www.biocote.com

Image Credit:www.biocote.com

Identification and Isolation of Insertion Sequences, in Carbapenem Resistant Clinical Isolates of Acinetobacter baumannii from Tehran Hospitals

Author(s):
Mina OwrangMina Owrang1, Fatemeh FallahFatemeh Fallah2, Shiva IraniShiva IraniShiva Irani ORCID1, Mohammad RahbarMohammad Rahbar3, Gita EslamiGita Eslami4,*
1Department of Biology, School of Basic Sciences, Science and Research Branch, Islamic Azad University, Tehran, IR Iran
2Pediatric Infection Research Center of S.B.M.U.M.C, Tehran, IR Iran
3Department of Microbiology, Reference Health Laboratories Research Centre, Ministry of Health and Medical Education, Tehran, IR Iran
4Microbiology Department, Medical school, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran

Jundishapur Journal of Microbiology:Vol. 11, issue 6; e58251
Published online:Nov 30, 2017
Article type:Research Article
Received:Jul 18, 2017
Accepted:Nov 18, 2017
How to Cite:Owrang M, Fallah F, Irani S, Rahbar M, Eslami G. Identification and Isolation of Insertion Sequences, in Carbapenem Resistant Clinical Isolates of Acinetobacter baumannii from Tehran Hospitals. Jundishapur J Microbiol. 2018;11(6):e58251. doi: https://doi.org/10.5812/jjm.58251

Abstract

Background:

Identification of antibiotic resistance Acinetobacter baumannii can help us control and prevent the infections and reduce the mortality rates caused by this microorganism.

Objectives:

This study aimes to identify the insertion elements that can play important roles in antibiotic resistance in A. baumannii.

Methods:

A total of 105 A. baumannii isolates from clinical samples were tested for their susceptibility to different antibiotics using disc diffusion test (DDT). Then, the isolates were evaluated for the presence of blaOXA genes along with IS elements by polymerase chain reaction (PCR).

Results:

PCR analysis showed that ISAba1 was present in all the isolates while 92.36% of the isolates were positive for ISAba2. All the strains of A. baumannii possessed a blaOXA-51-like gene but blaOXA-58-like gene was absent in all of them. About 64.76% of the isolates were positive for blaOXA-24-like gene and 98.09% were positive for blaOXA-23-like gene. All of the isolates were pandrug resistant A. baumannii and the lowest resistance rates were observed toward minocycline and amikacin (93.33% in both) and trimethoprim/sulfamethoxazole (92.38%).

Conclusions:

The high prevalence rates of ISAba1 and ISAba2 among A. baumannii isolates can explain the rapid dissemination of resistance genes. Thus, finding the accessory genes such as IS elements, which can affect antibiotic resistance, should be more considered.

1. Background

Acinetobacter baumannii is a non-fermentative Gram-negative coccobacillus that is associated with a variety of serious infections (1, 2). It is now proposed that A. baumannii is one of the most common microorganism that can cause infectious diseases in hospitals throughout the world (3). This opportunistic pathogen causes infections that cannot be treated well because of its ability to survive against most classes of antimicrobial drugs (3). This pathogen has many kinds of innate and acquired mechanisms for antibiotic resistance such as change of target site, over production of efflux pumps, low permeability of outer membrane, and inactivation of enzymes like β-lactamases (4).
Β-lactamases, which are grouped into four classes including A, B, C and D according to amino acid sequence identities, are enzymes that degrade β- lactam antibiotics (5). Β-lactam antibiotics, including penicillins, cephalosporins, and carbapenems, inhibit peptidoglycan transpeptidases. Group “D” or carbapenem-hydrolyzing class D β- lactamases (CHDLs) are known as oxacillinases because of their ability to hydrolyze oxacillin (6). These enzymes are classified into four main OXA subfamilies: OXA-23-like, OXA-24/40-like, OXA-58-like, and OXA-51-like that the latest one is chromosomally located in all A. baumannii strains. Thus, it is an important genetic marker in the identification of these bacteria (7, 8). OXA types have a weak hydrolysis property but they are usually associated with genetic elements such as insertion sequences to increase the expression of carbapenemases and also mobilize them (7, 9).
The most percentage of these insertion sequences is ISAba1, although the other IS elements like ISAba2, are associated with resistance, too. When the IS element is located at the upstream of a number of OXA-type β-lactamases genes, such as bla OXA-23-like genes, bla OXA-51-like genes, and bla OXA-58-like genes, it increases their expression to a level that confers resistance to carbapenem (5, 10, 11). Therefore, determining the prevalence of IS as well as the OAXs genes in A. baumannii in different hospitals and medical centers is very important.

2. Objectives

To our knowledge, there are no data regarding the dissemination of these OXAs genes along with IS family, especially ISAba2, in A. baumannii from different hospitals in Tehran, Iran. Since IS elements are transferable and they can be transferred and increase the characteristic of antibiotic resistance to other bacteria, in this study we aimed to evaluate the antimicrobial activity of 14 antibiotics against clinical isolates of A. baumannii collected from five hospitals in Tehran, Iran. Furthermore, the distribution of four subgroups of OXA carbapenemases genes as well as the presence of the insertion sequences ISAba1 and ISAba2 were considered in A. baumannii.

3. Methods

3.1. Bacterial Isolates

In this experimental study, a total of 105 clinical isolates of A. baumannii were collected from patients in five different hospitals in Tehran between 2014 and 2015. Phenotypic identification of the isolates as A. baumannii was performed by using biochemical tests like growth at 42°C, culture on selective media, negative oxidase test, lack of lactose fermentation, etc. The PCR amplification and sequencing of blaoxa-51-like genes were used as the final confirmation of A. baumannii species.

3.2. Antimicrobial Susceptibility Test

A panel of antimicrobial susceptibility testing of the isolates to 14 agents was determined by Kirby-Bauer disc diffusion method on Muller- Hinton agar (Merck, Germany) according to the current clinical and laboratory standard institute (CLSI) guidelines (2015). The following antimicrobials were used in the susceptibility testing: Amikacin (AMK: 30 µg); Ceftazidime (CAZ: 30 µg); Cefepime (FEP: 30 µg); Cefotaxime (CTX: 30 µg); Ceftriaxone (CRO: 30 µg); Ciprofloxacin (CIP: 5 µg); Gentamicin (GEN: 10 µg); Imipenem (IMP: 10 µg); Meropenem (MEM: 10 µg); Piperacillin (PIP : 100 µg); Piperacillin + Tazobactam (TZP: 100 + 10 µg); Tigecycline (TGC: 15 µg); Minocycline (MCN: 30 µg); Trimethoprim + Sulfamethoxazole (SXT: 1.25 + 23.75 µg). All of these antibiotics were purchased from ROSCO, DK.

3.3. DNA Extraction

Genomic DNA was extracted by standard DNA extraction kit (Bioneer, Korea) according to the manufacturer's instructions. A total of 5 μL of DNA extract was used for each reaction.

3.4. Molecular Detection of OXA Carbapenemases and IS Elements and Nucleotide Sequencing

All isolates were subjected to PCR for the detection of four main groups of OXA carbapenemases genes (bla OXA-51-like, bla OXA-23-like, bla OXA-58-like and bla OXA-24-like) as well as ISAba1 and ISAba2 elements. All primers used in this study were listed in Table 1. The PCR mixture contained 1 µL (0.5 µg concentration) of extracted DNA, 1 µL (0.8 µM concentration) each of forward and reverse primers, 9.5 µL of water, and 12.5 µL of Master Mix (Ampliqon, DK). Amplifications were performed on thermocycler (Eppendorf, Germany). The DNA thermal cycler device (Eppendorf, Germany) was programmed in the following amplification conditions: after initial activation at 94°C for 5 minutes, 30 cycles, each for 45 seconds at 94°C (denaturation), 53 - 55°C (annealing), and 45 seconds at 72°C (extension) were performed. In contrast to other genes, the annealing time for ISAba2 was 48°C. The final cycle was followed by 72°C for 7 minutes (Table 2). Amplified PCR products were analyzed by 1.5% agarose gel at 100 V for 50 minutes in 1X TBE containing Red safe (INTRON). The PCR purification kit (Ampliqon, DK) was used to purify PCR products. The DM 100 - 2300 base pair ladder was used in this study (SMOBIO). Photography on gel was performed with UV doc (uvitec). PCR products were purified by using PCR purification kit (Bioneer Co., Korea), sequencing was performed by Bioneer Company (Korea), and their results were sent to gene bank.
Table 1.PCR Primers to Detect Genes Encoding OXA Carbapenemase and IS Elements
PrimersNucleotide Sequences (5' to 3')Amplicon Size, bp
OXA 51FTAATGCTTTGATCGGCCTTG353
OXA 51RTGGATTGCACTTCATCTTGG
OXA23FGATCGGATTGGAGAACCAGA501
OXA23RATTTCTGACCGCATTTCCAT
OXA24FGGTTAGTTGGCCCCCTTAAA246
OXA24RAGTTGAGCGAAAAGGGGATT
OXA58FAAGTATTGGGGCTTGTGCTG599
OXA58RCCCCTCTGCGCTCTACATAC
ISAba1FGTGCTTTGCGCTCATCATGC435
ISAba1RCATGTAAACCAATGCTCACC
ISAba2FAATCCGAGATAGAGCGGTTC1100
ISAba2RTGACACATAACCTAGTGCAC
Table 2.The PCR Cycles Conditions to Amplify OXAs Genes and ISA Elements
StepsOXA-51OXA-23OXA-24OXA-58ISAba1ISAba2Repeats
Activation94°C/5min94°C/5min94°C/5min94°C/5min94°C/5min94°C/5min1 cycle
Denaturation94°C/45s94°C/45s94°C/45s94°C/45s94°C/45s94°C/45s30 cycles
Annealing54°C53°C54°C54°C55°C48°C
Extension72°C/45s72°C/45s72°C/45s72°C/45s72°C/45s72°C/45s
Final extension72°C/7min72°C/7min72°C/7min72°C/7min72°C/7min72°C/7min-

4. Results

In this study, we investigated 105 clinical isolates of A. baumannii from five hospitals in Tehran. Following the conventional identification methods, the antimicrobial susceptibility testing was performed. The results of susceptibility testing are presented in Table 3. High levels of resistance shown in this table are phenotypes often observed in A. baumannii. Indeed, 100% of the isolates were resistant to Cefotaxime and resistance rates to the other cephalosporins were also very high. Carbapenems like Imipenem and Meropenem had also high rates of resistance. The lowest range of resistance was related to trimethoprim/sulfamethoxazole.
Table 3.Antimicrobial Susceptibility Testing of A. baumannii Isolated from Hospitals in Tehrana
AntibioticsConcentrations, μgSensitiveResistant
Minocycline307 (6.66)98 (93.33)
Trimethoprim/Sulfamethoxazole1.25 + 23.758 (7.61)97 (92.38)
Piperacillin1002 (1.9)103 (98.09)
Ceftazidime304 (3.8)101 (96.19)
Cefotaxime300 (0)105 (100)
Gentamicin104 (3.8)101 (96.19)
Ciprofloxacin51 (0.95)104 (99.04)
Amikacin307 (6.66)98 (93.33)
Tigecycline152 (1.9)103 (98.09)
Imipenem105 (4.76)100 (95.23)
Cefepime301 (0.95)104 (99.04)
Ceftriaxone301 (0.95)104 (99.04)
Meropenem102 (1.9)103 (98.09)
Piperacillin/tazobactam100 + 104 (3.8)101 (96.19)

aValues are expressed as No. (%).

Distribution of OXA type genes and IS elements of A. baumannii isolated from hospitals in Tehran is shown in Table 4. All the isolates were positive for bla OXA-51-like genes that were confirmed to be A. baumannii and negative for carbapenemases belonging to OXA-58 family. Furthermore, 100% of the isolates had bla OXA-23-like genes that are one of the important resistance factors in this bacterium and 64.76% of the isolates had bla OXA-24-like genes. ISAba1 was found in all the analyzed strains of A. baumannii from the subjected isolates. ISAba2 was detected in 92.38% of the isolates. Furthermore, agarose gel electrophoresis of PCR products of all OXAs genes and IS elements is depicted in Figure 1. It is well elucidated that OXA 51 and ISAba1 are present in all samples, but we did not find OXA-58 in samples provided form the study hospitals. The presence of OXA- 23 and ISAba2 was confirmed in the most cases. The accession number for blaOXA-23 gene is KU310908.1.
Table 4.Distribution of OXA Type Genes and IS Elements of A. baumannii Isolated from Hospitals in Tehrana
GenesPercentage
TotalLoghmanMotahariTaleghaniMiladMofid
OXA 51105 (100)17 (100)33 (100)3 (100)48 (100)4 (100)
OXA23103 (98.09)17 (100)31 (93.93)3 (100)48 (100)4 (100)
OXA580 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
OXA2468 (64.76)17 (100)31 (93.93)3 (100)14 (11.53)3 (75)
ISAba1105 (100)17 (100)33 (100)3 (100)48 (100)4 (100)
ISAba297 (92.38)12 (70.58)32 (96.96)3 (100)46 (100)4 (100)

aValues are expressed as No. (%).

A: OXA23; B: OXA24; C: OXA51; D: <i>ISAba1</i>; E: <i>ISAba2</i>. Band 1 and 8: Ladder; Band 2: negative; Band 7: positive; Bands 3 - 6: PCR products of related genes.
Figure 1.

A: OXA23; B: OXA24; C: OXA51; D: ISAba1; E: ISAba2. Band 1 and 8: Ladder; Band 2: negative; Band 7: positive; Bands 3 - 6: PCR products of related genes.

5. Discussion

Acinetobacter baumannii has emerged as one of the most troublesome pathogens for health care institutions globally (12). The ability of this microorganism to survive in both dry and wet conditions and their affinity to plastic and metal materials have lead to failure in hygiene prophylaxis. Changes in growth conditions may affect the transposition efficiency of several mobile elements and cause an increase in resistance by up-regulation or acquisition of different mechanisms and expression of resistance in plasmids and chromosomes particularly in presence of carbapenems (13). Carbapenems are the antibiotics of choice for treatment of infections caused by A. baumannii when these bacteria show resistance to other β-lactam antibiotics. However, resistance to carbapenems has increased and limited physicians in the choice of antibiotics. Generally, the carbapenem resistance is associated with the production of oxacillinase (OXA) enzymes. Nevertheless, metallo-β-lactamases can make resistance to carbapenems in A. baumannii (14, 15).
There are four main OXA subgroups associated with A. baumannii that their related genes are named: bla OXA-51-like, bla OXA -23- like, bla OXA -58- like and bla OXA -24 -like. The largest subgroup is OXA-51-like that corresponds to chromosome-encoded enzymes. With PCR performed in our study, all the 105 clinical isolates were positive for bla OXA-51-like gene. A survey by Visca et al. also demonstrated the possession of bla OXA-51-like gene among 117 strains of A. baumannii (16). Similar results were also obtained by previous studies (17-20). Our study confirmed that detection of bla OXA -51-like could be used as simple and reliable way to identify A. baumannii (18, 19, 21-23). The antimicrobial susceptibility profiles shown in Table 1 indicate that most of the 105 isolates showed high levels of resistance, a phenotype often observed in Acinetobacter.
All the isolates were resistant to Cefotaxime while resistance to other cephalosporins was also high. These results are in accordance with those of other studies (19, 20, 24, 25). Unfortunately, the resistance of A. baumannii was not only to β - lactams including penicillin, 3rd generation cephalosporin, and carbapenems, but also to other drug divisions, including aminoglycosides and fluoroquinolones (21). These high rates as shown in Table 1 were observed toward antibiotics such as Piperacillin, Piperacillin-tazobactam, Gentamicin, Minocycline, and Ciprofloxacin, too. In this study, the rates of resistance to imipenem and meropenem were 95.23% and 98.09%, respectively.
The results also showed that the prevalence rate of carbapenems and the frequency of multiple resistance Genes like OXAs are the causes of this problem. The blaOXA-23 carbapenemase gene has increasingly been reported worldwide (19). The OXA 23-β-lactamases were first identified in an A. baumannii isolate collected in Edinburg, United Kingdom. The resistance phenotype was transferable, indicating a plasmid location (10). OXA-23-like enzymes are able to hydrolyze oxyimino cephalosporins, aminopenicillins, piperacillin, oxacillin, and aztreonam in addition to the carbapenems (10). In this study, bla OXA-23-like gene was detected in 100% of the isolates, which is in accordance with other worldwide studies (17, 26-29).
Another gene encoding OXA-Type carbapenemase is bla OXA-24-like and its prevalence in isolates collected in the present study was 64.76%, most of which were found in isolates from one hospital. Distribution of bla OXA-24-like gene in Tehran was 15% in 2009 (30) and 17.3% in 2012 (31, 32). The last OXA-Type carbapenemase investigated in our study was bla OXA- 58- like gene. None of the one hundred and five clinical isolates in this study was positive for bla OXA- 58- like gene and these results are nearly similar to the findings of other studies in Iran obtained, for example, by Peerayeh et al. (30). The insertion sequences are frequently identified in association with an OXA β-lactamase gene (10). The most prevalent one of these insertion sequences is ISAba1. Insertion Sequence ISAba1, which has 11-bp inverted repeat sequences (IRs) flanked by 9-bp direct repeats of the target sequence, has been identified in A. baumannii. As one of the many IS elements, it contains promoters that play a role in the expression of antibiotic resistance genes (19).
In our study, all 105 clinical isolates were PCR positive for ISAba1 that is similar to previous studies (18). Turton and other authors have proposed that insertion of ISAba1 upstream of bla OXA- 51- like genes may provide the promoter to enhance gene expression potentially contributing to increased levels of resistance to carbapenems (17, 18). ISAba2 was the final genetic element we investigated. Similar to ISAba1, this element is likely to affect the expression of OXA carbapenemases. In the present study, the prevalence rate of ISAba2 was 92.38% (Table 3) and the high rate of this IS can explain the enhancement of promoters related to resistance genes.

6. Conclusions

In conclusion, it can be said that A. baumannii is an important pathogen in many countries. According to the results obtained in this study, it can be considered as red alarm microorganism in hospitals causing high rate of mortality and morbidity because it has multiple mechanisms for resistance and is not treated or treated hardly with common antibiotics. This microorganism especially in children and patients with immune deficiency can cause serious and longtime infections. Our study was done on some genetic elements that can have a major role in resistance to antimicrobial drugs especially the mobile elements that can be transferred within species to transform the antimicrobial pattern and cause an increase in resistance. Identification of these factors can help us control the infection and reduce the prevalence rate of this microorganism.

Acknowledgments

Footnotes

References

  • 1.
    Zhao SY, Jiang DY, Xu PC, Zhang YK, Shi HF, Cao HL, et al. An investigation of drug-resistant Acinetobacter baumannii infections in a comprehensive hospital of East China. Ann Clin Microbiol Antimicrob. 2015;14:7. [PubMed ID: 25643932]. https://doi.org/10.1186/s12941-015-0066-4.
  • 2.
    Reddy D, Morrow BM, Argent AC. Acinetobacter baumannii infections in a South African paediatric intensive care unit. J Trop Pediatr. 2015;61(3):182-7. [PubMed ID: 25833097]. https://doi.org/10.1093/tropej/fmv017.
  • 3.
    Biderman P, Bugaevsky Y, Ben-Zvi H, Bishara J, Goldberg E. Multidrug-resistant Acinetobacter baumannii infections in lung transplant patients in the cardiothoracic intensive care unit. Clin Transplant. 2015;29(9):756-62. [PubMed ID: 26065630]. https://doi.org/10.1111/ctr.12575.
  • 4.
    Poirel L, Nordmann P. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin Microbiol Infect. 2006;12(9):826-36. [PubMed ID: 16882287]. https://doi.org/10.1111/j.1469-0691.2006.01456.x.
  • 5.
    Opazo A, Dominguez M, Bello H, Amyes SG, Gonzalez-Rocha G. OXA-type carbapenemases in Acinetobacter baumannii in South America. J Infect Dev Ctries. 2012;6(4):311-6. [PubMed ID: 22505439].
  • 6.
    Kaitany KC, Klinger NV, June CM, Ramey ME, Bonomo RA, Powers RA, et al. Structures of the class D Carbapenemases OXA-23 and OXA-146: mechanistic basis of activity against carbapenems, extended-spectrum cephalosporins, and aztreonam. Antimicrob Agents Chemother. 2013;57(10):4848-55. [PubMed ID: 23877677]. https://doi.org/10.1128/AAC.00762-13.
  • 7.
    Post V, Hall RM. AbaR5, a large multiple-antibiotic resistance region found in Acinetobacter baumannii. Antimicrob Agents Chemother. 2009;53(6):2667-71. [PubMed ID: 19364869]. https://doi.org/10.1128/AAC.01407-08.
  • 8.
    Poirel L, Naas T, Nordmann P. Diversity, epidemiology, and genetics of class D beta-lactamases. Antimicrob Agents Chemother. 2010;54(1):24-38. [PubMed ID: 19721065]. https://doi.org/10.1128/AAC.01512-08.
  • 9.
    Shaikh F, Spence RP, Levi K, Ou HY, Deng Z, Towner KJ, et al. ATPase genes of diverse multidrug-resistant Acinetobacter baumannii isolates frequently harbour integrated DNA. J Antimicrob Chemother. 2009;63(2):260-4. [PubMed ID: 19022777]. https://doi.org/10.1093/jac/dkn481.
  • 10.
    Walther-Rasmussen J, Hoiby N. OXA-type carbapenemases. J Antimicrob Chemother. 2006;57(3):373-83. [PubMed ID: 16446375]. https://doi.org/10.1093/jac/dki482.
  • 11.
    Gao J, Zhao X, Bao Y, Ma R, Zhou Y, Li X, et al. Antibiotic resistance and OXA-type carbapenemases-encoding genes in airborne Acinetobacter baumannii isolated from burn wards. Burns. 2014;40(2):295-9. [PubMed ID: 23886986]. https://doi.org/10.1016/j.burns.2013.06.003.
  • 12.
    Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev. 2008;21(3):538-82. [PubMed ID: 18625687]. https://doi.org/10.1128/CMR.00058-07.
  • 13.
    Heritier C, Poirel L, Aubert D, Nordmann P. Genetic and functional analysis of the chromosome-encoded carbapenem-hydrolyzing oxacillinase OXA-40 of Acinetobacter baumannii. Antimicrob Agents Chemother. 2003;47(1):268-73. [PubMed ID: 12499201].
  • 14.
    Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2010;65(2):233-8. [PubMed ID: 19996144]. https://doi.org/10.1093/jac/dkp428.
  • 15.
    Kim DH, Choi JY, Kim HW, Kim SH, Chung DR, Peck KR, et al. Spread of carbapenem-resistant Acinetobacter baumannii global clone 2 in Asia and AbaR-type resistance islands. Antimicrob Agents Chemother. 2013;57(11):5239-46. [PubMed ID: 23939892]. https://doi.org/10.1128/AAC.00633-13.
  • 16.
    D'Arezzo S, Principe L, Capone A, Petrosillo N, Petrucca A, Visca P. Changing carbapenemase gene pattern in an epidemic multidrug-resistant Acinetobacter baumannii lineage causing multiple outbreaks in central Italy. J Antimicrob Chemother. 2011;66(1):54-61. [PubMed ID: 21088019]. https://doi.org/10.1093/jac/dkq407.
  • 17.
    Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol. 2006;44(8):2974-6. [PubMed ID: 16891520]. https://doi.org/10.1128/JCM.01021-06.
  • 18.
    Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett. 2006;258(1):72-7. [PubMed ID: 16630258]. https://doi.org/10.1111/j.1574-6968.2006.00195.x.
  • 19.
    Nowak P, Paluchowska P, Budak A. Distribution of blaOXA genes among carbapenem-resistant Acinetobacter baumannii nosocomial strains in Poland. New Microbiol. 2012;35(3):317-25. [PubMed ID: 22842601].
  • 20.
    Asadollahi P, Akbari M, Soroush S, Taherikalani M, Asadollahi K, Sayehmiri K, et al. Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patients. Burns. 2012;38(8):1198-203. [PubMed ID: 22579564]. https://doi.org/10.1016/j.burns.2012.04.008.
  • 21.
    Stoeva T, Higgins PG, Savov E, Markovska R, Mitov I, Seifert H. Nosocomial spread of OXA-23 and OXA-58 beta-lactamase-producing Acinetobacter baumannii in a Bulgarian hospital. J Antimicrob Chemother. 2009;63(3):618-20. [PubMed ID: 19147517]. https://doi.org/10.1093/jac/dkn537.
  • 22.
    Huang XZ, Cash DM, Chahine MA, Nikolich MP, Craft DW. Development and validation of a multiplex TaqMan real-time PCR for rapid detection of genes encoding four types of class D carbapenemase in Acinetobacter baumannii. J Med Microbiol. 2012;61(Pt 11):1532-7. [PubMed ID: 22878252]. https://doi.org/10.1099/jmm.0.045823-0.
  • 23.
    Huang XZ, Chahine MA, Frye JG, Cash DM, Lesho EP, Craft DW, et al. Molecular analysis of imipenem-resistant Acinetobacter baumannii isolated from US service members wounded in Iraq, 2003-2008. Epidemiol Infect. 2012;140(12):2302-7. [PubMed ID: 22273504]. https://doi.org/10.1017/S0950268811002871.
  • 24.
    Bahador A, Taheri M, Pourakbari B, Hashemizadeh Z, Rostami H, Mansoori N, et al. Emergence of rifampicin, tigecycline, and colistin-resistant Acinetobacter baumannii in Iran; spreading of MDR strains of novel International Clone variants. Microb Drug Resist. 2013;19(5):397-406. [PubMed ID: 23768166]. https://doi.org/10.1089/mdr.2012.0233.
  • 25.
    Lin L, Ling BD, Li XZ. Distribution of the multidrug efflux pump genes, adeABC, adeDE and adeIJK, and class 1 integron genes in multiple-antimicrobial-resistant clinical isolates of Acinetobacter baumannii-Acinetobacter calcoaceticus complex. Int J Antimicrob Agents. 2009;33(1):27-32. [PubMed ID: 18790612]. https://doi.org/10.1016/j.ijantimicag.2008.06.027.
  • 26.
    Gordon NC, Wareham DW. Multidrug-resistant Acinetobacter baumannii: mechanisms of virulence and resistance. Int J Antimicrob Agents. 2010;35(3):219-26. [PubMed ID: 20047818]. https://doi.org/10.1016/j.ijantimicag.2009.10.024.
  • 27.
    Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: report from the SENTRY Surveillance Program. J Antimicrob Chemother. 2009;63(1):55-9. [PubMed ID: 18957398]. https://doi.org/10.1093/jac/dkn434.
  • 28.
    Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis. 2010;16(1):35-40. [PubMed ID: 20031040]. https://doi.org/10.3201/eid1601.090852.
  • 29.
    Turton JF, Kaufmann ME, Glover J, Coelho JM, Warner M, Pike R, et al. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J Clin Microbiol. 2005;43(7):3074-82. [PubMed ID: 16000417]. https://doi.org/10.1128/JCM.43.7.3074-3082.2005.
  • 30.
    Peerayeh SN, Karmostaji A, Sarasiabi SS, Javadpour S, Davoodian P, Moradi N. In Vitro Activity of Tigecycline and Colistin against clinical isolates of Acinetobacter baumannii in Hospitals in Tehran and Bandar-Abbas, Iran. Electron Physician. 2014;6(3):919-24. [PubMed ID: 25763168]. https://doi.org/10.14661/2014.919-924.
  • 31.
    Zhang X, Gu B, Mei Y, Wen Y, Xia W. Increasing resistance rate to carbapenem among blood culture isolates of Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa in a university-affiliated hospital in China, 2004-2011. J Antibiot (Tokyo). 2015;68(2):115-20. [PubMed ID: 25182483]. https://doi.org/10.1038/ja.2014.119.
  • 32.
    Gur D, Korten V, Unal S, Deshpande LM, Castanheira M. Increasing carbapenem resistance due to the clonal dissemination of oxacillinase (OXA-23 and OXA-58)-producing Acinetobacter baumannii: report from the Turkish SENTRY Program sites. J Med Microbiol. 2008;57(Pt 12):1529-32. [PubMed ID: 19018025]. https://doi.org/10.1099/jmm.0.2008/002469-0.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles