Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Prevalence of Oral Helicobacter pylori and cagA Gene in Healthy Young Iranian Children: A Cross-Sectional Study

Author(s):
Nazanin ZargarNazanin Zargar1, Neda ShariatiniaNeda Shariatinia2, Bahareh HajikhaniBahareh Hajikhani3, Soodabeh  TaheriSoodabeh Taheri3, Payam PaymanpourPayam PaymanpourPayam Paymanpour ORCID1,*, Shivasadat TabatabaeiShivasadat TabatabaeiShivasadat Tabatabaei ORCID2, 4
1Department of Endodontics, School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4School of Public Health, Boston University, Boston, USA

Jundishapur Journal of Microbiology:Vol. 18, issue 4; e157964
Published online:Mar 15, 2025
Article type:Research Article
Received:Nov 12, 2024
Accepted:Mar 06, 2025
How to Cite:Zargar N, Shariatinia N, Hajikhani B, Taheri S, Paymanpour P, et al. Prevalence of Oral Helicobacter pylori and cagA Gene in Healthy Young Iranian Children: A Cross-Sectional Study. Jundishapur J Microbiol. 2025;18(4):e157964. doi: https://doi.org/10.5812/jjm-157964

Abstract

Background:

The oral cavity has been suggested as a potential reservoir for Helicobacter pylori, which plays a significant role in various health conditions. The cytotoxin-associated gene A (cagA gene) encodes an important virulence factor in H. pylori infection.

Objectives:

This study aimed to determine the prevalence of oral H. pylori and the cagA gene in healthy children (< 5 years) in Tehran, Iran, and explore associations with age, sex, family history of gastritis, and dental health status.

Methods:

This cross-sectional study included 160 asymptomatic children. Informed consent was obtained from parents or guardians after discussing the study details. Age, sex, and family history of gastritis were recorded using questionnaires. Dental health status was assessed by a trained dentist using the decayed, missing, and filled teeth (dmft) index. Oral samples were collected with sterile cotton swabs from the buccal and sublingual mucosa. Polymerase chain reaction (PCR) was used to detect H. pylori and the cagA gene. Statistical analysis was performed using Fisher’s exact test (α = 0.05).

Results:

Helicobacter pylori was detected in six participants (3.75%), and the cagA gene was present in all H. pylori-positive samples. No significant associations were found with age, sex, family history of gastritis, or the dmft score.

Conclusions:

A small percentage of participants had oral H. pylori, with no significant link to demographic factors, family history of gastritis, or dental health. Larger studies are needed to better understand the epidemiology and long-term risks of oral H. pylori colonization in Iranian children.

1. Background

Helicobacter pylori is a Gram-negative, microaerophilic bacterium that infects the gastrointestinal epithelium and affects nearly half of the global population (1). It is a common cause of chronic gastritis, which often remains asymptomatic (2). Additionally, it has been linked to various health conditions, including the aggravation of gastritis, duodenal ulcers, iron deficiency anemia, lymphoma, and reactive adenocarcinoma (3-5). As the only bacterium classified as a class 1 carcinogen (6), H. pylori is the strongest known risk factor for gastric adenocarcinoma, which accounts for nearly two-thirds of gastric cancer cases worldwide (7). Moreover, the expression of the cytotoxin-associated gene A (cagA) in H. pylori has been considered a risk marker for mucosal atrophy and carcinogenesis. The encoded protein induces morphological and malignant transformations in gastric epithelial cells by disrupting intracellular signaling pathways (5, 8, 9). The bacterium can evade the host’s immune system by entering the cytoplasm of gastric epithelial cells, where neoplastic transformation occurs through the oncogenic protein encoded by the cagA gene (5, 9). Notably, gastric inflammation works in tandem with compensatory genetic and epigenetic alterations, leading to self-sustaining carcinogenesis (5, 10).
Helicobacter pylori infection commonly occurs within the first decade of life (11). In children, it is often transient and self-limiting (12), with symptoms typically manifesting later in life (13). The presence of the bacterium in the oral cavity supports both fecal-oral and oral-oral transmission routes (14-17). Additionally, poor personal and food hygiene practices in densely populated areas significantly contribute to intrafamilial transmission (18). Interestingly, the eradication of H. pylori from the oral cavity has been shown to improve the success rate of gastric infection treatment (19). Consequently, several previous studies have suggested that oral H. pylori may indicate actual infection rather than mere transient colonization (16, 20, 21).
The established relationship between H. pylori infection and gastric cancer (7), along with its poor prognosis as a leading cause of cancer-related mortality (22, 23), underscores the importance of early detection (24). This is particularly relevant since the prevalence of H. pylori in adulthood has been suggested to depend on childhood infection (25). Previous studies on the Iranian population have reported H. pylori infection prevalence ranging from 30.6% to 82% (26). However, given the close relationship between oral H. pylori and actual infection (27), and the fact that H. pylori infection typically occurs before the age of five (28), the prevalence of the bacterium in young Iranian children has yet to be investigated.

2. Objectives

The present study aimed to detect H. pylori and the cagA gene using polymerase chain reaction (PCR) in oral samples from asymptomatic children under the age of five residing in Tehran, Iran. Additionally, the study explored associations with age, sex, family history of gastritis, and the decayed, missing, and filled teeth (dmft) score.

3. Methods

3.1. Study Design and Participants

Ten kindergartens across districts #1 and #2 of Tehran were selected for this cross-sectional study. A total of 160 asymptomatic, healthy children under five years of age participated. Participants were chosen using simple random sampling from a list of enrolled children provided by the kindergartens. The sample size was determined based on feasibility considerations and a previous study by Castro-Muñoz et al. on 162 asymptomatic young Mexican children, which reported a prevalence rate of 13% for oral H. pylori, with an expected precision of 5.21% (29). Only asymptomatic children whose parents provided written informed consent were included in the study. Confidentiality and anonymity of the participants were ensured throughout the research process. Children or parents/guardians unwilling to participate, as well as those with systemic diseases or gastrointestinal symptoms, were excluded from the study.

3.2. Data Collection

Data collection took place between January and March 2020. For each participant, information on age, sex, and family history of gastritis was obtained from parents or legal guardians using questionnaires specifically designed for this study. A trained dentist then conducted an individual oral examination for each participant through visual inspection, using a dental explorer and mirror under adequate lighting conditions, to record the dmft score (30).

3.3. Sample Collection

Oral samples were collected by swabbing the buccal mucosa and sublingual areas of each participant using sterile cotton swabs (Arta Teb, Iran) (29). The swabs were immediately placed in sterile test tubes containing Luria-Bertani (LB) broth (Thermo Fisher Scientific, USA) and transferred to an independent laboratory for further analysis. To minimize potential detection bias, PCR analysis was conducted by trained personnel who were blinded to the participants’ information (31).

3.4. DNA Extraction

Bacterial genomic DNA was extracted from the collected samples using the HiPurA™ Bacterial Genomic DNA Purification Kit (HiMedia, India) following the manufacturer’s instructions. The quantity and purity of the extracted DNA were evaluated using a NanoDrop spectrophotometer (Thermo Scientific, USA).

3.5. Polymerase Chain Reaction Analysis

The presence of H. pylori and the cagA gene in oral samples was evaluated using PCR with specific primers (Table 1). Each PCR reaction was carried out in a total volume of 25 µL, consisting of 12.5 µL of master mix (Amplicon, Denmark), 1 µL of each primer (10 pmol/µL), 2 µL of template DNA, and 8.5 µL of nuclease-free water. The thermal cycling conditions were as follows: Initial denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds (35 cycles); annealing at 55°C for 30 seconds; extension at 72°C for 1 minute; and a final extension at 72°C for 7 minutes (32). Genomic DNA from the standard H. pylori strain (ATCC 49503) was used as a positive control (33-35).
Table 1.Primer Sequences Used for Polymerase Chain Reaction
GenePrimer Sequence (5' - 3')Product Size (bp)Reference
16S rDNAF: AGAGTTTGATCCTGGCTCAG1500(36)
R: AAGGAGGTGATCCAGCCGCA
cagAF: AATACACCAACGCCTCCAAG400(33)
R: TTGTTGCCGCTTTTGCTCTC

Abbreviations: bp, base pair; cagA, cytotoxin-associated geneA; F, forward; R, reverse.

3.6. Gel Electrophoresis

The PCR products were analyzed by electrophoresis on a 1.5% agarose gel stained with ethidium bromide. The gel was run at 100 volts for 45 minutes in 1X TAE buffer and visualized under ultraviolet light using a gel documentation system (Bio-Rad, USA). The presence of specific bands corresponding to H. pylori and the cagA gene indicated positive samples (32).

3.7. Statistical Analysis

Statistical analysis was performed using SPSS software version 22.0 (IBM Corp., Armonk, NY, USA). Fisher’s exact test was used to examine associations between H. pylori presence and variables such as age, sex, family history of gastritis, and dmft scores. A P-value of less than 0.05 was considered statistically significant.

4. Results

4.1. Participants’ Demographics and Dental Health Status

The mean age of the children was 3.15 ± 1.30 years. No pathological soft-tissue oral lesions were observed during intraoral visual examinations. The dmft scores ranged from 0 to 3, with a mean of 1.56 ± 0.49. A positive family history of gastritis was reported in 25 children (15.6%).

4.2. Prevalence of Helicobacter pylori

The PCR identified bacterial genomic DNA in 6 children (3.75%), all of whom were also positive for the cagA gene. Statistical analysis did not reveal any significant association with the participants' age, sex, family history of gastritis, or dental health (P > 0.05). Table 2 provides a breakdown of participants by age group, sex, dmft score, and family history of gastritis.
Table 2.Demographic Information, Dental Health Status, and Family History of Gastritis a
VariablesValuePositive for Helicobacter pylori (%)P-Value b
Gender0.109
Male82 (51.25)5 (83.3)
Female78 (48.75)1 (16.7)
dmft Score0.173
094 (58.8)1 (16.7)
117 (10.6)1 (16.7)
233 (20.6)3 (49.9)
316 (10)1 (16.7)
Age0.567
< 120 (12.5)0
1 - 233 (20.6)2 (33.3)
2 - 342 (26.25)3 (50)
3 - 434 (21.25)1 (16.7)
4 - 531 (19.4)0
Family history of gastritis0.913
Present25 (15.6)1 (16.7)
Absent135 (84.4)5 (83.3)

Abbreviations: dmft, decayed, missing, and filled teeth; y, year (s).

a Values are expressed as Number (%).

b P ≤ 0.05 was considered as statistically significant.

5. Discussion

To the best of the authors' knowledge, no previous study has investigated the prevalence of H. pylori in young children in Tehran. Therefore, this study aimed to explore the oral prevalence of H. pylori and the cagA gene in symptom-free young children in this city. The PCR was used in this study due to its ability to exclude other phylogenetically close bacteria, such as Campylobacter species (37), as well as its high reliability and efficiency in detecting H. pylori in children (38). The results showed a detection rate of 3.75% among children, which is considerably lower than that reported for Iranians under 15 years old (42% prevalence, 95% CI: 41 - 44%) or for the general healthy Iranian population (30.6% to 82% overall prevalence, with an age range of four months to 83 years) (26, 39).
This disparity may stem from differences in detection methods—such as enzyme-linked immunosorbent assay or stool antigen—, age-related inclusion criteria, or socioeconomic factors. In fact, social class, parental educational level, living conditions, household size, and drinking water sources have all been shown to influence the prevalence of H. pylori, even within different regions of the same country (17, 18). Moreover, the low prevalence in this study can be explained by our sampling method, which did not include dental plaque. Indeed, dental plaque has the highest detection rate of H. pylori in the oral cavity owing to its biofilm characteristics (21, 40). The lower prevalence of H. pylori in younger children, compared to older children or adults, in other countries also help explain the low detection rate in this study (15, 26, 41).
In this study, the virulence gene cagA was detected in all H. pylori-positive oral samples. This finding is consistent with a previous study that reported similar results using saliva samples from Iranian adults with gastroduodenal disease, who were referred to an endoscopy center in a different city (34). Additionally, another study investigating H. pylori genotyping and host antibody response identified the cagA gene in 91% of Iranian H. pylori strains isolated from gastric biopsies (35). These findings suggest that the cagA gene may exhibit low regional and possibly age-related variability within Iran. However, further studies are needed to validate this hypothesis.
In the present study, none of the H. pylori-positive subjects reported experiencing gastrointestinal symptoms at the time of investigation. This lack of symptoms may be attributed to a diminished immune response and reduced cell infiltration in children following bacterial colonization, leading to less gastric inflammation compared to adults (42, 43). However, even in the absence of symptoms, when H. pylori infection is suspected, it is important to consider the increased risk of gastrointestinal ulceration, particularly from nonsteroidal anti-inflammatory drugs and chronic immune thrombocytopenic purpura (44).
Although H. pylori-positive participants in this study were predominantly male, the difference between the two sexes did not reach statistical significance. This finding aligns with a previous study evaluating anti-H. pylori IgG in the serum of 2,561 healthy adults living in rural and urban areas of Tehran province (45). A meta-analysis also confirmed the absence of a clear gender-based predisposition for H. pylori infection in children, possibly due to differential antibiotic exposure or gender-specific protective immunity rather than solely differential exposure (46). Interestingly, while sex was found to be of no significance in H. pylori prevalence among children in South Korea, being male was reported as a risk factor in adults (41). Thus, although no significant association was found in the present study, a higher bacterial detection rate in males may suggest a possible trend in young Iranian children that warrants further investigation.
The present study did not show any association between H. pylori detection and the dmft score, which aligns with a previous report by Mehdipour et al. (mean age: 7.97 ± 1.83 years) (30). In contrast, Sruthi et al. reported significantly higher mean scores in Indian H. pylori-positive children aged 3 - 6 years, demonstrating that higher caries status and caries severity were associated with a greater prevalence of H. pylori (47). This discrepancy may be attributed to their small sample size (n = 20), as well as differences in geographical location, age range, and sampling method.
The present study had several limitations. First, a larger sample size was required to detect small effect sizes. Second, the cross-sectional nature of the study was unable to provide data on incidence rates, sources of infection, or lifelong trends, all of which are essential for devising effective future prevention strategies. Third, while PCR is a highly specific method, it does not differentiate between transient colonization and persistent infection. Fourth, participants were recruited from only two districts, which may limit the generalizability of the findings. Consequently, future studies should include larger, more diverse samples and incorporate additional diagnostic techniques.

5.1. Conclusions

The prevalence of oral H. pylori was low in the study population. However, the cagA gene was detected in all H. pylori-positive participants. No associations were found with age, sex, family history, or dental health status.

Acknowledgments

Footnotes

References

  • 1.
    Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1983;1(8336):1273-5. [PubMed ID: 6134060].
  • 2.
    Blaser MJ. Ecology of Helicobacter pylori in the human stomach. J Clin Invest. 1997;100(4):759-62. [PubMed ID: 9259572]. [PubMed Central ID: PMC508245]. https://doi.org/10.1172/JCI119588.
  • 3.
    Salama NR, Hartung ML, Muller A. Life in the human stomach: persistence strategies of the bacterial pathogen Helicobacter pylori. Nat Rev Microbiol. 2013;11(6):385-99. [PubMed ID: 23652324]. [PubMed Central ID: PMC3733401]. https://doi.org/10.1038/nrmicro3016.
  • 4.
    Quaglia NC, Dambrosio A. Helicobacter pylori: A foodborne pathogen? World J Gastroenterol. 2018;24(31):3472-87. [PubMed ID: 30131654]. [PubMed Central ID: PMC6102504]. https://doi.org/10.3748/wjg.v24.i31.3472.
  • 5.
    Takahashi-Kanemitsu A, Knight CT, Hatakeyama M. Molecular anatomy and pathogenic actions of Helicobacter pylori CagA that underpin gastric carcinogenesis. Cell Mol Immunol. 2020;17(1):50-63. [PubMed ID: 31804619]. [PubMed Central ID: PMC6952403]. https://doi.org/10.1038/s41423-019-0339-5.
  • 6.
    Moller H, Heseltine E, Vainio H. Working group report on schistosomes, liver flukes and Helicobacter pylori. Int J Cancer. 1995;60(5):587-9. [PubMed ID: 7860130]. https://doi.org/10.1002/ijc.2910600502.
  • 7.
    Parkin DM. The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 2006;118(12):3030-44. [PubMed ID: 16404738]. https://doi.org/10.1002/ijc.21731.
  • 8.
    Kuipers EJ, Thijs JC, Festen HP. The prevalence of Helicobacter pylori in peptic ulcer disease. Aliment Pharmacol Ther. 1995;9 Suppl 2:59-69. [PubMed ID: 8547530].
  • 9.
    Song L, Song M, Rabkin CS, Chung Y, Williams S, Torres J, et al. Identification of anti-Helicobacter pylori antibody signatures in gastric intestinal metaplasia. J Gastroenterol. 2023;58(2):112-24. [PubMed ID: 36301365]. [PubMed Central ID: PMC9610335]. https://doi.org/10.1007/s00535-022-01933-0.
  • 10.
    Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature. 2008;454(7203):436-44. [PubMed ID: 18650914]. https://doi.org/10.1038/nature07205.
  • 11.
    Malfertheiner P, Camargo MC, El-Omar E, Liou JM, Peek R, Schulz C, et al. Helicobacter pylori infection. Nat Rev Dis Primers. 2023;9(1):19. [PubMed ID: 37081005]. [PubMed Central ID: PMC11558793]. https://doi.org/10.1038/s41572-023-00431-8.
  • 12.
    Kotilea K, Bontems P, Touati E. Epidemiology, diagnosis and risk factors of Helicobacter pylori infection. Adv Exp Med Biol. 2019;1149:17-33. [PubMed ID: 31016621]. https://doi.org/10.1007/5584_2019_357.
  • 13.
    Zabala Torrres B, Lucero Y, Lagomarcino AJ, Orellana-Manzano A, George S, Torres JP, et al. Review: Prevalence and dynamics of Helicobacter pylori infection during childhood. Helicobacter. 2017;22(5). [PubMed ID: 28643393]. https://doi.org/10.1111/hel.12399.
  • 14.
    Cai H, Li W, Shu X, Peng K, Zhang Y, Jiang M. Genetic variation of Helicobacter pylori in the oral cavity and stomach detected using thymine adenine cloning in children with chronic gastritis. Pediatr Infect Dis J. 2014;33(1):e1-6. [PubMed ID: 23989107]. https://doi.org/10.1097/INF.0000000000000017.
  • 15.
    Al Sayed A, Anand PS, Kamath KP, Patil S, Preethanath RS, Anil S. Oral cavity as an extragastric reservoir of Helicobacter pylori. ISRN Gastroenterol. 2014;2014:261369. [PubMed ID: 24701355]. [PubMed Central ID: PMC3950549]. https://doi.org/10.1155/2014/261369.
  • 16.
    Duan M, Li Y, Liu J, Zhang W, Dong Y, Han Z, et al. Transmission routes and patterns of helicobacter pylori. Helicobacter. 2023;28(1). e12945. [PubMed ID: 36645421]. https://doi.org/10.1111/hel.12945.
  • 17.
    Yuan C, Adeloye D, Luk TT, Huang L, He Y, Xu Y, et al. The global prevalence of and factors associated with Helicobacter pylori infection in children: A systematic review and meta-analysis. Lancet Child Adolesc Health. 2022;6(3):185-94. [PubMed ID: 35085494]. https://doi.org/10.1016/S2352-4642(21)00400-4.
  • 18.
    Kotilea K, Kalach N, Homan M, Bontems P. Helicobacter pylori infection in pediatric patients: Update on diagnosis and eradication strategies. Paediatr Drugs. 2018;20(4):337-51. [PubMed ID: 29785564]. https://doi.org/10.1007/s40272-018-0296-y.
  • 19.
    Wang XM, Yee KC, Hazeki-Taylor N, Li J, Fu HY, Huang ML, et al. Oral Helicobacter pylori, its relationship to successful eradication of gastric H. pylori and saliva culture confirmation. J Physiol Pharmacol. 2014;65(4):559-66. [PubMed ID: 25179088].
  • 20.
    Iwai K, Azuma T, Yonenaga T, Sasai Y, Watanabe K, Obora A, et al. Association between failed eradication of 7-day triple therapy for Helicobacter pylori and untreated dental caries in Japanese adults. Sci Rep. 2024;14(1):4043. [PubMed ID: 38369603]. [PubMed Central ID: PMC10874953]. https://doi.org/10.1038/s41598-024-54757-8.
  • 21.
    Aksit Bicak D, Akyuz S, Kiratli B, Usta M, Urganci N, Alev B, et al. The investigation of Helicobacter pylori in the dental biofilm and saliva samples of children with dyspeptic complaints. BMC Oral Health. 2017;17(1):67. [PubMed ID: 28327128]. [PubMed Central ID: PMC5361728]. https://doi.org/10.1186/s12903-017-0361-x.
  • 22.
    Nashimoto A, Akazawa K, Isobe Y, Miyashiro I, Katai H, Kodera Y, et al. Gastric cancer treated in 2002 in Japan: 2009 annual report of the JGCA nationwide registry. Gastric Cancer. 2013;16(1):1-27. [PubMed ID: 22729699]. [PubMed Central ID: PMC3549249]. https://doi.org/10.1007/s10120-012-0163-4.
  • 23.
    Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209-49. [PubMed ID: 33538338]. https://doi.org/10.3322/caac.21660.
  • 24.
    Huang JQ, Sridhar S, Hunt RH. Role of Helicobacter pylori infection and non-steroidal anti-inflammatory drugs in peptic-ulcer disease: A meta-analysis. Lancet. 2002;359(9300):14-22. [PubMed ID: 11809181]. https://doi.org/10.1016/S0140-6736(02)07273-2.
  • 25.
    Banatvala N, Mayo K, Megraud F, Jennings R, Deeks JJ, Feldman RA. The cohort effect and Helicobacter pylori. J Infect Dis. 1993;168(1):219-21. [PubMed ID: 8515114]. https://doi.org/10.1093/infdis/168.1.219.
  • 26.
    Eshraghian A. Epidemiology of Helicobacter pylori infection among the healthy population in Iran and countries of the Eastern Mediterranean Region: A systematic review of prevalence and risk factors. World J Gastroenterol. 2014;20(46):17618-25. [PubMed ID: 25516677]. [PubMed Central ID: PMC4265624]. https://doi.org/10.3748/wjg.v20.i46.17618.
  • 27.
    Iwai K, Watanabe I, Yamamoto T, Kuriyama N, Matsui D, Nomura R, et al. Association between Helicobacter pylori infection and dental pulp reservoirs in Japanese adults. BMC Oral Health. 2019;19(1):267. [PubMed ID: 31791309]. [PubMed Central ID: PMC6889519]. https://doi.org/10.1186/s12903-019-0967-2.
  • 28.
    Okuda M, Miyashiro E, Booka M, Tsuji T, Nakazawa T. Helicobacter pylori colonization in the first 3 years of life in Japanese children. Helicobacter. 2007;12(4):324-7. [PubMed ID: 17669105]. https://doi.org/10.1111/j.1523-5378.2007.00510.x.
  • 29.
    Castro-Munoz LJ, Gonzalez-Diaz CA, Munoz-Escobar A, Tovar-Ayona BJ, Aguilar-Anguiano LM, Vargas-Olmos R, et al. Prevalence of Helicobacter pylori from the oral cavity of Mexican asymptomatic children under 5 years of age through PCR. Arch Oral Biol. 2017;73:55-9. [PubMed ID: 27665274]. https://doi.org/10.1016/j.archoralbio.2016.09.007.
  • 30.
    Mehdipour A, Chaboki P, Rasouli Asl F, Aghaali M, Sharifinejad N, Shams S. Comparing the prevalence of Helicobacter pylori and virulence factors cagA, vacA, and dupA in supra-gingival dental plaques of children with and without dental caries: a case-control study. BMC Oral Health. 2022;22(1):170. [PubMed ID: 35534888]. [PubMed Central ID: PMC9087938]. https://doi.org/10.1186/s12903-022-02175-5.
  • 31.
    Kottner J, Audige L, Brorson S, Donner A, Gajewski BJ, Hrobjartsson A, et al. Guidelines for reporting reliability and agreement studies (GRRAS) were proposed. Int J Nurs Stud. 2011;48(6):661-71. [PubMed ID: 21514934]. https://doi.org/10.1016/j.ijnurstu.2011.01.016.
  • 32.
    Sambrook J, Russell DW. Molecular cloning: A laboratory manual. 3rd. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.
  • 33.
    Kabir S. Detection of Helicobacter pylori in faeces by culture, PCR and enzyme immunoassay. J Med Microbiol. 2001;50(12):1021-9. [PubMed ID: 11761185]. https://doi.org/10.1099/0022-1317-50-12-1021.
  • 34.
    Momtaz H, Souod N, Dabiri H, Sarshar M. Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J Gastroenterol. 2012;18(17):2105-11. [PubMed ID: 22563199]. [PubMed Central ID: PMC3342610]. https://doi.org/10.3748/wjg.v18.i17.2105.
  • 35.
    Talebkhan Y, Mohammadi M, Mohagheghi MA, Vaziri HR, Eshagh Hosseini M, Mohajerani N, et al. cagA gene and protein status among Iranian Helicobacter pylori strains. Dig Dis Sci. 2008;53(4):925-32. [PubMed ID: 17939043]. https://doi.org/10.1007/s10620-007-9978-y.
  • 36.
    Banerjee HN, Gramby M, Hawkins Z. Molecular diagnosis of Helicobacter pylori strain by 16S rDNA PCR amplification and direct sequencing. J Bioprocess Biotech. 2011;1. [PubMed ID: 24443707]. [PubMed Central ID: PMC3891930]. https://doi.org/10.4172/2155-9821.1000105e.
  • 37.
    Mendoza-Cantu A, Urrutia-Baca VH, Urbina-Rios CS, De la Garza-Ramos MA, Garcia-Martinez ME, Torre-Martinez HHH. Prevalence of Helicobacter pylori vacA genotypes and cagA gene in dental plaque of asymptomatic mexican children. Biomed Res Int. 2017;2017:4923640. [PubMed ID: 29226140]. [PubMed Central ID: PMC5687131]. https://doi.org/10.1155/2017/4923640.
  • 38.
    Guven B, Gulerman F, Kacmaz B. Helicobacter pylori resistance to clarithromycin and fluoroquinolones in a pediatric population in Turkey: A cross-sectional study. Helicobacter. 2019;24(3). e12581. [PubMed ID: 30950125]. https://doi.org/10.1111/hel.12581.
  • 39.
    Moosazadeh M, Lankarani KB, Afshari M. Meta-analysis of the prevalence of Helicobacter pylori infection among children and adults of Iran. Int J Prev Med. 2016;7:48. [PubMed ID: 27076886]. [PubMed Central ID: PMC4809131]. https://doi.org/10.4103/2008-7802.177893.
  • 40.
    Morales-Espinosa R, Fernandez-Presas A, Gonzalez-Valencia G, Flores-Hernandez S, Delgado-Sapien G, Mendez-Sanchez JL, et al. Helicobacter pylori in the oral cavity is associated with gastroesophageal disease. Oral Microbiol Immunol. 2009;24(6):464-8. [PubMed ID: 19832798]. https://doi.org/10.1111/j.1399-302X.2009.00541.x.
  • 41.
    Lim SH, Kim N, Kwon JW, Kim SE, Baik GH, Lee JY, et al. Trends in the seroprevalence of Helicobacter pylori infection and its putative eradication rate over 18 years in Korea: A cross-sectional nationwide multicenter study. PLoS One. 2018;13(10). e0204762. [PubMed ID: 30332428]. [PubMed Central ID: PMC6192591]. https://doi.org/10.1371/journal.pone.0204762.
  • 42.
    Serrano C, Wright SW, Bimczok D, Shaffer CL, Cover TL, Venegas A, et al. Downregulated Th17 responses are associated with reduced gastritis in Helicobacter pylori-infected children. Mucosal Immunol. 2013;6(5):950-9. [PubMed ID: 23299619]. [PubMed Central ID: PMC3775337]. https://doi.org/10.1038/mi.2012.133.
  • 43.
    Arnold IC, Lee JY, Amieva MR, Roers A, Flavell RA, Sparwasser T, et al. Tolerance rather than immunity protects from Helicobacter pylori-induced gastric preneoplasia. Gastroenterology. 2011;140(1):199-209. [PubMed ID: 20600031]. [PubMed Central ID: PMC3380634]. https://doi.org/10.1053/j.gastro.2010.06.047.
  • 44.
    Kim BJ, Kim HS, Jang HJ, Kim JH. Helicobacter pylori eradication in idiopathic thrombocytopenic purpura: A meta-analysis of randomized trials. Gastroenterol Res Pract. 2018;2018:6090878. [PubMed ID: 30402091]. [PubMed Central ID: PMC6198559]. https://doi.org/10.1155/2018/6090878.
  • 45.
    Nouraie M, Latifi-Navid S, Rezvan H, Radmard AR, Maghsudlu M, Zaer-Rezaii H, et al. Childhood hygienic practice and family education status determine the prevalence of Helicobacter pylori infection in Iran. Helicobacter. 2009;14(1):40-6. [PubMed ID: 19191895]. https://doi.org/10.1111/j.1523-5378.2009.00657.x.
  • 46.
    de Martel C, Parsonnet J. Helicobacter pylori infection and gender: A meta-analysis of population-based prevalence surveys. Dig Dis Sci. 2006;51(12):2292-301. [PubMed ID: 17089189]. https://doi.org/10.1007/s10620-006-9210-5.
  • 47.
    Sruthi MA, Mani G, Ramakrishnan M, Selvaraj J. Dental caries as a source of Helicobacter pylori infection in children: An RT-PCR study. Int J Paediatr Dent. 2023;33(1):82-8. [PubMed ID: 35771167]. https://doi.org/10.1111/ipd.13017.

Similar Articles

12
Dec
2012

Prevalence of Helicobacter Pylori Infection in Children, a Population-Based Cross-Sectional Study in West Iran

Jafar Soltani,
Jalil Amirzadeh,
Soheila Nahedi,
Sirous Shahsavari

Soltani J, Amirzadeh J, Nahedi S, Shahsavari S. Prevalence of Helicobacter Pylori Infection in Children, a Population-Based Cross-Sectional Study in West Iran. Inn J Pediatr. 2013;23(1):. doi:

16
Jan
2016

Helicobacter pylori Seropositivity in Children With Asthma

Parsa Yousefichaijan,
Ghasem Mosayebi,
Mojtaba Sharafkhah,
Manijeh Kahbazi,
Phaezeh Heydarbagi,
Mohammad Rafiei

Yousefichaijan P, Mosayebi G, Sharafkhah M, Kahbazi M, Heydarbagi P, et al. Helicobacter pylori Seropositivity in Children With Asthma. Arch Pediatr Infect Dis. 2016;4(1):e26639. doi: https://doi.org/10.5812/pedinfect.26639

24
Jan
2023
Arch Clin Infect Dis

Is Helicobacter pylori Infection Prevalent in Middle East Countries?

Peiman Nasri,
Hossein Saneian,
Fatemeh Famoori,
Majid Khademian,
Fatemeh Salehi

Nasri P, Saneian H, Famoori F, Khademian M, Salehi F. Is Helicobacter pylori Infection Prevalent in Middle East Countries?. Arch Clin Infect Dis. 2022;17(6):e123364. doi: https://doi.org/10.5812/archcid-123364

15
Aug
2013

Association between Helicobacter pylori, cagA, and vacA Status and Clinical Presentation in Iranian Children

Reza Ghotaslou,
Mandana Rafeey,
Morteza Milani,
Nima Farokhi,
Morteza Ghojazadeh

Ghotaslou R, Rafeey M, Milani M, Farokhi N, Ghojazadeh M. Association between Helicobacter pylori, cagA, and vacA Status and Clinical Presentation in Iranian Children. Inn J Pediatr. 2013;23(5):. doi:

23
Dec
2015

Primary Antibiotic Resistance to Helicobacter pylori Strains Isolated From Children in Northern Iran: A Single Center Study

Shohreh Maleknejad,
Ali Mojtahedi,
Afshin Safaei-Asl,
Zeinab Taghavi,
Ehsan Kazemnejad

Maleknejad S, Mojtahedi A, Safaei-Asl A, Taghavi Z, Kazemnejad E. Primary Antibiotic Resistance to Helicobacter pylori Strains Isolated From Children in Northern Iran: A Single Center Study. Inn J Pediatr. 2015;25(6):e2661. doi: https://doi.org/10.5812/ijp.2661


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles