Antigenicity Identification of a Novel Recombinant Multi-Epitope Antigen Based on FlaA and UreB Antigens of Helicobacter pylori

Authors

Zeinab Hamzehloo1, Ghasem MosayebiGhasem Mosayebi ORCID2, Behzad KhansarinejadBehzad  Khansarinejad ORCID2, Mina Zolfaghari2, Hamid AbtahiHamid Abtahi ORCID2,*
1Department of Biotechnology, School of Medicine, Arak University of Medical Sciences, Arak, Iran
2Molecular and Medical Research Center, Arak University of Medical Sciences, Arak, Iran
*Corresponding Author: Molecular and Medical Research Center, Arak University of Medical Sciences, Arak, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 12, issue 5; e66502
Published online:May 04, 2019
Article type:Research Article
Received:Jan 20, 2018
Accepted:Mar 14, 2019
How to Cite:Hamzehloo Z, Mosayebi G, Khansarinejad B, Zolfaghari M, Abtahi H. Antigenicity Identification of a Novel Recombinant Multi-Epitope Antigen Based on FlaA and UreB Antigens of Helicobacter pylori. Jundishapur J Microbiol. 2019;12(5):e66502. doi: https://doi.org/10.5812/jjm.66502

Abstract

Background:

Helicobacter pylori is the main cause of stomach ulcers and gastric cancer. Hence, the diagnosis, treatment, and prevention of H. pylori infection can considerably reduce the fatality.

Objectives:

This study aimed to construct a dual-antigen protein by combining the antigenic regions of UreB and FlaA of H. pylori and determine its antigenicity as a promising vaccine and serodiagnosis candidate.

Methods:

The antigenic regions of FlaA and UreB were detected by immunological bioinformatics, amplified and joined together by polymerase chain reaction (PCR) with special primers containing linker sequences. Then, it was cloned into pET-32a and after expression and purification of the recombinant multi-epitope protein (rFlaA-UreB), its antigenicity was evaluated by immunoblotting using the sera of infected patients.

Results:

DNA sequencing and enzyme digestion analysis showed the rFlaA-UreB gene was successfully inserted into pET32a. The recombinant protein was produced and purified via affinity chromatography and its molecular weight was similar to what had been predicted. Moreover, data indicated that rFlaA-UreB was recognized by all patients’ sera and its sensitivity and specificity were high.

Conclusions:

Although the developed recombinant multi-epitope protein was very smaller and lighter than the natural forms of these two critical antigens, they all had close antigenic properties. Therefore, this recombinant protein can be an important antigen in the diagnosis and vaccination against H. pylori.

Highlights

1. Background

Most people in the world have a history of infection with Helicobacter pylori, a Gram-negative, spiral-shaped, and microaerophilic bacillus that resides the human gastric and duodenal mucosa. Persistent, chronic infection with H. pylori induces stomach ulcers and gastric cancer (1-4). Helicobacter pylori is recognized as a class I human carcinogenic agent and one of the etiological agents in human gastric adenocarcinoma (5). Thus, it seems that prevention, early detection, and treatment of this infection can decrease morbidity and mortality rates in infected patients. Unfortunately, current treatment against H. pylori infection is associated with some drawbacks such as re-infection, increased antibiotic resistance, side effects, patient compliance, and high cost (6, 7). Therefore, vaccination against this bacterium could be a potential way to control the H. pylori infection.
Epitope-based vaccines are a new strategy for increasing immune response to pathogens. Some advantages of an epitope vaccine include (i) increased safety, (ii) increased immunogenicity of predefined epitopes, and (iii) ability to focus immune responses on conserved epitopes (8). However, research has proven that immunity created against H. pylori using a single antigen does not lead to effective protection, rather effective immunity against this infection is achieved via a combination of various antigens (9-11). Some commercial diagnostic kits used to detect H. pylori infection utilize a combination of antigens because this strategy provides high sensitivity and specificity compared to a single antigen (12-15).
Based on previous studies, UreB and FlaA are excellent candidates for the production of vaccines and diagnostic antigens. UreB (the B subunit of urease and one of the four subunits of this enzyme) elicits an immune response; it acts as a portion of whole urease to metabolize urea to ammonia and generate a neutral environment (16-20). FlaA (the predominant subunit of the flagella) is an important pathogenic factor responsible for H. pylori colonization and persistent infection (7, 21-23).

2. Objectives

In this study, we designed, constructed, cloned, and expressed a recombinant multi-epitope gene based on the combined immunodominant regions of UreB and FlaA (rFlaA-UreB) genes of H. pylori. Moreover, we detected its antigenicity as a vaccine candidate and diagnostic antigen by using infected human sera in western blot analysis.

3. Methods

3.1. Chromosomal DNA of H. pylori, Strains, Plasmids, and Media

Chromosomal DNA of H. pylori was purchased from Imam Khomeini Hospital (a teaching university hospital in Tehran, Iran). Escherichia coli strain DH5α (Stratagene, USA) was used for cloning. The recombinant protein was produced by pET32a plasmid (Novagene, USA). The FlaA-UreB recombinant protein was produced using pET32a in E. coli BL21 (DE3) pLysS.

3.2. Identification of Antigenic Regions

We used UreB (NC-018939.1) and FlaA (WP-000885496.1) gene sequences for epitope mapping. B-cell epitope prediction was performed using IEDB, ElliPro, DiscoTope, and IgPred (24).

3.3. Gene Replication

Specific primers required for polymerase chain reaction (PCR) were designed using Allele ID software. The FlaA gene of H. pylori was amplified by primers 5’CGGGATCCGGCGTGTTAGCAGAAGTGAT3’ (forward primer) and 5’CGCCGCCGCCAGGACATTGAGCTCTTAGCGTC3’ (reverse primer) with a linker sequence. The UreB gene was amplified by 5’CTGGCGGCGGCGGCTATGGGTCGTGTGGGT3’ (forward primer) and 5’CCGCTCGAGGAAAATGCTAAAGAGTTGCG3’ (reverse primer) with a linker sequence. The replication of the FlaA gene was done in a 25-µL volume, containing 1 µL of template, 10 pmol of each primer, 50 mM of MgCl2, 0.5 µL of dNTP, 2.5 µL of buffer (10×), and 1 unit of Taq polymerase. Proliferation of the FlaA gene was done under the following conditions: initial denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 20 seconds, annealing at 56°C for 20 seconds, extension at 72°C for 40 seconds, and a final extension at 72°C for 5 minutes.
The PCR of the UreB gene was performed in a total volume of 25 µL under the same PCR conditions as the FlaA PCR amplification (except for annealing at 62°C for 20 seconds) (25). Then, for making the conjugated gene as a template for last PCR amplification, we prepared a tube in a total volume of 25 µL, containing 1.5 µL of FlaA PCR product, 1.5 µL of UreB PCR product, 1.5 µL of MgCl2 (50 mM), 0.5 µL of dNTP, 2.5 µL of buffer (10×), and 0.5 µL of the Taq polymerase (neither of primers was used) and amplified by 20 cycles in the same PCR conditions as the FlaA and UreB PCR amplification (except for annealing at 55°C for 20 seconds). The final PCR was done in a 25-µL volume containing 2 µL of template (1 to 6 diluted previous PCR product in double distilled water), 0.5 µL of forward primer of FlaA, 0.5 µL of reverse primer of UreB (10 pmol), 1.5 µL of MgCl2 (50 mM), 0.5 µL of dNTP, 2.5 µL of buffer (10×), and 0.5 µL of the Taq polymerase. The final duplication was performed at an annealing temperature of 58°C.

3.4. Recombinant Plasmid Construction and Purification

The PCR product, rFlaA-UreB, was purified by the high-pure PCR product purification kit (Roche, Germany). Both pET32a and PCR product were digested with BamHI and XhoI and ligated by T4 DNA ligase (Cinagene, Iran). Moreover, E. coli BL21 (DE3) pLysS (Stratagene, USA) and E. coli DH5α (Stratagene, USA) component cells were prepared using calcium chloride (CaCl2) method (25) and transformed by plasmids. The pET32a-FlaA-UreB was transformed into E. coli BL21 (DE3) pLysS cells as the host for the expression of recombinant protein production (25). To confirm the transformation of pET32a-FlaA-UreB into E. coli BL21 (DE3) pLysS, the PCR and enzymatic digestion with BamHI and XhoI were performed. Finally, the nucleotide sequences of recombinant plasmid pET32a-FlaA-UreB were analyzed using the dideoxy chain termination method by standard primers, according to a procedure described by Sanger et al. (26).

3.5. Expression of Recombinant Dual Antigen Multi-Epitope Protein rFlaA-UreB

The pET32a-FlaA-UreB plasmids were transformed into E. coli BL21 (DE3) pLysS grown in 50 mL of nutrient broth supplemented with ampicillin (100 µ/mL) and chloramphenicol (35 µg/mL) at 37°C with vigorous agitation at 220 rpm. The cultured cells were grown until OD600 nm of 0.6. The production of rFlaA-UreB recombinant protein was induced by adding 50 µg of Isopropyl-β-D thiogalactopyranoside (IPTG) to the final concentration of 1 mM, followed by 4 hours of incubation. The recombinant protein was purified with Ni-NTA Agarose resin (Qiagen, USA) based on the manufacturer’s instruction. The purified recombinant protein was analyzed by SDS-PAGE (15%) and spectrophotometry (260/280 nm) (25).

3.6. Immunoblot Analysis

Immunoblot analysis was done (25) using the sera obtained from 15 seropositive H. pylori patients and 15 negative human sera detected by culture, urease test, and pathological analysis. For immunoblot analysis, 0.5 µg of the purified recombinant protein was used per well. Then, the recombinant protein was blotted on polyvinylidene difluoride (PVDF) membrane (Roche, Germany) using transfer buffer containing 25 mM of Tris (pH = 8.3), 192 mM of glycine, and 20% methanol at 90 V for 3 hours at 4°C. The blotted PVDF was blocked with 2.5% (w/v) BSA in TBS buffer for one hour at room temperature. Then, PVDF was incubated for 2 hours at room temperature with diluted (1:100) and normal patients sera. After reaction with the primary antibody, the blot was washed three times with Tris-buffered saline (TBS; 0.5 M of NaCl, 0.02 M of Tris, and 0.05% Tween-20, pH = 8.5) and incubated with anti-human IgG (Abcam, United Kingdom) in 1:1000 dilution. The blots were developed by diaminobenzidine (DAB) solution (Sigma, USA).

3.7. Statistical Analysis

Statistical analysis was performed using t test to evaluate differences in variables between the groups. Comparison between groups was made based on the Mann-Whitney U test. Data were analyzed by SPSS version 16.0 software.

4. Results

4.1. Detection of Antigenic Region

In this study, we predicted antigenic fragments of FlaA and UreB protein sequences through epitope mapping. We used IEDB software to predict the B-cell epitope. According to the results, amino acid sequences of 215 to 352 in FlaA (Figure 1) and 365 to 568 in UreB (Figure 2) were selected as regions with the most pronounced antigenic properties.
The result of <i>FlaA</i> antigenic fragment prediction
Figure 1.
The result of FlaA antigenic fragment prediction
The result of <i>UreB</i> antigenic fragment prediction
Figure 2.
The result of UreB antigenic fragment prediction

4.2. DNA Amplification, Multi-Epitope Gene Construction, and Molecular Characterization of rFlaA-UreB

The amplified genes had the expected size of 414 base pair (bp) in FlaA and 609 bp in UreB compared to a 100-bp DNA ladder (Figure 3). The rFlaA-UreB gene was constructed with 1035 bp compared to a 100-bp DNA ladder (Figure 4). The results of PCR and enzymatic digestion of the recombinant plasmid (pET32a-FlaA-UreB) with restriction enzymes confirmed the transformation and showed that the target gene was inserted into the vector correctly. Then, pET32a-FlaA-UreB was sequenced and the results were confirmed. Data showed that the target gene had 100% homology with the reported original sequences (data not shown).
<i>FlaA</i> and <i>UreB</i> genes from <i>Helicobacter pylori</i> amplified by PCR. Lane 1: negative control of <i>UreB</i>, lane 2: positive control of <i>UreB</i>, lane 3: <i>UreB</i> gene, lane 4: 100-bp DNA marker, lane 5: <i>FlaA</i> gene, lane 6: negative control.
Figure 3.
FlaA and UreB genes from Helicobacter pylori amplified by PCR. Lane 1: negative control of UreB, lane 2: positive control of UreB, lane 3: UreB gene, lane 4: 100-bp DNA marker, lane 5: FlaA gene, lane 6: negative control.
<i>rFlaA-UreB</i> recombinant multi-epitope gene construction and amplification by PCR. Lane 1: negative control of <i>rFlaA-UreB</i>, lane 2: 100-bp DNA marker, lane 3: <i>rFlaA-UreB</i> PCR product.
Figure 4.
rFlaA-UreB recombinant multi-epitope gene construction and amplification by PCR. Lane 1: negative control of rFlaA-UreB, lane 2: 100-bp DNA marker, lane 3: rFlaA-UreB PCR product.

4.3. Expression and Purification of Recombinant Protein

The molecular weight of the recombinant protein was estimated at 38.045 kDa. In the presence of 6xHis-tag in the N-terminal region of rFlaA-UreB added by the pET-32a vector, the protein molecular weight, purified using Ni-NTA resin affinity chromatography, was 57.62 kDa. The SDS-PAGE analysis of induced E. coli BL21 (DE3) pLysS showed a band similar to what that had been predicted with desired molecular weight (Figure 5).
Expression and purification of <i>rFlaA-UreB</i> protein. Lane 1: <i>Escherichia coli BL21 (DE3) pLysS</i> destruction pellet, lane 2: <i>pET-32a-FlaA-UreB</i> after 2-h induction, lane 3: protein marker, lane 4 - 7: purified <i>rFlaA-UreB</i> protein.
Figure 5.
Expression and purification of rFlaA-UreB protein. Lane 1: Escherichia coli BL21 (DE3) pLysS destruction pellet, lane 2: pET-32a-FlaA-UreB after 2-h induction, lane 3: protein marker, lane 4 - 7: purified rFlaA-UreB protein.

4.4. Immunoblotting Analysis

In this study, the antigenicity of the recombinant protein was determined by Western blotting via the sera of humans who suffered H. pylori infection. Our data showed the desired band with an estimated molecular weight of 57.62 kDa. In fact, the recombinant protein reacted with the patients’ sera whereas all 15 human normal sera used as negative controls failed to act similarly. Therefore, based on Western blot analysis results, the produced recombinant protein had an antigenicity enabling it to react with the sera of patients (Figure 6).
Western Blot analysis of <i>rFlaA-UreB</i> by using infected human sera. Lanes 1 - 4: Western Blotting by infected human sera, lane 5: protein marker, lane 6: Western Blotting by normal sera (negative control).
Figure 6.
Western Blot analysis of rFlaA-UreB by using infected human sera. Lanes 1 - 4: Western Blotting by infected human sera, lane 5: protein marker, lane 6: Western Blotting by normal sera (negative control).

5. Discussion

Nowadays, the technology of multi-epitope antigens is widespread. Design and construction of multi-epitope DNA and protein antigens can serve as (i) a vaccine candidate against different cancers like breast cancer and cervical cancer (27, 28), (ii) a vaccine candidate for the prevention and control of some infectious diseases like Toxoplasmosis, Influenza, and HIV-1 (29-31), and (iii) an antigen in diagnostic kits for Trypanosoma cruzi, Toxoplasma gondii, Hepatitis C, and Tuberculosis (32-35). Several virulence genes of H. pylori have been identified, some of which including UreB, HpaA, NapA, FlaA, and FlaB have been investigated as vaccines and serologic diagnostic candidates for H. pylori infection (36-39).
The prevalence of these antigens in H. pylori isolated strains is 100%, 100%, 93.6%, 100%, and 99%, respectively. Therefore, among proteins, UreB is the optimal antigen and others can be potential antigens for developing H. pylori diagnostic kits and vaccines (40). The benefits of this protein in stimulating immune responses include the same nucleotide sequence and high prevalence among strains, high molecular weight, high expression rate, and strong antigenicity of urea protein (41). Previous research on this antigen showed despite these benefits, oral immunization with a dual antigen was achieved using a combination of H. pylori heat-shock protein and urease in H. felis-infected mice models and induced a strong immune response.
Similarly, in another study, immunization with HpaA or UreB alone induced weak immune responses; however, when both antigens were used together, a stronger immune response was produced (42-45). These results indicate that combining antigens can be a good strategy for developing vaccines against H. pylori infection. Moreover, a mixture of antigens in diagnostic kits provides higher sensitivity and specificity than a single antigen (12-15). The 100% FlaA expression rate among different H. pylori isolates and 98.4% of its specific antibody positive rate in infected patients (with the highest expression rate and specific antibody positive rate in the second rank after UreB) make it appropriate for selection compared to other antigens of H. pylori (40).
The construction of many epitope proteins involves several proteins or domains of proteins. The linker sequence is particularly important for the construction of functional fusion proteins. Several studies have investigated the linker sequence, showing that the flexibility and hydrophilicity of the linker were important in the function of domains. For this reason, we chose LAAA as a peptide linker for making a recombinant multi-epitope protein (46).
Therefore, in this study, we decided to design and construct a multi-epitope antigen via combining the hyperantigenic regions of UreB with the hyperantigenic regions of FlaA in order to increase the specific immune response and safety and decrease side effects of unfavorable epitopes associated with complete antigens. Conserved epitopes of UreB and FlaA with appropriate antigen properties were determined by bioinformatics methods and used instead of whole antigens (11). These regions were confirmed by four software applications, as mentioned earlier. Based on the results, the recombinant protein had high antigenicity and could stimulate the immune response.
In this study, the antigenicity of the specified regions was evaluated through the production of recombinant rFlaA-UreB. Then, the antigenicity of the protein was examined by immunoblotting, performed on the patients’ sera with H. pylori infection. Therefore, it can be concluded although rFlaA-UreB is much smaller than normal UreB and FlaA, it has the same antigenic properties. Thus, it seems this recombinant protein can be effectively used for vaccines. Moreover, it could be applied as a diagnostic antigen for H. pylori infections in different kits.

5.1. Conclusions

In summary, the study identified the antigenic areas of recombinant rFlaA-UreB protein by human sera infected with H. pylori. It can be concluded that the antigenic areas of this multi-epitope protein have an antigenic property that can be further used for the development of H. pylori vaccines and diagnostic kits.

Acknowledgments

Footnotes

  • Authors' Contribution: Study design: Hamid Abtahi and Ghasem Mosayebi. Literature review: Behzad Khansarinejad. Data analysis: Zeinab Hamzehloo and Mina Zolfaghari. Manuscript preparation: Hamid Abtahi, Ghasem Mosayebi, and Zeinab Hamzehloo.

  • Conflict of Interests: The authors declare no conflict of interest.

  • Ethical Considerations: This study is a part of the thesis proposal of M.Sc (No.: 2025) and its ethical code from the Ethical Committee of Arak University of Medical Sciences, Arak, Iran is 93-171-19.

  • Financial Disclosure: The authors declare no financial disclosure.

  • Funding/Support: This study was conducted with the financial support from Molecular and Medicine Research Center, Arak University of Medical Sciences, Arak, Iran.

  • Patient Consent: It is not declared by the authors.

References

  • 1.
    Linz B, Balloux F, Moodley Y, Manica A, Liu H, Roumagnac P, et al. An African origin for the intimate association between humans and Helicobacter pylori. Nature. 2007;445(7130):915-8. [PubMed ID: 17287725]. [PubMed Central ID: PMC1847463]. https://doi.org/10.1038/nature05562.
  • 2.
    McMahon BJ, Bruce MG, Koch A, Goodman KJ, Tsukanov V, Mulvad G, et al. The diagnosis and treatment of Helicobacter pylori infection in Arctic regions with a high prevalence of infection: Expert Commentary. Epidemiol Infect. 2016;144(2):225-33. [PubMed ID: 26094936]. [PubMed Central ID: PMC4697284]. https://doi.org/10.1017/S0950268815001181.
  • 3.
    Frydman GH, Davis N, Beck PL, Fox JG. Helicobacter pylori eradication in patients with immune thrombocytopenic purpura: A review and the role of biogeography. Helicobacter. 2015;20(4):239-51. [PubMed ID: 25728540]. [PubMed Central ID: PMC4506733]. https://doi.org/10.1111/hel.12200.
  • 4.
    Farjadi V, Abtahi H, Zolfaghari MR, Soufian S, Hasanzadeh L. Expression, purification and evaluation of antigenicity of CagA antigenic fragment of Helicobacter pylori. Jundishapur J Microbiol. 2013;6(9). e7367. https://doi.org/10.5812/jjm.7367.
  • 5.
    Perrais M, Rousseaux C, Ducourouble MP, Courcol R, Vincent P, Jonckheere N, et al. Helicobacter pylori urease and flagellin alter mucin gene expression in human gastric cancer cells. Gastric Cancer. 2014;17(2):235-46. [PubMed ID: 23703470]. https://doi.org/10.1007/s10120-013-0267-5.
  • 6.
    Zhang H, Liu M, Li Y, Zhao Y, He H, Yang G, et al. Oral immunogenicity and protective efficacy in mice of a carrot-derived vaccine candidate expressing UreB subunit against Helicobacter pylori. Protein Expr Purif. 2010;69(2):127-31. [PubMed ID: 19651219]. https://doi.org/10.1016/j.pep.2009.07.016.
  • 7.
    Xing Y, Liu W, Li X, Guo L, Lv X, Xi T. Immunogenicity characterization of the multi-epitope vaccine CTB-UE with chitosan-CpG as combination adjuvants against Helicobacter pylori. Biochem Biophys Res Commun. 2015;462(3):269-74. [PubMed ID: 25957472]. https://doi.org/10.1016/j.bbrc.2015.04.130.
  • 8.
    Zhou WY, Shi Y, Wu C, Zhang WJ, Mao XH, Guo G, et al. Therapeutic efficacy of a multi-epitope vaccine against Helicobacter pylori infection in BALB/c mice model. Vaccine. 2009;27(36):5013-9. [PubMed ID: 19446591]. https://doi.org/10.1016/j.vaccine.2009.05.009.
  • 9.
    Zavala-Spinetti L, Breslin MB, Correa H, Begue RE. Development and evaluation of a DNA vaccine based on Helicobacter pylori urease B: Failure to prevent experimental infection in the mouse model. Helicobacter. 2006;11(6):517-22. [PubMed ID: 17083372]. https://doi.org/10.1111/j.1523-5378.2006.00453.x.
  • 10.
    Corthesy B, Boris S, Isler P, Grangette C, Mercenier A. Oral immunization of mice with lactic acid bacteria producing Helicobacter pylori urease B subunit partially protects against challenge with Helicobacter felis. J Infect Dis. 2005;192(8):1441-9. [PubMed ID: 16170763]. https://doi.org/10.1086/444425.
  • 11.
    Liu KY, Shi Y, Luo P, Yu S, Chen L, Zhao Z, et al. Therapeutic efficacy of oral immunization with attenuated Salmonella typhimurium expressing Helicobacter pylori CagA, VacA and UreB fusion proteins in mice model. Vaccine. 2011;29(38):6679-85. [PubMed ID: 21745524]. https://doi.org/10.1016/j.vaccine.2011.06.099.
  • 12.
    Andersen LP, Espersen F. Immunoglobulin G antibodies to Helicobacter pylori in patients with dyspeptic symptoms investigated by the western immunoblot technique. J Clin Microbiol. 1992;30(7):1743-51. [PubMed ID: 1629330]. [PubMed Central ID: PMC265374].
  • 13.
    Simor AE, Lin E, Saibil F, Cohen L, Louie M, Pearen S, et al. Evaluation of enzyme immunoassay for detection of salivary antibody to Helicobacter pylori. J Clin Microbiol. 1996;34(3):550-3. [PubMed ID: 8904412]. [PubMed Central ID: PMC228844].
  • 14.
    Manes G, Zanetti MV, Piccirillo MM, Lombardi G, Balzano A, Pieramico O. Accuracy of a new monoclonal stool antigen test in post-eradication assessment of Helicobacter pylori infection: Comparison with the polyclonal stool antigen test and urea breath test. Dig Liver Dis. 2005;37(10):751-5. [PubMed ID: 16023902]. https://doi.org/10.1016/j.dld.2005.03.012.
  • 15.
    Pelerito A, Oleastro M, Lopes AI, Ramalho P, Cabral J, Monteiro L. Evaluation of rapid test Assure Helicobacter pylori for diagnosis of H. pylori in pediatric population. J Microbiol Methods. 2006;66(2):331-5. [PubMed ID: 16516992]. https://doi.org/10.1016/j.mimet.2005.12.013.
  • 16.
    Stingl K, Altendorf K, Bakker EP. Acid survival of Helicobacter pylori: How does urease activity trigger cytoplasmic pH homeostasis? Trends Microbiol. 2002;10(2):70-4. [PubMed ID: 11827807]. https://doi.org/10.1016/S0966-842X(01)02287-9.
  • 17.
    Weeks DL, Eskandari S, Scott DR, Sachs G. A H+-gated urea channel: The link between Helicobacter pylori urease and gastric colonization. Science. 2000;287(5452):482-5. [PubMed ID: 10642549]. https://doi.org/10.1126/science.287.5452.482.
  • 18.
    Begue RE, Sadowska-Krowicka H. Protective efficacy of recombinant urease B and aluminum hydroxide against Helicobacter pylori infection in a mouse model. FEMS Immunol Med Microbiol. 2010;60(2):142-6. [PubMed ID: 20731722]. [PubMed Central ID: PMC2970735]. https://doi.org/10.1111/j.1574-695X.2010.00726.x.
  • 19.
    Yan J, Wang Y, Shao SH, Mao YF, Li HW, Luo YH. Construction of prokaryotic expression system of ltB-ureB fusion gene and identification of the recombinant protein immunity and adjuvanticity. World J Gastroenterol. 2004;10(18):2675-9. [PubMed ID: 15309718]. [PubMed Central ID: PMC4572192]. https://doi.org/10.3748/wjg.v10.i18.2675.
  • 20.
    Raoufi E, Akrami H, Khansarinejad B, Abtahi H. Expression and antigenic evaluation of Helicobacter pylori UreB fragment. Jundishapur J Microbiol. 2017;10(5). e41645. https://doi.org/10.5812/jjm.41645.
  • 21.
    Kostrzynska M, Betts JD, Austin JW, Trust TJ. Identification, characterization, and spatial localization of two flagellin species in Helicobacter pylori flagella. J Bacteriol. 1991;173(3):937-46. [PubMed ID: 1704004]. [PubMed Central ID: PMC207209]. https://doi.org/10.1128/jb.173.3.937-946.1991.
  • 22.
    Wu CC, Chou PY, Hu CT, Liu ZC, Lin CY, Tseng YH, et al. Clinical relevance of the vacA, iceA, cagA, and flaA genes of Helicobacter pylori strains isolated in Eastern Taiwan. J Clin Microbiol. 2005;43(6):2913-5. [PubMed ID: 15956417]. [PubMed Central ID: PMC1151873]. https://doi.org/10.1128/JCM.43.6.2913-2915.2005.
  • 23.
    Zarei M, Mosayebi G, Khansarinejad B, Abtahi H. Antigenic and immunogenic evaluation of Helicobacter pylori FlaA epitopes. Iran J Basic Med Sci. 2017;20(8):920-6. [PubMed ID: 29085584]. [PubMed Central ID: PMC5651478]. https://doi.org/10.22038/IJBMS.2017.9115.
  • 24.
    Tong JC, Tan TW, Ranganathan S. Methods and protocols for prediction of immunogenic epitopes. Brief Bioinform. 2007;8(2):96-108. [PubMed ID: 17077136]. https://doi.org/10.1093/bib/bbl038.
  • 25.
    Sambrook J, Russel D. Molecular cloning: A laboratory manual. 3rd ed. New york: Cold Spring Harbor Laboratory Press; 2001.
  • 26.
    Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74(12):5463-7. [PubMed ID: 271968]. [PubMed Central ID: PMC431765]. https://doi.org/10.1073/pnas.74.12.5463.
  • 27.
    Ghaffari-Nazari H, Tavakkol-Afshari J, Jaafari MR, Tahaghoghi-Hajghorbani S, Masoumi E, Jalali SA. Improving multi-epitope long peptide vaccine potency by using a strategy that enhances CD4+ T help in BALB/c Mice. PLoS One. 2015;10(11). e0142563. [PubMed ID: 26556756]. [PubMed Central ID: PMC4640540]. https://doi.org/10.1371/journal.pone.0142563.
  • 28.
    de Oliveira LM, Morale MG, Chaves AA, Cavalher AM, Lopes AS, Diniz Mde O, et al. Design, immune responses and anti-tumor potential of an HPV16 E6E7 multi-epitope vaccine. PLoS One. 2015;10(9). e0138686. [PubMed ID: 26390407]. [PubMed Central ID: PMC4577214]. https://doi.org/10.1371/journal.pone.0138686.
  • 29.
    Cao A, Liu Y, Wang J, Li X, Wang S, Zhao Q, et al. Toxoplasma gondii: Vaccination with a DNA vaccine encoding T- and B-cell epitopes of SAG1, GRA2, GRA7 and ROP16 elicits protection against acute toxoplasmosis in mice. Vaccine. 2015;33(48):6757-62. [PubMed ID: 26518401]. https://doi.org/10.1016/j.vaccine.2015.10.077.
  • 30.
    Chowdhury MY, Seo SK, Moon HJ, Talactac MR, Kim JH, Park ME, et al. Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice. Virol J. 2014;11:21. [PubMed ID: 24502341]. [PubMed Central ID: PMC3923897]. https://doi.org/10.1186/1743-422X-11-21.
  • 31.
    Paul S, Piontkivska H. Frequent associations between CTL and T-Helper epitopes in HIV-1 genomes and implications for multi-epitope vaccine designs. BMC Microbiol. 2010;10:212. [PubMed ID: 20696039]. [PubMed Central ID: PMC2924856]. https://doi.org/10.1186/1471-2180-10-212.
  • 32.
    Camussone C, Gonzalez V, Belluzo MS, Pujato N, Ribone ME, Lagier CM, et al. Comparison of recombinant Trypanosoma cruzi peptide mixtures versus multiepitope chimeric proteins as sensitizing antigens for immunodiagnosis. Clin Vaccine Immunol. 2009;16(6):899-905. [PubMed ID: 19339486]. [PubMed Central ID: PMC2691048]. https://doi.org/10.1128/CVI.00005-09.
  • 33.
    Hajissa K, Zakaria R, Suppian R, Mohamed Z. Design and evaluation of a recombinant multi-epitope antigen for serodiagnosis of Toxoplasma gondii infection in humans. Parasit Vectors. 2015;8:315. [PubMed ID: 26062975]. [PubMed Central ID: PMC4465724]. https://doi.org/10.1186/s13071-015-0932-0.
  • 34.
    Dipti CA, Jain SK, Navin K. A novel recombinant multiepitope protein as a hepatitis C diagnostic intermediate of high sensitivity and specificity. Protein Expr Purif. 2006;47(1):319-28. [PubMed ID: 16504539]. https://doi.org/10.1016/j.pep.2005.12.012.
  • 35.
    Cheng Z, Zhao JW, Sun ZQ, Song YZ, Sun QW, Zhang XY, et al. Evaluation of a novel fusion protein antigen for rapid serodiagnosis of tuberculosis. J Clin Lab Anal. 2011;25(5):344-9. [PubMed ID: 21919069]. https://doi.org/10.1002/jcla.20483.
  • 36.
    Cremonini F, Gabrielli M, Gasbarrini G, Pola P, Gasbarrini A. The relationship between chronic H. pylori infection, CagA seropositivity and stroke: Meta-analysis. Atherosclerosis. 2004;173(2):253-9. [PubMed ID: 15064099]. https://doi.org/10.1016/j.atherosclerosis.2003.12.012.
  • 37.
    Schumann C, Triantafilou K, Rasche FM, Moricke A, Vogt K, Triantafilou M, et al. Serum antibody positivity for distinct Helicobacter pylori antigens in benign and malignant gastroduodenal disease. Int J Med Microbiol. 2006;296(4-5):223-8. [PubMed ID: 16600680]. https://doi.org/10.1016/j.ijmm.2006.02.009.
  • 38.
    Jiang Z, Tao XH, Huang AL, Wang PL. A study of recombinant protective H.pylori antigens. World J Gastroenterol. 2002;8(2):308-11. [PubMed ID: 11925614]. [PubMed Central ID: PMC4658373]. https://doi.org/10.3748/wjg.v8.i2.308.
  • 39.
    Michetti P, Kreiss C, Kotloff KL, Porta N, Blanco JL, Bachmann D, et al. Oral immunization with urease and Escherichia coli heat-labile enterotoxin is safe and immunogenic in Helicobacter pylori-infected adults. Gastroenterology. 1999;116(4):804-12. [PubMed ID: 10092302]. https://doi.org/10.1016/S0016-5085(99)70063-6.
  • 40.
    Yan J, Mao YF, Shao ZX. Frequencies of the expression of main protein antigens from Helicobacter pylori isolates and production of specific serum antibodies in infected patients. World J Gastroenterol. 2005;11(3):421-5. [PubMed ID: 15637759]. [PubMed Central ID: PMC4205353]. https://doi.org/10.3748/wjg.v11.i3.421.
  • 41.
    Mao YF, Yan J. Construction of prokaryotic expression system of ureB gene from a clinical Helicobacter pylori strain and identification of the recombinant protein immunity. World J Gastroenterol. 2004;10(7):977-84. [PubMed ID: 15052678]. [PubMed Central ID: PMC4717116]. https://doi.org/10.3748/wjg.v10.i7.977.
  • 42.
    Blanchard T NJ. Helicobacter pylori vaccine. Helicobacter pylori in the 21st century. Wallingford, Oxforshire, UK: CABI; 2010.
  • 43.
    Ferrero RL, Thiberge JM, Kansau I, Wuscher N, Huerre M, Labigne A. The GroES homolog of Helicobacter pylori confers protective immunity against mucosal infection in mice. Proc Natl Acad Sci U S A. 1995;92(14):6499-503. [PubMed ID: 7604021]. [PubMed Central ID: PMC41545]. https://doi.org/10.1073/pnas.92.14.6499.
  • 44.
    Flach CF, Svensson N, Blomquist M, Ekman A, Raghavan S, Holmgren J. A truncated form of HpaA is a promising antigen for use in a vaccine against Helicobacter pylori. Vaccine. 2011;29(6):1235-41. [PubMed ID: 21147129]. https://doi.org/10.1016/j.vaccine.2010.11.088.
  • 45.
    Nystrom J, Svennerholm AM. Oral immunization with HpaA affords therapeutic protective immunity against H. pylori that is reflected by specific mucosal immune responses. Vaccine. 2007;25(14):2591-8. [PubMed ID: 17239498]. https://doi.org/10.1016/j.vaccine.2006.12.026.
  • 46.
    Arai R, Ueda H, Kitayama A, Kamiya N, Nagamune T. Design of the linkers which effectively separate domains of a bifunctional fusion protein. Protein Eng. 2001;14(8):529-32. [PubMed ID: 11579220]. https://doi.org/10.1093/protein/14.8.529.

Copyright

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

6
Feb
2017

Expression and Antigenic Evaluation of Helicobacter pylori UreB Fragment

Ehsan Raoufi,
Hassan Akrami,
Behzad Khansarinejad,
Hamid Abtahi

Raoufi E, Akrami H, Khansarinejad B, Abtahi H. Expression and Antigenic Evaluation of Helicobacter pylori UreB Fragment. Jundishapur J Microbiol. 2017;10(5):e41645. doi: https://doi.org/10.5812/jjm.41645

31
Jan
2010

Cloning, Expression, Purification and Characterization of Recombinant UreB229-561 from Helicobacter Pylori

Bahareh Hajikhani,
Shahin Najar Peerayeh,
Hoorieh Soleimanjahi,
Zuhair M Hassan,
Gholamreza Goudarzi

Hajikhani B, Najar Peerayeh S, Soleimanjahi H, M Hassan Z, Goudarzi G. Cloning, Expression, Purification and Characterization of Recombinant UreB229-561 from Helicobacter Pylori. Arch Clin Infect Dis. 2010;5(1):. doi:

1
Nov
2013

Expression, Purification and Evaluation of Antigenicity of CagA Antigenic Fragment of Helicobacter pylori

Vahideh Farjadi,
Hamid Abtahi,
Mohammad Reza Zolfaghari,
Safieh Soufian,
Leila Hasanzadeh

Farjadi V, Abtahi H, Zolfaghari MR, Soufian S, Hasanzadeh L. Expression, Purification and Evaluation of Antigenicity of CagA Antigenic Fragment of Helicobacter pylori. Jundishapur J Microbiol. 2013;6(9):e7367. doi: https://doi.org/10.5812/jjm.7367

31
Oct
2011

Cloning and Expression of Helicobacter Pylori UreB122(a Segment of the B-subunit of Urease Gene)

Shahin Najar Peerayeh,
Moein Farshchian,
Majid Sadeghizadeh,
Javad Atoofi

Najar Peerayeh S, Farshchian M, Sadeghizadeh M, Atoofi J. Cloning and Expression of Helicobacter Pylori UreB122(a Segment of the B-subunit of Urease Gene). Arch Clin Infect Dis. 2011;6(4):. doi:

30
Apr
2010

Elicitation of IgY in Chicken Egg Yolk by Recombinant Fragments of UreC and Its Efficacy Against Helicobacter Pylori

Hossein Basiri,
Seyed Latif Mousavi,
Iraj Rasooli,
Mohsen Basiri,
Davood Yadegarynia

Basiri H, Mousavi SL, Rasooli I, Basiri M, Yadegarynia D. Elicitation of IgY in Chicken Egg Yolk by Recombinant Fragments of UreC and Its Efficacy Against Helicobacter Pylori. Arch Clin Infect Dis. 2010;5(2):. doi:

More by these authors

Zeinab HamzehlooPubMedScholar
Ghasem MosayebiPubMedScholar
Behzad KhansarinejadPubMedScholar
Mina ZolfaghariPubMedScholar
Hamid AbtahiPubMedScholar
Share
Cited by
Metrics