. 2020;185(2):307-17. [PubMed ID: 31776790]. https://doi.org/10.1007/s11046-019-00407-x.
  • 2.
    Francisco EC, de Almeida Junior JN, de Queiroz Telles F, Aquino VR, Mendes AVA, de Andrade Barberino MGM, et al. Species distribution and antifungal susceptibility of 358 Trichosporon clinical isolates collected in 24 medical centres. Clin Microbiol Infect. 2019;25(7):909 e1-5. [PubMed ID: 30991116]. https://doi.org/10.1016/j.cmi.2019.03.026.
  • 3.
    Guo LN, Yu SY, Hsueh PR, Al-Hatmi AMS, Meis JF, Hagen F, et al. Invasive infections due to Trichosporon: Species distribution, genotyping, and antifungal susceptibilities from a multicenter study in China. J Clin Microbiol. 2019;57(2). [PubMed ID: 30463892]. [PubMed Central ID: PMC6355529]. https://doi.org/10.1128/JCM.01505-18.
  • 4.
    Lara BR, de Camargo BB, Paula CR, Junior DPL, Garces HG, Arnoni MV, et al. Comparing the phenotypic, genotypic, and proteomic identification of Trichosporon species: A globally emerging yeast of medical importance. Med Mycol. 2021;59(12):1181-90. [PubMed ID: 34424343]. https://doi.org/10.1093/mmy/myab050.
  • 5.
    Iturrieta-Gonzalez IA, Padovan AC, Bizerra FC, Hahn RC, Colombo AL. Multiple species of Trichosporon produce biofilms highly resistant to triazoles and amphotericin B. PLoS One. 2014;9(10). e109553. [PubMed ID: 25360765]. [PubMed Central ID: PMC4215839]. https://doi.org/10.1371/journal.pone.0109553.
  • 6.
    Chagas-Neto TC, Chaves GM, Melo AS, Colombo AL. Bloodstream infections due to Trichosporon spp.: species distribution, Trichosporon asahii genotypes determined on the basis of ribosomal DNA intergenic spacer 1 sequencing, and antifungal susceptibility testing. J Clin Microbiol. 2009;47(4):1074-81. [PubMed ID: 19225102]. [PubMed Central ID: PMC2668300]. https://doi.org/10.1128/JCM.01614-08.
  • 7.
    Mirhendi H, Diba K, Rezaei A, Jalalizand N, Hosseinpur L, Khodadadi H. Colony PCR is a rapid and sensitive method for DNA amplification in yeasts. Iran J Public Health. 1970;36(1).
  • 8.
    Kim J, Kim MJ, Chong YP, Kim SH, Choi SH, Lee SO, et al. Comparison of the characteristics of patients with invasive infections and noninvasive infections caused by Trichosporon asahii. Med Mycol. 2021;59(3):296-300. [PubMed ID: 32876327]. https://doi.org/10.1093/mmy/myaa076.
  • 9.
    Borman AM, Muller J, Walsh-Quantick J, Szekely A, Patterson Z, Palmer MD, et al. MIC distributions for amphotericin B, fluconazole, itraconazole, voriconazole, flucytosine and anidulafungin and 35 uncommon pathogenic yeast species from the UK determined using the CLSI broth microdilution method. J Antimicrob Chemother. 2020;75(5):1194-205. [PubMed ID: 32025716]. https://doi.org/10.1093/jac/dkz568.
  • 10.
    Mehta V, Nayyar C, Gulati N, Singla N, Rai S, Chandar J. A comprehensive review of Trichosporon spp.: An invasive and emerging fungus. Cureus J. 2021;13(8). https://doi.org/10.7759/cureus.17345.
  • 11.
    Jamali S, Gharaei M. The first isolation of Trichosporon coremiiforme from soil in Iran. Curr Med Mycol. 2015;1(3):3-10. [PubMed ID: 28680990]. [PubMed Central ID: PMC5490323]. https://doi.org/10.18869/acadpub.cmm.1.3.3.
  • 12.
    Rodriguez-Tudela JL, Diaz-Guerra TM, Mellado E, Cano V, Tapia C, Perkins A, et al. Susceptibility patterns and molecular identification of Trichosporon species. Antimicrob Agents Chemother. 2005;49(10):4026-34. [PubMed ID: 16189076]. [PubMed Central ID: PMC1251560]. https://doi.org/10.1128/AAC.49.10.4026-4034.2005.
  • 13.
    Araujo Ribeiro M, Alastruey-Izquierdo A, Gomez-Lopez A, Rodriguez-Tudela JL, Cuenca-Estrella M. Molecular identification and susceptibility testing of Trichosporon isolates from a Brazilian hospital. Rev Iberoam Micol. 2008;25(4):221-5. [PubMed ID: 19071890].
  • 14.
    Makela P, Leaman D, Sobel JD. Vulvovaginal trichosporonosis. Infect Dis Obstet Gynecol. 2003;11(2):131-3. [PubMed ID: 14627220]. [PubMed Central ID: PMC1852272]. https://doi.org/10.1080/10647440300025510.
  • 15.
    Arabatzis M, Abel P, Kanellopoulou M, Adamou D, Alexandrou-Athanasoulis H, Stathi A, et al. Sequence-based identification, genotyping and EUCAST antifungal susceptibilities of Trichosporon clinical isolates from Greece. Clin Microbiol Infect. 2014;20(8):777-83. [PubMed ID: 24330082]. https://doi.org/10.1111/1469-0691.12501.
  • 16.
    Lemes RM, Lyon JP, Moreira LM, de Resende MA. Antifungal susceptibility profile of Trichosporon isolates: correlation between CLSI and etest methodologies. Braz J Microbiol. 2010;41(2):310-5. [PubMed ID: 24031497]. [PubMed Central ID: PMC3768694]. https://doi.org/10.1590/S1517-83822010000200008.

Copyright

Copyright © 2024, Ranjbar Golafshani et al. This open-access article is available under the Creative Commons Attribution 4.0 (CC BY 4.0) International License (https://creativecommons.org/licenses/by/4.0/), which allows for unrestricted use, distribution, and reproduction in any medium, provided that the original work is properly cited.

Similar Articles

18
Apr
2015

Isolation of Different Species of Candida in Patients With Vulvovaginal Candidiasis From Sari, Iran

Mohammad Taghi Hedayati,
Zahra Taheri,
Tahereh Galinimoghadam,
Seyed Reza Aghili,
Jamshid Yazdani Cherati,
Elham Mosayebi

Hedayati MT, Taheri Z, Galinimoghadam T, Aghili SR, Yazdani Cherati J, et al. Isolation of Different Species of Candida in Patients With Vulvovaginal Candidiasis From Sari, Iran. Jundishapur J Microbiol. 2015;8(4):e15992. doi: https://doi.org/10.5812/jjm.8(4)2015.15992

27
Mar
2016

Prevalence Rate of Vulvovaginal Candidiasis and Identification of Candida Species in Women in Referred to Hamedan Hospitals 2013 - 2014, West of Iran

Reza Habibipour

Habibipour R. Prevalence Rate of Vulvovaginal Candidiasis and Identification of Candida Species in Women in Referred to Hamedan Hospitals 2013 - 2014, West of Iran. Zahedan J Res Med Sci. 2016;18(3):e6250. doi: https://doi.org/10.17795/zjrms-6250

1
Aug
2017

Molecular Epidemiology and In Vitro Antifungal Susceptibility of Candida Isolates from Women with Vulvovaginal Candidiasis in Northern Cities of Khuzestan Province, Iran

Shirin Hasanvand,
Hamid Azadegan Qomi,
Mohammad Kord,
Mojtaba Didehdar

Hasanvand S, Azadegan Qomi H, Kord M, Didehdar M. Molecular Epidemiology and In Vitro Antifungal Susceptibility of Candida Isolates from Women with Vulvovaginal Candidiasis in Northern Cities of Khuzestan Province, Iran. Jundishapur J Microbiol. 2017;10(8):e12804. doi: https://doi.org/10.5812/jjm.12804

23
Jan
2018
An Unusual Case of Nosocomial <i>Trichosporon asahii</i> Fungemia in a Patient with <i>Tuberculous meningitis</i>

An Unusual Case of Nosocomial Trichosporon asahii Fungemia in a Patient with Tuberculous meningitis

Vijaya S Rajmane,
Shivkumar T Rajmane,
Virendra C Patil,
Vinayak V Raje

Rajmane VS, Rajmane ST, Patil VC, Raje VV. An Unusual Case of Nosocomial Trichosporon asahii Fungemia in a Patient with Tuberculous meningitis. Arch Clin Infect Dis. 2018;13(1):e66927. doi: https://doi.org/10.5812/archcid.66927

31
Dec
2007

Agents associated with candida vulvovaginitis in women referred to health centers in Qazvin

MR Aghamirian,
D Keshavarz,
H Jahani Hashemi,
M sadeghi Qazvini

Aghamirian M, Keshavarz D, Jahani Hashemi H, sadeghi Qazvini M. Agents associated with candida vulvovaginitis in women referred to health centers in Qazvin. J Inflamm Dis. 2024;11(3):e155341. doi:

Download PDF1.26 MB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles