Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Detection of Carbapenemase Genes in Acinetobacter baumannii Isolates from Al-Azizya Hospital, Wasit, Iraq

Author(s):
Asmaa Jalil AlawiAsmaa Jalil Alawi1, Fazel PourahmadFazel PourahmadFazel Pourahmad ORCID1,*, Khadijeh FattahiKhadijeh Fattahi2
1Department of Microbiology, Faculty of Veterinary Sciences, Ilam University, Ilam, Iran
2Department of Cell and Molecular Biology and Microbiology, Faculty of Biological Science and Technology, University of Isfahan, Isfahan, Iran

Jundishapur Journal of Microbiology:Vol. 18, issue 6; e159737
Published online:Jun 03, 2025
Article type:Research Article
Received:Feb 01, 2025
Accepted:May 15, 2025
How to Cite:Jalil Alawi A, Pourahmad F, Fattahi K. Detection of Carbapenemase Genes in Acinetobacter baumannii Isolates from Al-Azizya Hospital, Wasit, Iraq. Jundishapur J Microbiol. 2025;18(6):e159737. doi: https://doi.org/10.5812/jjm-159737

Abstract

Background:

Acinetobacter baumannii is a critical nosocomial pathogen notorious for its multidrug resistance (MDR) and ability to cause severe infections, particularly in intensive care units (ICUs). Carbapenem-resistant A. baumannii (CRAB) poses a significant public health threat due to limited treatment options and high mortality rates.

Objectives:

This study aimed to detect carbapenemase genes (blaOXA-23, blaOXA-48, blaNDM, and blaVIM) and evaluate antibiotic resistance patterns in A. baumannii isolates from Al-Azizya Hospital, Wasit, Iraq.

Methods:

Fifty-eight A. baumannii isolates were collected from clinical samples and identified using phenotypic and biochemical tests. Antibiotic susceptibility was assessed via the disk diffusion method, and carbapenemase genes were detected using PCR.

Results:

All isolates harbored the intrinsic blaOXA-51 gene, confirming their identity as A. baumannii. The prevalence of carbapenemase genes was as follows: blaOXA-23 (26%), blaVIM (24%), blaOXA-48 (22%), and blaNDM (21%). High resistance rates were observed against ceftazidime (100%), meropenem (96%), and imipenem (95%), with aztreonam showing the lowest resistance (59%).

Conclusions:

These findings highlight the genetic diversity of carbapenem resistance mechanisms in this region and underscore the urgent need for stringent infection control measures, including enhanced surveillance, strict antibiotic stewardship, and the development of novel therapeutic strategies to combat CRAB infections. This study contributes to a better understanding of CRAB’s molecular epidemiology in Iraq and informs strategies to mitigate the spread of MDR A. baumannii in healthcare settings.

1. Background

Acinetobacter baumannii is a Gram-negative, non-fermenting coccobacillus that has emerged as a significant nosocomial pathogen, particularly in intensive care units (ICUs) and burn wards. Its ability to cause severe, hard-to-treat infections and its remarkable capacity to develop multidrug resistance (MDR) has made it a formidable challenge for healthcare systems worldwide. The World Health Organization (WHO) has classified A. baumannii as a "critical priority" pathogen, emphasizing the urgent need for new therapeutic strategies to combat its spread (1). The pathogenicity of A. baumannii is driven by several virulence factors, including biofilm formation and capsular polysaccharide production. Biofilms enable the bacterium to adhere to surfaces, such as medical devices, and protect it from both host immune responses and antibiotics (2). Capsular polysaccharides further enhance its virulence by shielding it from phagocytosis and other immune defenses (3). These traits and its ability to survive in harsh environments make A. baumannii a persistent threat in healthcare settings. Studies have shown that the bacterium can survive on dry surfaces for up to 30 days, with survival prolonged in moist conditions, complicating infection control efforts (4).
One of the most alarming features of A. baumannii is its capacity to develop MDR, especially to carbapenems, which are often regarded as last-resort treatments. The rise of carbapenem-resistant A. baumannii (CRAB) has severely limited therapeutic options, leaving clinicians with few effective antibiotics (5). Resistance to carbapenems is primarily mediated by the production of carbapenem-hydrolyzing class D β-lactamases (CHDLs), such as OXA-23 and OXA-24, which degrade carbapenems and other β-lactam antibiotics (6). Additionally, efflux pump overexpression and alterations in outer membrane permeability contribute to its resistance profile (7). As a result, treatment often relies on polymyxins and combination therapies, which are associated with higher toxicity and limited efficacy (8).
Carbapenem resistance in A. baumannii is primarily driven by carbapenemase enzymes encoded by genes such as blaOXA-23, blaOXA-48, blaNDM, and blaVIM. These enzymes hydrolyze carbapenems, rendering them ineffective. For example, blaOXA-48, frequently found in Enterobacteriaceae, can transfer between bacterial species, spreading resistance (9). Similarly, blaNDM and blaVIM significantly contribute to resistance in Pseudomonas aeruginosa and A. baumannii (10). These genes are often linked to high rates of MDR, complicating treatment and infection control efforts (11).
In the Middle East, including Iraq, the prevalence of CRAB is rising, posing significant challenges to healthcare systems already strained by limited resources and high rates of hospital-acquired infections. Globally, CRAB has been reported with high prevalence in regions such as Europe (e.g., Greece and Italy) and Asia (e.g., China and India), reflecting a widespread challenge to infection control (12, 13). A study from Jordan reported 98.1% resistance to meropenem and 87.7% resistance to imipenem among CRAB isolates, highlighting the severity of the issue (14). In Iran, genomic analyses have revealed the presence of multiple antibiotic resistance genes in CRAB strains, underscoring the ongoing evolution and spread of these pathogens (11). The increasing rates of CRAB infections are particularly concerning in resource-limited settings, where infection control measures and access to effective antibiotics are often inadequate (12).
In Iraq, particularly in the Wasit region, data on the molecular epidemiology of carbapenemase genes in A. baumannii isolates are limited. However, studies in Erbil have identified blaOXA-23 and blaOXA-51 as the most prevalent carbapenemase genes among isolates, with ST 556 and ST 218 being the most common sequence types (15). Another study in Iraq found that all tested isolates carried blaOXA-23 and blaOXA-51, with some also harboring blaOXA-58 (16). These findings highlight a concerning level of carbapenem resistance in Iraq, though data from the Wasit region remain scarce. Understanding the prevalence and distribution of carbapenemase genes is crucial for developing effective infection control strategies and guiding empirical antibiotic therapy. The genetic adaptability of A. baumannii, combined with its ability to thrive in hospital environments and disseminate resistance genes via mobile genetic elements (MGEs), has made CRAB a major public health threat (17). Global travel further facilitates the spread of resistant strains into new environments, underscoring the need for coordinated international efforts to address this growing crisis (18).

2. Objectives

This study aimed to: (1) Detect the presence of carbapenemase genes (blaOXA-23, blaOXA-48, blaNDM, and blaVIM) in A. baumannii isolates from Al-Azizya Hospital, Wasit, Iraq; (2) assess their antibiotic resistance patterns; and (3) analyze the distribution of these genes and resistance profiles to enhance understanding of CRAB’s molecular epidemiology in Iraq and guide local infection control and antibiotic stewardship strategies.

3. Methods

3.1. Sample Collection

Clinical specimens, including urine, wound swabs, blood, and respiratory secretions, were collected from 112 patients (49 in the ICU and 63 in non-ICU wards) at Al-Azizya Hospital, Wasit, Iraq (Figure 1), from May to November 2023, following standard microbiological protocols (19).
Map of Iraq highlighting Wasit province, where the study was conducted
Figure 1.

Map of Iraq highlighting Wasit province, where the study was conducted

3.2. Phenotypic Characterization of the Isolates

Clinical specimens were cultured on MacConkey and blood agar at 37°C for 24 - 48 hours to isolate A. baumannii (19). Suspected colonies, identified by their non-lactose-fermenting, smooth, and mucoid appearance, were subjected to Gram staining to confirm gram-negative coccobacilli morphology. Phenotypic identification was performed using standard biochemical tests, including oxidase (negative), catalase (positive), citrate utilization (positive), motility (non-motile), and growth at 44°C (positive). The API 20NE system (bioMérieux, France) was used to confirm identification, following the manufacturer’s instructions.

3.3. Antibiotic Susceptibility Testing

Antibiotic susceptibility was assessed using the disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI) guidelines (M100, 33rd edition, 2023) (20). The following antibiotics were tested: Ceftazidime, cefotaxime, ciprofloxacin, ceftriaxone, gentamicin, amikacin, aztreonam, imipenem, and meropenem.

3.4. Molecular Detection of Carbapenemase Genes

DNA was extracted from bacterial isolates using a simple boiling method (21). PCR was performed to detect the presence of blaOXA-23, blaOXA-48, blaNDM, and blaVIM genes using specific primers listed in Table 1. The blaOXA-51 gene, intrinsic to A. baumannii, was used as a confirmatory marker for species identification (22). Acinetobacter baumannii (ATCC 19606) was used as the positive control, and molecular-grade water was used as the negative control in all PCR assays. PCR products were visualized on 1.5% agarose gels stained with ethidium bromide and compared against a DNA 100 bp size marker for identification (22).
Table 1.The List of Oligonucleotide Primers Used in This Study
Target Genes and Primer Sequence (5'→3')PCR Product Size (bp)Reference
blaOXA-51353(23)
F: TAATGCTTTGATCGGCCTTG
R: TGGATTGCACTTCATCTTGG
blaVIM390(23)
F: GATGGTGTTTGGTCGCATA
R: CGAATGCGCAGCACCAG
blaNDM621(23)
F: GGTTTGGCGATCTGGTTTTC
R: CGGAATGGCTCATCACGATC
blaOXA-23300(23)
F: GATGTGTCATAGTATTCGTCG
R: TCACAACAACTAAAAGCACTG
blaOXA-48597(23)
F: AACGGGCGAACCAAGCATTTT
R: TGAGCACTTCTTTTGTGATGGCT

4. Results

4.1. Phenotypic and Genotypic Characterization of Strains

Based on the biochemical and Gram staining results, 63 isolates were identified as A. baumannii. However, using PCR of the species-specific marker blaOXA-51 gene, 58 (92%) isolates were confirmed to be A. baumannii (Figure 2).
Agarose gel electrophoresis of PCR-amplified <i>bla</i><sub>OXA-51</sub> gene in <i>Acinetobacter baumannii</i> isolates. Lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from <i>A. baumanii</i> isolates, displaying expected bands (353 bp).
Figure 2.

Agarose gel electrophoresis of PCR-amplified blaOXA-51 gene in Acinetobacter baumannii isolates. Lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from A. baumanii isolates, displaying expected bands (353 bp).

4.2. Frequency of Isolates Based on the Type of Patient Wards and Gender

As shown in Table 2, out of 58 isolates, 32 were recovered from 49 patients hospitalized in the ICU, while 26 isolates were collected from 63 patients in the non-ICU wards. Of these, 38 strains (65.5%) were isolated from women, and 20 strains (34.5%) were recovered from men.
Table 2.Frequency of Acinetobacter baumannii Isolates Based on the Type of Patient Wards and Gender
CategoriesICU WardsNon-ICU WardsTotal
Number of patients4963112
Female365187
Male131225
Number of isolates322658
Gender distribution of isolates; No. (%)
Female--38 (65.5)
Male--20 (34.5)

4.3. Frequency of Strains Based on the Type of Patient Specimens

As indicated in Table 3, out of 58 A. baumannii strains, the highest number was related to urine samples (43.1%), while the lowest number was related to catheter samples (6.9%).
Table 3.Frequency of Strains According to the Type of Patient Specimens a
VariablesValues
Type of specimens
Urine25 (43.1)
Blood14 (24.2)
Wound 9 (15.5)
Respiratory secretions6 (10.3)
Catheter4 (6.9)
Total58 (100)

a Values are expressed as No. (%).

4.4. Antibacterial Sensitivity Test

Urine samples yielded the highest number of isolates (43.1%), followed by blood (24.2%), wound (15.5%), respiratory secretions (10.3%), and catheters (6.9%).

4.5. Detection of Carbapenemase Genes

The blaNDM gene was detected in 12 isolates (21%), while the blaVIM gene was found in 14 isolates (24%), and the blaOXA-23 gene was detected in 15 isolates (26%). Additionally, the blaOXA-48 gene was identified in 13 isolates (22%) (Figure 3A - D). The frequency of each gene is summarized in Table 4.
Agarose gel electrophoresis of PCR products for carbapenemase genes detection in <i>Acinetobacter baumannii</i> isolates. A, Lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from isolates, displaying predictable bands (621 bp), indicative of the amplified <i>bla</i><sub>NDM</sub> gene; B, lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 – 17, PCR products from isolates, exhibiting expected bands (390 bp), representing the amplified <i>bla</i><sub>VIM</sub> gene; C, lanes: (M) DNA size marker (100 - 1500 bp), (C+) positive control, (C-) negative control, 1 - 17, PCR products from isolates, displaying expected bands (390 bp), corresponding to the amplified <i>bla</i><sub>OXA-23</sub> gene; D, lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from isolates, showing a band at 390 bp, representing the amplified <i>bla</i><sub>OXA-48 </sub>gene.
Figure 3.

Agarose gel electrophoresis of PCR products for carbapenemase genes detection in Acinetobacter baumannii isolates. A, Lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from isolates, displaying predictable bands (621 bp), indicative of the amplified blaNDM gene; B, lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 – 17, PCR products from isolates, exhibiting expected bands (390 bp), representing the amplified blaVIM gene; C, lanes: (M) DNA size marker (100 - 1500 bp), (C+) positive control, (C-) negative control, 1 - 17, PCR products from isolates, displaying expected bands (390 bp), corresponding to the amplified blaOXA-23 gene; D, lanes: (M) DNA size marker (100 - 1500 bp), (C-) negative control, (C+) positive control, 1 - 17, PCR products from isolates, showing a band at 390 bp, representing the amplified blaOXA-48 gene.

Table 4.Frequency of Studied Genes a
Target GenePositive Isolates
blaOXA-5158 (100)
blaNDM12 (21)
blaVIM14 (24)
blaOXA-2315 (26)
blaOXA-4813 (22)

a Values are expressed as No. (%).

5. Discussion

The findings of this study reveal a concerning prevalence of carbapenemase genes among A. baumannii isolates from Al-Azizya Hospital. The blaOXA-51 gene, an intrinsic marker for A. baumannii, was detected in all isolates, confirming their identity. This aligns with global studies reporting the ubiquity of blaOXA-51 in A. baumannii isolates, often accompanied by other carbapenemase genes such as blaOXA-23 and blaOXA-58 (24). The presence of these genes is particularly alarming due to their association with MDR, a significant challenge in healthcare settings (25). The detection of blaOXA-23 (26%), blaVIM (24%), blaOXA-48 (22%), and blaNDM (21%) highlights the genetic diversity of carbapenem resistance mechanisms in this region. These findings are consistent with studies in the Middle East, such as in Iraq and Egypt, where blaOXA-23 was the predominant gene among CRAB and Klebsiella pneumoniae isolates, with blaNDM also contributing significantly to resistance profiles (15, 16, 26). Similarly, a Jordanian study reported high resistance to meropenem (98.1%) and imipenem (87.7%), mirroring our observed rates (96% and 95%, respectively) (14).
However, contrasting results have been reported in other regions. For instance, a study in South Korea found a lower prevalence of blaNDM (5%) among A. baumannii isolates, with blaOXA-23 dominating at 80%, suggesting regional variations in resistance gene distribution (13). In Europe, particularly in Greece, blaVIM was more prevalent than blaOXA-23 in some hospital settings, highlighting differing resistance mechanisms (12, 18, 22). These comparisons underscore the need for region-specific surveillance to tailor infection control strategies.
The presence of blaOXA-23 is particularly concerning due to its association with high-level carbapenem resistance and its role in hospital outbreaks. This gene is often linked to insertion sequences that enhance its expression and mobilization, contributing to the virulence and resistance of A. baumannii (27). Similarly, detecting blaVIM and blaNDM, which encode metallo-β-lactamases, further complicates treatment options. These genes confer resistance to a broad range of β-lactam antibiotics, including carbapenems, which are often considered last-resort treatments for severe infections (28). The emergence of these resistance genes poses a significant public health threat, necessitating alternative treatment strategies such as combination therapies or newer antibiotics like cefiderocol (29).
The antibiotic resistance patterns observed in this study reflect a global trend of increasing resistance among A. baumannii isolates. The highest resistance rates were observed against ceftazidime (100%), meropenem (96%), and imipenem (95%), which are critical antibiotics for treating MDR infections. These findings are consistent with reports from other regions, highlighting the urgent need for enhanced surveillance and infection control measures to mitigate the spread of resistant strains (14). The COVID-19 pandemic has further exacerbated these trends, with shifts in bacterial prevalence and resistance profiles observed during this period (30). The resistance to cephalosporins and carbapenems underscores the need for alternative treatment options and stricter antibiotic stewardship programs. Newer agents such as ceftazidime-avibactam, meropenem-vaborbactam, and cefiderocol have shown promise against resistant strains and should be considered in treatment regimens (31). Effective stewardship programs are essential to optimize antibiotic use, reduce unnecessary prescriptions, and monitor resistance patterns, thereby preserving the efficacy of existing antibiotics (32).
While aztreonam retains some utility against CRAB, with a resistance rate of approximately 59%, its effectiveness varies depending on the specific resistance mechanisms present. Susceptibility testing is therefore crucial before treatment (33). Similarly, the high resistance rates to aminoglycosides (50.2%) and fluoroquinolones (65.7%) among CRAB isolates further limit therapeutic options, necessitating the exploration of alternative therapies and combination treatments (34, 35).
The high prevalence of carbapenemase genes and antibiotic resistance in A. baumannii isolates from Al-Azizya Hospital underscores the urgent need for stringent infection control measures. The ability of A. baumannii to form biofilms enhances its persistence in clinical settings, complicating eradication efforts (36). To mitigate the spread of resistant strains, healthcare facilities must implement rigorous infection control protocols, including enhanced surveillance, strict hand hygiene, contact precautions, and environmental disinfection (37). Continuous education and training for healthcare workers are also vital to ensure compliance with these measures (38).
While this study provides valuable insights into the molecular characteristics of A. baumannii isolates, it is limited by a small sample size from a single hospital and a focus on carbapenemase genes without exploring other resistance mechanisms. Clinical variables such as patient age, underlying diseases, and immunodeficiency status were not examined. Future studies should incorporate these factors to identify risk factors for CRAB infections and inform targeted prevention strategies.

5.1. Conclusions

This study demonstrates the high prevalence of carbapenemase genes and antibiotic resistance in A. baumannii isolates from Al-Azizya Hospital in Wasit, Iraq. The presence of blaOXA-23, blaVIM, blaOXA-48, and blaNDM genes highlights the genetic diversity of carbapenem resistance mechanisms in this region. These findings underscore the urgent need for effective infection control measures, including strict antibiotic stewardship and enhanced surveillance of CRAB in Iraqi hospitals. Additionally, the development of new therapeutic strategies, such as combination therapies and novel antibiotics, is essential to combat the growing threat of multidrug-resistant A. baumannii.

Acknowledgments

Footnotes

References

  • 1.
    Nocera FP, Attili AR, De Martino L. Acinetobacter baumannii: Its clinical significance in human and veterinary medicine. Pathogens. 2021;10(2). [PubMed ID: 33513701]. [PubMed Central ID: PMC7911418]. https://doi.org/10.3390/pathogens10020127.
  • 2.
    Gedefie A, Demsis W, Ashagrie M, Kassa Y, Tesfaye M, Tilahun M, et al. Acinetobacter baumannii biofilm formation and its role in disease pathogenesis: A review. Infect Drug Resist. 2021;14:3711-9. [PubMed ID: 34531666]. [PubMed Central ID: PMC8439624]. https://doi.org/10.2147/IDR.S332051.
  • 3.
    Ching C, Yang B, Onwubueke C, Lazinski D, Camilli A, Godoy VG. Lon protease has multifaceted biological functions in Acinetobacter baumannii. J Bacteriol. 2019;201(2). [PubMed ID: 30348832]. [PubMed Central ID: PMC6304660]. https://doi.org/10.1128/JB.00536-18.
  • 4.
    Towner KJ. Acinetobacter: An old friend, but a new enemy. J Hosp Infect. 2009;73(4):355-63. [PubMed ID: 19700220]. https://doi.org/10.1016/j.jhin.2009.03.032.
  • 5.
    Dettori M, Piana A, Deriu MG, Lo Curto P, Cossu A, Musumeci R, et al. Outbreak of multidrug-resistant Acinetobacter baumannii in an intensive care unit. New Microbiol. 2014;37(2):185-91. [PubMed ID: 24858645].
  • 6.
    Vazquez-Ucha JC, Maneiro M, Martinez-Guitian M, Buynak J, Bethel CR, Bonomo RA, et al. Activity of the beta-lactamase inhibitor LN-1-255 against carbapenem-hydrolyzing class D beta-lactamases from Acinetobacter baumannii. Antimicrob Agents Chemother. 2017;61(11). [PubMed ID: 28807908]. [PubMed Central ID: PMC5655052]. https://doi.org/10.1128/AAC.01172-17.
  • 7.
    Vahhabi A, Hasani A, Rezaee MA, Baradaran B, Hasani A, Samadi Kafil H, et al. A plethora of carbapenem resistance in Acinetobacter baumannii: No end to a long insidious genetic journey. J Chemother. 2021;33(3):137-55. [PubMed ID: 33243098]. https://doi.org/10.1080/1120009X.2020.1847421.
  • 8.
    De Oliveira DMP, Forde BM, Phan MD, Steiner B, Zhang B, Zuegg J, et al. Rescuing tetracycline class antibiotics for the treatment of multidrug-resistant Acinetobacter baumannii pulmonary infection. mBio. 2022;13(1). e0351721. [PubMed ID: 35012353]. [PubMed Central ID: PMC8749419]. https://doi.org/10.1128/mbio.03517-21.
  • 9.
    Elshamy AA, Saleh SE, Alshahrani MY, Aboshanab KM, Aboulwafa MM, Hassouna NA. OXA-48 carbapenemase-encoding transferable plasmids of Klebsiella pneumoniae recovered from Egyptian patients suffering from complicated urinary tract infections. Biology (Basel). 2021;10(9). [PubMed ID: 34571766]. [PubMed Central ID: PMC8469419]. https://doi.org/10.3390/biology10090889.
  • 10.
    Kim YA, Jeong SH, Shin JH, Shin KS, Shin JH, Kim YR, et al. Four genotypes of carbapenem-resistant Acinetobacter baumannii strains lacking OXA-23 production in Korea. Ann Clin Microbiol. 2024;27(2):143-7. https://doi.org/10.5145/acm.2024.27.2.8.
  • 11.
    Douraghi M, Kenyon JJ, Aris P, Asadian M, Ghourchian S, Hamidian M. Accumulation of antibiotic resistance genes in carbapenem-resistant Acinetobacter baumannii isolates belonging to lineage 2, global clone 1, from outbreaks in 2012-2013 at a Tehran burns hospital. mSphere. 2020;5(2). [PubMed ID: 32269158]. [PubMed Central ID: PMC7142300]. https://doi.org/10.1128/mSphere.00164-20.
  • 12.
    Muller C, Reuter S, Wille J, Xanthopoulou K, Stefanik D, Grundmann H, et al. A global view on carbapenem-resistant Acinetobacter baumannii. mBio. 2023;14(6). e0226023. [PubMed ID: 37882512]. [PubMed Central ID: PMC10746149]. https://doi.org/10.1128/mbio.02260-23.
  • 13.
    Bae IK, Hong JS. The distribution of carbapenem-resistant Acinetobacter species and high prevalence of CC92 OXA-23-producing Acinetobacter Baumannii in community hospitals in South Korea. Infect Drug Resist. 2024;17:1633-41. [PubMed ID: 38707988]. [PubMed Central ID: PMC11068040]. https://doi.org/10.2147/IDR.S459739.
  • 14.
    AlFaris EA, Al-Karablieh N, Odat NA, Rafei R. Carbapenem-resistant Acinetobacter baumannii from Jordan: Complicated carbapenemase combinations. Jordan J Biol Sci. 2024;17(2):355-61. https://doi.org/10.54319/jjbs/170216.
  • 15.
    Abduljabar KA, Mawlood AH. Multilocus sequence typing analysis and molecular characterization of carbapenemase related genes in Acinetobacter baumannii isolated from hospitalized patients in Erbil city, Iraq. Cell Mol Biol (Noisy-le-grand). 2023;69(11):116-24. [PubMed ID: 38015532]. https://doi.org/10.14715/cmb/2023.69.11.18.
  • 16.
    Alzaidi JR. Prevalence of OXA genes responsible for carbapenem-resistance among Acinetobacter baumannii isolated from clinical samples in Iraq. Med J Babylon. 2023;20(3):632-7. https://doi.org/10.4103/mjbl.Mjbl_828_23.
  • 17.
    Odih EE, Sunmonu GT, Okeke IN, Dalsgaard A. NDM-1- and OXA-23-producing Acinetobacter baumannii in wastewater of a Nigerian hospital. Microbiol Spectr. 2023;11(6). e0238123. [PubMed ID: 37796014]. [PubMed Central ID: PMC10714947]. https://doi.org/10.1128/spectrum.02381-23.
  • 18.
    Theriault N, Tillotson G, Sandrock CE. Global travel and gram-negative bacterial resistance; implications on clinical management. Expert Rev Anti Infect Ther. 2021;19(2):181-96. [PubMed ID: 32815412]. https://doi.org/10.1080/14787210.2020.1813022.
  • 19.
    Ababneh Q, Abulaila S, Jaradat Z. Isolation of extensively drug resistant Acinetobacter baumannii from environmental surfaces inside intensive care units. Am J Infect Control. 2022;50(2):159-65. [PubMed ID: 34520789]. https://doi.org/10.1016/j.ajic.2021.09.001.
  • 20.
    Clinical & Laboratory Standards Institute. Performance standards antimicrobial susceptibility testing. Wayne, PA: Clinical & Laboratory Standards Institute; 2023. Available from: https://clsi.org/shop/standards/m100/.
  • 21.
    Hajizadeh M, Pourahmad F, Nemati M. Isolation and screening of antibacterial activity of Actinomycetota from the medicinal plant, anthemis pseudocotula boiss. Arch Razi Inst. 2023;78(5):1638-46. [PubMed ID: 38590676]. [PubMed Central ID: PMC10998938]. https://doi.org/10.22092/ARI.2023.78.5.1638.
  • 22.
    Vijayakumar S, Biswas I, Veeraraghavan B. Accurate identification of clinically important Acinetobacter spp.: An update. Future Sci OA. 2019;5(6):FSO395. [PubMed ID: 31285840]. [PubMed Central ID: PMC6609899]. https://doi.org/10.2144/fsoa-2018-0127.
  • 23.
    Sathyanesan LK, Jose R, Valsan C, Joy LM. Genotypic characterisation of carbapenemases in clinical isolates of Acinetobacter baumannii in a tertiary care teaching hospital of Kerala. J Med Bacteriol. 2024;12(3). https://doi.org/10.18502/jmb.v12i3.16608.
  • 24.
    Pitout JDD, Peirano G, Kock MM, Strydom KA, Matsumura Y. The global ascendency of OXA-48-type carbapenemases. Clin Microbiol Rev. 2019;33(1). [PubMed ID: 31722889]. [PubMed Central ID: PMC6860007]. https://doi.org/10.1128/CMR.00102-19.
  • 25.
    Shirmohammadlou N, Zeighami H, Haghi F, Kashefieh M. Resistance pattern and distribution of carbapenemase and antiseptic resistance genes among multidrug-resistant Acinetobacter baumannii isolated from intensive care unit patients. J Med Microbiol. 2018;67(10):1467-73. [PubMed ID: 30175954]. https://doi.org/10.1099/jmm.0.000826.
  • 26.
    Mohanna ZA, Al-Yasseen AK. Distribution of carbapenemase genes among carbapenem-resistant Klebsiella pneumoniae isolates from the patients in Najaf, Iraq. Biomed Biotechnol Res J. 2024;8(3):297-304. https://doi.org/10.4103/bbrj.bbrj_212_24.
  • 27.
    Yungyuen T, Chatsuwan T, Plongla R, Kanthawong S, Yordpratum U, Voravuthikunchai SP, et al. Nationwide surveillance and molecular characterization of critically drug-resistant gram-negative bacteria: results of the research university network Thailand study. Antimicrob Agents Chemother. 2021;65(9). e0067521. [PubMed ID: 34181474]. [PubMed Central ID: PMC8370234]. https://doi.org/10.1128/AAC.00675-21.
  • 28.
    Garg A, Garg J, Kumar S, Bhattacharya A, Agarwal S, Upadhyay GC. Molecular epidemiology & therapeutic options of carbapenem-resistant Gram-negative bacteria. Indian J Med Res. 2019;149(2):285-9. [PubMed ID: 31219096]. [PubMed Central ID: PMC6563745]. https://doi.org/10.4103/ijmr.IJMR_36_18.
  • 29.
    Ramadan RA, Bedawy AM, Negm EM, Hassan TH, Ibrahim DA, ElSheikh SM, et al. Carbapenem-resistant Klebsiella pneumoniae among patients with ventilator-associated Pneumonia: Evaluation of antibiotic combinations and susceptibility to new antibiotics. Infect Drug Resist. 2022;15:3537-48. [PubMed ID: 35833009]. [PubMed Central ID: PMC9271681]. https://doi.org/10.2147/IDR.S371248.
  • 30.
    Zafer MM, Bassiouny DM, Ghosh S, Bornman C, Hussein AFA. Antimicrobial resistance patterns among critical priority pathogens in an intensive care unit at a tertiary hospital in Egypt: A descriptive analysis comparing pre- and COVID-19 eras. J Med Microbiol. 2024;73(6). [PubMed ID: 38916589]. https://doi.org/10.1099/jmm.0.001838.
  • 31.
    Ifedinezi OV, Nnaji ND, Anumudu CK, Ekwueme CT, Uhegwu CC, Ihenetu FC, et al. Environmental antimicrobial resistance: Implications for food safety and public health. Antibiotics (Basel). 2024;13(11). [PubMed ID: 39596781]. [PubMed Central ID: PMC11591122]. https://doi.org/10.3390/antibiotics13111087.
  • 32.
    Tilahun M, Kassa Y, Gedefie A, Ashagire M. Emerging carbapenem-resistant enterobacteriaceae infection, its epidemiology and novel treatment options: A review. Infect Drug Resist. 2021;14:4363-74. [PubMed ID: 34707380]. [PubMed Central ID: PMC8544126]. https://doi.org/10.2147/IDR.S337611.
  • 33.
    Spellberg B, Srinivasan A, Chambers HF. New societal approaches to empowering antibiotic stewardship. JAMA. 2016;315(12):1229-30. [PubMed ID: 26914942]. [PubMed Central ID: PMC5611826]. https://doi.org/10.1001/jama.2016.1346.
  • 34.
    Tozluyur A. Fosfomycin in the treatment of New Delhi Metallo-β-Lactamase-5 (blaNDM-5)-producing Escherichia coli infection. German J Microbiol. 2024;4(1):1-5. https://doi.org/10.51585/gjm.2024.1.0028.
  • 35.
    Zhang S, Di L, Qi Y, Qian X, Wang S. Treatment of infections caused by carbapenem-resistant Acinetobacter baumannii. Front Cell Infect Microbiol. 2024;14:1395260. [PubMed ID: 39081869]. [PubMed Central ID: PMC11287075]. https://doi.org/10.3389/fcimb.2024.1395260.
  • 36.
    Nirwati H, Hakim MS, Darma S, Mustafa M, Nuryastuti T. Detection of bla(oxa) genes and identification of biofilm-producing capacity of Acinetobacter baumannii in a tertiary teaching hospital, Klaten, Indonesia. Med J Malaysia. 2018;73(5):291-6. [PubMed ID: 30350807].
  • 37.
    Koo SH, Kwon KC, Cho HH, Sung JY. Genetic basis of multidrug-resistant Acinetobacter baumannii clinical isolates from three university hospitals in Chungcheong province, Korea. Korean J Lab Med. 2010;30(5):498-506. [PubMed ID: 20890082]. https://doi.org/10.3343/kjlm.2010.30.5.498.
  • 38.
    Woon JJ, Ahmad Kamar A, Teh CSJ, Idris N, Zhazali R, Saaibon S, et al. Molecular epidemiological investigation and management of outbreak caused by carbapenem-resistant Acinetobacter baumannii in a neonatal intensive care unit. Microorganisms. 2023;11(4). [PubMed ID: 37110495]. [PubMed Central ID: PMC10146162]. https://doi.org/10.3390/microorganisms11041073.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles