Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Molecular Detection and Prevalence of Mycoplasma hominis and M. genitalium Among Fertile and Infertile Individuals in Southern Iran

Author(s):
Neda FazeliNeda FazeliNeda Fazeli ORCID1, Babak KheirkhahBabak KheirkhahBabak Kheirkhah ORCID2,*, Nadia KazemipourNadia KazemipourNadia Kazemipour ORCID1
1Department of Microbiology, Ke.C., Islamic Azad University, Kerman, Iran
2Department of Microbiology, Baf.C., Islamic Azad University, Baft, Iran

Jundishapur Journal of Microbiology:Vol. 19, issue 3; e167346
Published online:Feb 24, 2026
Article type:Research Article
Received:Oct 18, 2025
Accepted:Feb 03, 2026
How to Cite:Fazeli N, Kheirkhah B, Kazemipour N. Molecular Detection and Prevalence of Mycoplasma hominis and M. genitalium Among Fertile and Infertile Individuals in Southern Iran. Jundishapur J Microbiol. 2026;19(3):e167346. doi: https://doi.org/10.5812/jjm-167346

Abstract

Background:

Mycoplasma hominis and M. genitalium have been associated with reproductive health issues and may contribute to infertility, although causal links remain unclear. Data on their prevalence and antimicrobial susceptibility in southern Iran are limited.

Objectives:

To assess the molecular prevalence, species distribution, and antimicrobial susceptibility of M. hominis and M. genitalium among fertile and infertile individuals in Bandar Abbas, Hormozgan province, southern Iran.

Methods:

In this cross-sectional study conducted in 2024, 200 participants (100 infertile and 100 fertile) provided clinical samples — 100 semen samples from men and 100 endocervical swabs from women. Fertility status was clinically confirmed for all participants. Samples were enriched in pleuropneumonia-like organism (PPLO) broth, analyzed by polymerase chain reaction (PCR) targeting the 16S rRNA gene for genus-level detection, followed by multiplex PCR for species identification. Minimum inhibitory concentrations (MIC) for azithromycin, erythromycin, and moxifloxacin were determined using the 96-well microdilution method. Data were analyzed using SPSS v29, with P < 0.05 considered statistically significant.

Results:

Among 200 samples, 41 (20.5%) were positive for Mycoplasma: 22 men (20 infertile, 2 fertile) and 19 women (16 infertile, 3 fertile). Multiplex PCR identified 26 isolates as M. genitalium (12 infertile men, 2 fertile men; 10 infertile women, 2 fertile women) and 15 isolates as M. hominis (8 infertile men, 0 fertile men; 6 infertile women, 1 fertile woman). Although minor differences were observed between sexes (22% of men vs 19% of women), these were not statistically significant (P > 0.05). Macrolide resistance was detected in 6 M. genitalium and 4 M. hominis isolates, while moxifloxacin resistance was rare, found in only one M. genitalium isolate.

Conclusions:

Mycoplasma hominis and M. genitalium are present in both fertile and infertile individuals in southern Iran, with higher macrolide resistance in M. genitalium. While these organisms may influence reproductive health, causal associations cannot be confirmed. Routine molecular detection and species-specific antimicrobial testing are recommended, and larger longitudinal studies are needed to clarify their potential role in infertility.

1. Background

Infertility, defined by the World Health Organization (WHO) as the inability to achieve pregnancy after 12 months of regular, unprotected intercourse, is a major global public health concern with significant psychological, social, and economic implications (1). More than 22 million women worldwide — many within reproductive age — are affected annually (2). The burden is particularly high in low- and middle-income countries, where strong cultural expectations surrounding childbearing may lead to stigma, isolation, and economic hardship (3). Although infertility has multifactorial and sometimes idiopathic causes, infectious agents of the urogenital tract are increasingly recognized as important contributors (4). Among these, Mycoplasma hominis and M. genitalium are notable opportunistic pathogens capable of both asymptomatic colonization and persistent infections affecting reproductive health. In women, they may cause ascending infections leading to pelvic inflammatory disease, tubal obstruction, and infertility (5). In men, these organisms have been associated with epididymitis, prostatitis, reduced sperm motility, and sperm DNA fragmentation (6).
Mycoplasmas lack a cell wall, rendering them intrinsically resistant to β-lactam antibiotics. Treatment therefore depends on macrolides, tetracyclines, and fluoroquinolones (7). However, rising global antimicrobial resistance — particularly macrolide resistance in M. genitalium and emerging fluoroquinolone resistance — poses challenges for effective treatment and may contribute to persistent infection-related infertility (8, 9). Molecular diagnostic methods, especially polymerase chain reaction (PCR), offer rapid and sensitive detection compared with traditional culture techniques (10, 11). Despite their clinical importance, epidemiological information from southern Iran remains limited, and existing studies have not fully characterized the burden of these infections in both men and women or examined antimicrobial resistance patterns.

2. Objectives

This study aims to address key knowledge gaps by simultaneously evaluating the prevalence of M. hominis and M. genitalium among fertile and infertile men and women in Bandar Abbas, Hormozgan province, using molecular diagnostic methods. In addition, the study investigates antimicrobial resistance to erythromycin and azithromycin (macrolides) and moxifloxacin (a fluoroquinolone) using minimum inhibitory concentration (MIC) determination by the 96-well microbroth dilution method. By integrating molecular detection with standardized antimicrobial susceptibility testing and including both sexes with fertile comparison groups, this research represents the first comprehensive regional investigation of these organisms and their antimicrobial resistance profiles in southern Iran.

3. Methods

3.1. Study Design and Participants

This cross-sectional descriptive study was conducted in the first half of 2024 at the Ome Leila Infertility Center, Bandar Abbas, Hormozgan province, Iran. A total of 200 participants were enrolled, including 100 infertile individuals and 100 fertile individuals as controls. Fertility status was confirmed by a gynecologist for female participants and by an andrologist for male participants. The mean age of participants in both groups was 31.4 years, ranging from 20 to 40 years.

3.2. Inclusion and Exclusion Criteria

The inclusion criteria for all participants were no antibiotic use in the previous month and abstinence from sexual activity for 4 - 5 days prior to semen sample collection. Participants who did not meet these criteria were excluded from the study (7).

3.3. Data Collection

Demographic and clinical information — including age, place of residence, type of infertility (primary or secondary), and smoking and alcohol consumption — was collected using a structured questionnaire. The final sample size of 200 participants was chosen based on the expected prevalence of genital Mycoplasma infections reported in prior studies. Using these prevalence estimates and a 95% confidence level, the required sample size was reviewed and confirmed in consultation with a statistician. This number was also feasible given the study duration and the applied inclusion/exclusion criteria.

3.4. Sample Collection and Laboratory Procedures

Endocervical swabs were obtained using sterile Dacron swabs and immediately placed into 5 mL of pleuropneumonia-like organism (PPLO) broth under aseptic conditions for transport and subsequent processing. To prevent interference with microbial growth, only Dacron or polyester swabs with aluminum or plastic shafts were used. Semen specimens were collected by masturbation after 4 - 5 days of sexual abstinence and delivered to the laboratory within 30 minutes in sterile, screw-capped containers (4). Semen quality was assessed according to WHO guidelines, including volume, pH, motility, concentration, and morphology. All handling, transport, and disposal procedures followed institutional biosafety standards and ethical regulations.

3.5. Enrichment and Selective Isolation of Mycoplasma Species

For the enrichment of M. hominis and M. genitalium, PPLO broth was prepared with 10% arginine, 10% glucose, and 5% horse serum. Penicillin G (1000 IU/mL) and polymyxin B (500 IU/mL) were included to suppress non-target microbial growth, and the pH was adjusted to 7.0. Media were stored at 4°C until use (12). Upon arrival, 1 mL of each semen and endocervical sample was inoculated individually into the enrichment medium. Cultures were incubated at 37°C with 5 - 10% CO₂ for 24 hours, then filtered through 0.45 µm PVDF syringe filters into fresh PPLO broth containing 20% horse serum and 0.02% phenol red. The incubation continued for 3–5 days, during which bacterial growth was monitored daily. Color changes were used as indicators: yellow for M. genitalium (glucose fermentation) and purple for M. hominis (arginine hydrolysis). Biochemical assays were also performed to confirm species identity (7). It should be noted that this enrichment process was intended to improve the sensitivity of subsequent molecular detection rather than for quantitative or semi-quantitative culture. All enriched cultures were then subjected to PCR analysis for genus- and species-specific identification of M. hominis and M. genitalium, ensuring reliable DNA amplification and accurate detection.

3.6. DNA Extraction

Genomic DNA was isolated from all 200 clinical samples using the High Pure PCR Template Preparation Kit (Beh Gene, Iran; Cat. No. BP101R010/050/100) following the manufacturer’s instructions (3). DNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). Extracted DNA samples were stored at -20°C until further PCR analysis.

3.7. Polymerase Chain Reaction-Based Detection and Multiplex Differentiation of Mycoplasma Species

Conventional PCR targeting a conserved region of the 16S rRNA gene was performed on all DNA samples to detect the Mycoplasma genus. This approach enhances sensitivity and minimizes false-negative results, particularly in specimens with low bacterial load that may not produce visible growth during enrichment. Subsequently, multiplex PCR was carried out to simultaneously identify M. hominis and M. genitalium using species-specific primers (Table 1). Primer sequences were validated for specificity using NCBI BLAST. Conventional PCR reactions (20 µL) included 10 µL of 2X Master Mix (SinaClon, Iran), 1 µL of each primer (10 pmol/µL), 5 µL of DNA template (50 ng), and 3 µL of nuclease-free water. Thermal cycling conditions are presented in Table 2.
Table 1.Nucleotide Sequences, Used Primers, and Their Lengths
Gene/TargetPrimer SequenceLength (Base Pair)
Mycoplasma genus (13)272
16s rRNA
F5’ TGGGGAGCAAACAGGATTAGATACC3’
R5’ TGCACCATCTGTCACTCTGTTAACCT3’
M. hominis (14)604
16s rRNA
F5’ACCCATTGGAAACAATGGCTAATGCCGGATACG3’
R5’ATAGACCCAGTAAGCTGCCTTCGCCT3’
M. genitalium (15)927
16s rRNA
F5’GCAGTGAAGAACGAGGGG3’
R5’GTCCTCGCTTCGGTCCTCTCG3’
Table 2.Thermal Cycling Conditions and Time Parameters for Polymerase Chain Reaction Amplification
StageInitial DenaturationDenaturation aAnnealing aExtension aFinal Extension
Temperature (°C)949459.37272
Time2 min15 s15 s15 s5 min

a Cycle = 35.

Multiplex PCR reactions (20 µL) consisted of 10 µL of 2X Master Mix (CinnaGene, Iran), 1 µL of each primer, 2 µL DNA template (50 ng), and 4 µL nuclease-free water. Thermal cycling parameters are shown in Table 3. Reference strains M. hominis PG21 (ATCC 23114) (16) and M. genitalium G37 (ATCC 33530) (17) were included as positive controls, while nuclease-free water served as the negative control. Polymerase chain reaction products were separated on 1.5% agarose gels, stained with CyberSafe DNA stain, and visualized under UV light. A DNA ladder (100 - 3000 bp; GeneRuler, Fermentas) was used as a size reference. Expected amplicon sizes were 272 bp for the Mycoplasma genus, 604 bp for M. hominis, and 927 bp for M. genitalium. Samples lacking these bands were recorded as negative.
Table 3.Thermal Cycling Conditions and Time Parameters for polymerase chain reaction Amplification
StageInitial DenaturationDenaturation aAnnealing aExtension aFinal Extension
Temperature (°C)9494577272
Time2 min15 s15 s15 s5 min

a Cycle = 35.

3.8. Antimicrobial Susceptibility Testing

The MICs of erythromycin and azithromycin (macrolides) and moxifloxacin (fluoroquinolone) were determined using the standard 96-well broth microdilution method. PPLO broth supplemented with horse serum and either L-arginine (for M. hominis) or D-glucose (for M. genitalium), and containing phenol red as a pH indicator, was used as the growth medium. Briefly, 25 µL of PPLO broth was dispensed into wells 1 - 9, 10, and 12 of each microtiter plate row. Next, 25 µL of antibiotic stock solution (512 mg/L) was added to wells 1 and 11. Serial twofold dilutions were performed across wells 1 - 9, resulting in final antibiotic concentrations ranging from 0.25 to 64 mg/L in a total volume of 200 µL per well.
Subsequently, 175 µL of standardized inoculum (10⁴ CFU/mL) from each Mycoplasma-positive isolate was added to wells 1 - 9 and 12. Well 10 served as the medium control, well 11 as the antibiotic control, and well 12 as the growth control. Each assay was performed in duplicate to ensure reproducibility and to minimize pipetting- or contamination-related errors. Plates were incubated at 37°C and visually examined daily for 18 - 72 hours. Growth was indicated by a color change due to the metabolic degradation of glucose (yellow for M. genitalium) or arginine (purple for M. hominis) in the presence of phenol red. The MIC was defined as the lowest antibiotic concentration showing no color change at the time when the growth control (well 12) exhibited its first detectable color shift. Quality control was performed using M. hominis PG21 (ATCC 23114) and M. genitalium G37 (ATCC 33530). Interpretation of susceptibility and resistance followed CLSI breakpoints (mg/L): erythromycin (S ≤ 1, R ≥ 4), azithromycin (S ≤ 0.125, R ≥ 4), and moxifloxacin (S ≤ 0.25, R ≥ 0.5) (18).

3.9. Statistical Analysis

All statistical analyses were performed using SPSS software (version 29). Demographic and clinical variables were summarized using frequencies and percentages (%). Parametric tests were applied to variables with a normal distribution, while non-parametric tests were employed for variables that did not meet normality assumptions or for categorical data. A two-tailed P-value of < 0.05 was considered statistically significant.

4. Results

A total of 200 clinical samples, including 100 infertile and 100 fertile participants, were analyzed. All samples underwent PCR-based detection to identify the Mycoplasma genus and to differentiate M. hominis and M. genitalium. Positive isolates were further assessed for antimicrobial susceptibility to erythromycin, azithromycin, and moxifloxacin using the standard MIC method. The following sections present the prevalence, species distribution, and relevant statistical analyses.

4.1. Polymerase Chain Reaction-Based Detection and Multiplex Differentiation

Conventional PCR targeting the 16S rRNA gene was performed on all 200 clinical samples, confirming the presence of the Mycoplasma genus in 41 samples (20.5%) (representative results shown in Figure 1). This included 22 males (20 infertile, 2 fertile controls) and 19 females (16 infertile, 3 fertile controls). Multiplex PCR enabled species-level differentiation of M. hominis (604 bp) and M. genitalium (927 bp) (representative results shown in Figure 2). Among the positive samples, 15 isolates were M. hominis (8 males: 8 infertile, 0 controls; 7 females: 6 infertile, 1 control), and 26 isolates were M. genitalium (14 males: 12 infertile, 2 controls; 12 females: 10 infertile, 2 controls). Biochemical assays and enrichment were performed as confirmatory controls; however, their quantitative results are not included in this analysis.
Amplification of a fragment of the 16S rRNA gene for the detection of the <i>Mycoplasma</i> genus. Lanes, from left to right: 100 bp DNA ladder (Fermentas), positive control (<i>Mycoplasma</i> genus DNA), negative control (no template), and clinical samples numbered 1 - 12.
Figure 1.

Amplification of a fragment of the 16S rRNA gene for the detection of the Mycoplasma genus. Lanes, from left to right: 100 bp DNA ladder (Fermentas), positive control (Mycoplasma genus DNA), negative control (no template), and clinical samples numbered 1 - 12.

Multiplex polymerase chain reaction (PCR) for the species-specific detection of <i>Mycoplasma hominis</i> (604 bp) and <i>M. genitalium</i> (927 bp). Lanes, from left to right: 100 bp DNA ladder (Fermentas), positive control (<i>M. hominis</i> ATCC 23114), positive control (<i>M. genitalium</i> ATCC 33530), negative control (no template), and clinical samples numbered 1 - 12.
Figure 2.

Multiplex polymerase chain reaction (PCR) for the species-specific detection of Mycoplasma hominis (604 bp) and M. genitalium (927 bp). Lanes, from left to right: 100 bp DNA ladder (Fermentas), positive control (M. hominis ATCC 23114), positive control (M. genitalium ATCC 33530), negative control (no template), and clinical samples numbered 1 - 12.

4.2. Antimicrobial Susceptibility Testing

Minimum inhibitory concentrations testing was performed on all 41 PCR-confirmed Mycoplasma-positive isolates using the standard 96-well broth microdilution method (19). Minimum inhibitory concentrations values were determined for erythromycin and azithromycin (macrolides) and moxifloxacin (fluoroquinolone). All tests were performed in duplicate to ensure reproducibility. Among M. genitalium isolates (n = 26), 6 strains showed resistance to macrolides, and only 1 strain was resistant to moxifloxacin. For M. hominis isolates (n = 15), 4 strains were resistant to macrolides, with no resistance observed to moxifloxacin. Thus, resistance to macrolides was more frequent in M. genitalium than in M. hominis, whereas resistance to moxifloxacin was rare, being detected in only a single M. genitalium isolate and absent in M. hominis. MIC results are presented in Table 4.
Table 4.Minimum Inhibitory Concentrations Values (µg/mL) for Mycoplasma genitalium and Mycoplasma hominis Isolates Against Azithromycin, Erythromycin, and Moxifloxacin a
Interpretation (R/S)Moxifloxacin (µg/mL) bAzithromycin (µg/mL)Erythromycin (µg/mL)
M. genitalium
Azithromycin and erythromycin: R, moxifloxacin: S0.251632
Azithromycin and erythromycin: R, moxifloxacin: S0.25816
Azithromycin and erythromycin: S, moxifloxacin: S< 0.2548
Moxifloxacin: R, azithromycin and erythromycin: R0.51632
Azithromycin and erythromycin: S, moxifloxacin: S< 0.25816
Azithromycin and erythromycin: R, moxifloxacin: S0.253264
M. hominis
Erythromycin: R, others S< 0.25416
Azithromycin and erythromycin: R, moxifloxacin: S< 0.25816
Azithromycin and erythromycin: R, moxifloxacin: S0.251632
Azithromycin and erythromycin: S, moxifloxacin: S< 0.2548

Abbreviations: R, resistant; S, susceptible.

a MIC values reflect the lowest concentration that inhibited visible growth.

b “<” and “>” indicate results below or above the tested concentration range.

4.3. Statistical Analysis

Descriptive statistics showed that the median age of infertile men was 29 years (IQR: 5; range 20 - 42), while infertile women had a median age of 28 years (IQR: 7; range 21 - 42). Chi-square tests were used to evaluate associations between categorical variables. Men reported higher rates of smoking, alcohol, and tobacco use compared to women (P < 0.05). The overall prevalence of Mycoplasma infections was similar between genders: 22.0% of men and 19.0% of women tested positive (P = 0.599). Specifically, M. genitalium was detected in 15.0% of men versus 12.0% of women (P = 0.535), and M. hominis in 8.0% of men versus 7.0% of women (P = 0.788). These differences were not statistically significant, suggesting no meaningful biological disparity between sexes. Health status was comparable across genders: 49.0% of men and 51.0% of women were classified as infertile (P = 0.777) (Table 5). All statistical analyses were conducted using SPSS version 29. Parametric tests were applied for normally distributed variables, and non-parametric tests for non-normally distributed or qualitative variables. A P-value < 0.05 was considered statistically significant.
Table 5.Comparison of Mycoplasma Infection Prevalence and Health Status by Gender (N = 100) a
CharacteristicFemaleMaleP-Value
Mycoplasma19 (19.0)22 (22.0)0.599
M. genitalium12 (12.0)15 (15.0)0.535
M. hominis7 (7.0)8 (8.0)0.788
Fertility status49 (49.0)51 (51.0)0.777

a Values are expressed as No. (%).

5. Discussion

The present study provides a comprehensive molecular assessment of M. hominis and M. genitalium among both fertile and infertile men and women in southern Iran, representing the first regional investigation to integrate species-level differentiation with antimicrobial susceptibility profiling. The overall prevalence of Mycoplasma infections was 20.5%, with 15.0% of men and 12.0% of women testing positive for M. genitalium, and 8.0% of men and 7.0% of women positive for M. hominis (differences were not statistically significant, P > 0.05). These findings are largely consistent with several prior reports, suggesting that the prevalence rates observed in our cohort align with trends seen in similar populations. For instance, Tam Le et al. reported a low but detectable presence of M. genitalium among infertile men (0.79%) (4), while Doroftei et al. found M. hominis prevalence of approximately 5.7 - 28.46% among infertile women (20). Similarly, Heidari Pebdeni et al. reported associations between M. genitalium and semen quality, with prevalence values broadly comparable to our study (21). The concordance between our findings and these studies supports the validity of our molecular detection approach and suggests that the prevalence of these pathogens in the Middle Eastern population is within a comparable range to other international cohorts.
Despite these consistencies, several discrepancies with other studies remain. For example, Tjagur et al. reported a much lower prevalence of M. genitalium in infertile men (1.1%) (1), while Abdo et al. observed a high seroprevalence of M. hominis (49%) among women attending fertility clinics in Abu Dhabi (6). These differences likely reflect a combination of regional, demographic, and methodological factors. Geographic and population-specific characteristics including environmental conditions, sexual behaviors, access to healthcare, and local microbiota play a critical role in shaping infection prevalence. Methodological differences, such as the use of conventional culture, commercial kits, or PCR, can also significantly influence detection sensitivity, as highlighted by Ozturk et al., who reported variability in M. hominis detection across different diagnostic kits (19).
Antimicrobial susceptibility analysis showed that macrolide resistance was more common in M. genitalium (6/26, 23%) compared to M. hominis (4/15, 27%). Resistance to moxifloxacin was rare, detected in only a single M. genitalium isolate (3.8%). These findings align with recent reports by Yu et al. and Chua et al., indicating an increasing trend of macrolide resistance in M. genitalium (22, 23). The observed differences in resistance profiles highlight the importance of conducting species-specific antimicrobial testing to guide appropriate therapy and minimize the risk of treatment failure. Lifestyle and demographic factors may also contribute to prevalence differences. In our cohort, infertile men reported higher rates of smoking, alcohol, and tobacco use compared to women, but these differences were not statistically linked to Mycoplasma infection prevalence.
Our study’s cross-sectional design limits causal inference and the ability to evaluate temporal patterns of infection. Additionally, the relatively small sample size and the absence of screening for other sexually transmitted infections, such as Chlamydia trachomatis, Neisseria gonorrhoeae, and Trichomonas vaginalis, constrain the generalizability of our findings. Consequently, it is not possible to determine whether observed associations are independent of co-infections. Future longitudinal studies with larger cohorts, broader pathogen screening, and mechanistic analyses are warranted to clarify causal pathways and optimize treatment strategies.

5.1. Conclusions

This study provides updated molecular data on the presence of M. hominis and M. genitalium among fertile and infertile individuals in southern Iran, along with their susceptibility patterns to commonly used antibiotics. The findings underscore the value of sensitive molecular diagnostic methods for improving detection accuracy and supporting more informed clinical management. Given the cross-sectional design, relatively small sample size, and the lack of screening for other sexually transmitted infections, the interpretation of these results should be made with caution. Future research with larger cohorts, longitudinal follow-up, and more comprehensive evaluation of co-infections will help clarify the role of Mycoplasma species in reproductive health and the dynamics of infection.

Acknowledgments

Footnotes

References

  • 1.
    Tjagur S, Mandar R, Poolamets O, Pomm K, Punab M. Mycoplasma genitalium provokes seminal inflammation among infertile males. Int J Mol Sci. 2021;22(24). [PubMed ID: 34948264]. [PubMed Central ID: PMC8707260]. https://doi.org/10.3390/ijms222413467.
  • 2.
    Charity Ezeanya-Bakpa C, Regina Agbakoba N, Blanche Oguejiofor C, Bessie Enweani-Nwokelo I. Sequence analysis reveals asymptomatic infection with Mycoplasma hominis and Ureaplasma urealyticum possibly leads to infertility in females: A cross-sectional study. Int J Reprod Biomed. 2021;19(11):951-8. [PubMed ID: 34977452]. [PubMed Central ID: PMC8717075]. https://doi.org/10.18502/ijrm.v19i11.9910.
  • 3.
    Tsevat DG, Wiesenfeld HC, Parks C, Peipert JF. Sexually transmitted diseases and infertility. Am J Obstet Gynecol. 2017;216(1):1-9. [PubMed ID: 28007229]. [PubMed Central ID: PMC5193130]. https://doi.org/10.1016/j.ajog.2016.08.008.
  • 4.
    Tam Le M, Nguyen Nguyen D, Bach Nguyen H, Quynh Tram Ngo V, Quoc Huy Nguyen V. Ureaplasma urealyticum and Mycoplasma genitalium detection and sperm quality: A cross-sectional study in Vietnam. Int J Reprod Biomed. 2021;20(3):185-94. [PubMed ID: 35571499]. [PubMed Central ID: PMC9099368]. https://doi.org/10.18502/ijrm.v20i3.10710.
  • 5.
    Paira DA, Molina G, Tissera AD, Olivera C, Molina RI, Motrich RD. Results from a large cross-sectional study assessing Chlamydia trachomatis, Ureaplasma spp. and Mycoplasma hominis urogenital infections in patients with primary infertility. Sci Rep. 2021;11(1):13655. [PubMed ID: 34211075]. [PubMed Central ID: PMC8249471]. https://doi.org/10.1038/s41598-021-93318-1.
  • 6.
    Abdo NM, Aslam I, Irfan S, George JA, Alsuwaidi AR, Ahmed LA, et al. Seroepidemiology of Treponema pallidum, Mycoplasma hominis, and Ureaplasma urealyticum in fertility treatment-seeking patients in the Emirate of Abu Dhabi, United Arab Emirates. J Infect Public Health. 2024;17(1):163-71. [PubMed ID: 38039859]. https://doi.org/10.1016/j.jiph.2023.11.019.
  • 7.
    Nazarzadeh F, Ahmadi MH, Ansaripour S, Niakan M, Pouladi I. Detection and evaluation of macrolide resistance (erythromycin) in Mycoplasma hominis isolated from endocervical specimens of patients referring to Ibn Sina Infertility Treatment Centre, Tehran, Iran. Int J Fertil Steril. 2022;16(2):95-101. [PubMed ID: 35639656]. [PubMed Central ID: PMC9108290]. https://doi.org/10.22074/IJFS.2021.529020.1118.
  • 8.
    Ahmadi MH. Resistance to tetracyclines among clinical isolates of Mycoplasma hominis and Ureaplasma species: A systematic review and meta-analysis. J Antimicrob Chemother. 2021;76(4):865-75. [PubMed ID: 33367765]. https://doi.org/10.1093/jac/dkaa538.
  • 9.
    Moridi K, Ghazvini K, Hemmaty M, Hoseiniun H, Torkaman M, Fallah Mehrabadi MH. Prevalence determination of M. hominis and M. genitalium in the semen samples in the northeast of Iran using culture and multiplex polymerase chain reaction. Arch Razi Inst. 2021;76(1):41-9. [PubMed ID: 33818956]. [PubMed Central ID: PMC8410203]. https://doi.org/10.22092/ari.2019.125966.1338.
  • 10.
    Qing L, Song QX, Feng JL, Li HY, Liu G, Jiang HH. Prevalence of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium and Ureaplasma urealyticum infections using a novel isothermal simultaneous RNA amplification testing method in infertile males. Ann Clin Microbiol Antimicrob. 2017;16(1):45. [PubMed ID: 28646898]. [PubMed Central ID: PMC5482940]. https://doi.org/10.1186/s12941-017-0220-2.
  • 11.
    Pineiro L, Idigoras P, de la Caba I, Lopez-Olaizola M, Cilla G. Guided antibiotic therapy for Mycoplasma genitalium infections: Analysis of mutations associated with resistance to macrolides and fluoroquinolones. Enferm Infecc Microbiol Clin. 2019;37(6):394-7. [PubMed ID: 30396750]. https://doi.org/10.1016/j.eimc.2018.10.003.
  • 12.
    Moosavian M, Ghadiri A, Amirzadeh S, Rashno M, Afzali M, Ahmadi K. Investigating Chlamydia trachomatis and Genital Mycoplasma prevalence and apoptosis markers in infertile and fertile couples. Jundishapur J Microbiol. 2019;In Press(In Press). https://doi.org/10.5812/jjm.84954.
  • 13.
    Esmaeili H, Shakeri AP, Tajik P, Hamedi M. The frequency of bacterial pathogens of mastitis and their antibiotic susceptibility in Saanen and Alpine goats. Research Square. 2023;Preprint. https://doi.org/10.18502/jmb.v11i1-2.14371.
  • 14.
    Aguilera-Arreola MG, Gonzalez-Cardel AM, Tenorio AM, Curiel-Quesada E, Castro-Escarpulli G. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. BMC Res Notes. 2014;7:433. [PubMed ID: 24997675]. [PubMed Central ID: PMC4099392]. https://doi.org/10.1186/1756-0500-7-433.
  • 15.
    Matsuoka M, Narita M, Okazaki N, Ohya H, Yamazaki T, Ouchi K, et al. Characterization and molecular analysis of macrolide-resistant Mycoplasma pneumoniae clinical isolates obtained in Japan. Antimicrob Agents Chemother. 2004;48(12):4624-30. [PubMed ID: 15561835]. [PubMed Central ID: PMC529214]. https://doi.org/10.1128/AAC.48.12.4624-4630.2004.
  • 16.
    Molla Kazemiha V, Amanzadeh A, Memarnejadian A, Azari S, Shokrgozar MA, Mahdian R, et al. Sensitivity of biochemical test in comparison with other methods for the detection of mycoplasma contamination in human and animal cell lines stored in the National Cell Bank of Iran. Cytotechnology. 2014;66(5):861-73. [PubMed ID: 24493067]. [PubMed Central ID: PMC4158010]. https://doi.org/10.1007/s10616-013-9640-9.
  • 17.
    Mousavi A, Farhadifar F, Mirnejad R, Ramazanzadeh R. Detection of genital mycoplasmal infections among infertile females by multiplex PCR. Iran J Microbiol. 2014;6(6):398-403. [PubMed ID: 25926957]. [PubMed Central ID: PMC4411425].
  • 18.
    Boujemaa S, Mlik B, Mardassi H, Ben Abdelmoumen Mardassi B. Clonal spread of tetracycline resistance among Mycoplasma hominis clinical strains, Tunisia. Infect Drug Resist. 2020;13:2093-7. [PubMed ID: 32669861]. [PubMed Central ID: PMC7337446]. https://doi.org/10.2147/IDR.S249630.
  • 19.
    Ozturk S, Yildiz S, Dursun P, Yener Ilce B, Kaymaz O. Mycoplasma hominis profile in women: Culture, kit, molecular diagnosis, antimicrobial resistance, and treatment. Microb Pathog. 2019;135:103635. [PubMed ID: 31352064]. https://doi.org/10.1016/j.micpath.2019.103635.
  • 20.
    Doroftei B, Ilie OD, Armeanu T, Anton E, Scripcariu I, Maftei R. The prevalence of Ureaplasma urealyticum and Mycoplasma hominis infections in infertile patients in the northeast region of Romania. Medicina. 2021;57(3). [PubMed ID: 33652790]. [PubMed Central ID: PMC7996858]. https://doi.org/10.3390/medicina57030211.
  • 21.
    Heidari Pebdeni P, Saffari F, Reza Mirshekari T, Ashourzadeh S, Taheri Soodejani M, Ahmadrajabi R. Bacteriospermia and its association with seminal fluid parameters and infertility in infertile men, Kerman, Iran: A cross-sectional study. Int J Reprod Biomed. 2021;20(3):202-12. [PubMed ID: 35571500]. [PubMed Central ID: PMC9099366]. https://doi.org/10.18502/ijrm.v20i3.10712.
  • 22.
    Yu J, Zhou Y, Luo H, Su X, Gan T, Wang J, et al. Mycoplasma genitalium infection in the female reproductive system: Diseases and treatment. Front Microbiol. 2023;14:1098276. [PubMed ID: 36896431]. [PubMed Central ID: PMC9989269]. https://doi.org/10.3389/fmicb.2023.1098276.
  • 23.
    Chua TP, Danielewski J, Bodiyabadu K, Bradshaw CS, Machalek DA, Garland SM, et al. Impact of 16S rRNA single nucleotide polymorphisms on Mycoplasma genitalium organism load with doxycycline treatment. Antimicrob Agents Chemother. 2022;66(5). e0024322. [PubMed ID: 35420491]. [PubMed Central ID: PMC9112994]. https://doi.org/10.1128/aac.00243-22.

Similar Articles

11
Nov
2014

Isolation and Molecular Identification of Mycoplasma Hominis in Infertile Female and Male Reproductive System

Samaneh Jamalizadeh Bahaabadi,
Naeime Mohseni Moghadam,
Babak Kheirkhah,
Alireza Farsinejad,
Victoria Habibzadeh

Jamalizadeh Bahaabadi S, Mohseni Moghadam N, Kheirkhah B, Farsinejad A, Habibzadeh V. Isolation and Molecular Identification of Mycoplasma Hominis in Infertile Female and Male Reproductive System. Nephro-Urol Mon. 2014;6(6):e22390. doi: https://doi.org/10.5812/numonthly.22390

19
Dec
2009

Prevalence of Mycoplasma hominis and Ureaplasma urealyticum in infertile women and their husbands

Mohammad Niakan,
Marefat Gafari,
Fahim Abedi

Niakan M, Gafari M, Abedi F. Prevalence of Mycoplasma hominis and Ureaplasma urealyticum in infertile women and their husbands. J Kermanshah Univ Med Sci. 2009;13(3):e79595. doi:

21
Jun
2016

Prevalence of Mycoplasma hominis and Ureaplasma spp. in Routine Gynecological Care in Sao Paulo City, Brazil

Fernanda Milanezi,
Ariane Falconi,
Beatriz Schnabel,
Luana R. Ricardi,
Priscilla M. Monfredini,
Alline T. Ziliotto
,et al.

Milanezi F, Falconi A, Schnabel B, R. Ricardi L, M. Monfredini P, et al. Prevalence of Mycoplasma hominis and Ureaplasma spp. in Routine Gynecological Care in Sao Paulo City, Brazil. Arch Clin Infect Dis. 2016;11(3):e36668. doi: https://doi.org/10.5812/archcid.36668

10
Aug
2013

Frequency of Mycoplasma hominis and Ureaplasma urealyticum in Females With Urogenital Infections and Habitual Abortion History in Ahvaz, Iran; Using Multiplex PCR

Susan Maleki,
Hossein Motamedi,
Seyyed Mojtaba Moosavian,
Nahid Shahbaziyan

Maleki S, Motamedi H, Moosavian SM, Shahbaziyan N. Frequency of Mycoplasma hominis and Ureaplasma urealyticum in Females With Urogenital Infections and Habitual Abortion History in Ahvaz, Iran; Using Multiplex PCR. Jundishapur J Microbiol. 2013;6(6):e10088. doi: https://doi.org/10.5812/jjm.10088

13
Jan
2019
Investigating <i>Chlamydia trachomatis</i> and Genital <i>Mycoplasma</i> Prevalence and Apoptosis Markers in Infertile and Fertile Couples

Investigating Chlamydia trachomatis and Genital Mycoplasma Prevalence and Apoptosis Markers in Infertile and Fertile Couples

Mojtaba Moosavian,
Ataallah Ghadiri,
Sareh Amirzadeh,
Mohammad Rashno,
Maryam Afzali,
Khadijeh Ahmadi

Moosavian M, Ghadiri A, Amirzadeh S, Rashno M, Afzali M, et al. Investigating Chlamydia trachomatis and Genital Mycoplasma Prevalence and Apoptosis Markers in Infertile and Fertile Couples. Jundishapur J Microbiol. 2019;12(1):e84954. doi: https://doi.org/10.5812/jjm.84954


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles