A Novel Mutation in the α2-Globin Gene in Two Unrelated Iranian Families

Author(s):
Tayebeh HamzehloeiTayebeh Hamzehloei1,*, Farnaz Mohajer TehranFarnaz Mohajer Tehran2, Hosein AzimianHosein Azimian1
1Medical Genetics Department, Mashhad University of Medical Sciences, Mashhad, IR Iran
2Genetics Division, Ghaem Hospital, Mashhad University of Medical Sciences, Mashhad, IR Iran
*Corresponding Author: Tayebeh Hamzehloei, Department of Medical Genetics, Mashhad University of Medical Sciences, Mashhad, IR Iran. Tel: +98-5118002248, Fax: +98-5118002248, E-mail: Email: [email protected]

Shiraz E-Medical Journal:Vol. 15, issue 1; e19735
Published online:Jan 15, 2014
Article type:Research Article
Received:Jun 10, 2013
Accepted:Apr 10, 2014
How to Cite:Hamzehloei T, Mohajer Tehran F, Azimian H. A Novel Mutation in the α2-Globin Gene in Two Unrelated Iranian Families. Shiraz E-Med J. 2014;15(1):e19735. doi: https://doi.org/10.17795/semj19735

Abstract

Background:

α-globin is encoded by two adjacent genes, αl and α2. Evidence suggests that these genes are not expressed equally and that the α2-globin gene encodes the majority of α-globin. This finding predicts that a thalassemic mutation of the α2-globin gene would result in a more severe loss of α-chain synthesis than a similar mutation in the αl-globin gene.

Objectives:

In the present study we described a novel non-deletion α-thalassemia defect in the 5'UTR region of the α2-globin gene.

Materials and Methods:

For molecular analysis, genomic DNA was isolated from peripheral blood cells by a salting out procedure. The common alpha deletion mutations were ruled out using the published primers and conditions. The amplification of the entire β and α1 globin genes was also carried out and their DNA was sequenced. No mutation was detected.

Results:

The mutation under study was located on an AP-1 transcription factor binding site and inherited in two unrelated Iranian families with hypochromic microcytic anemia.

Conclusions:

The patients in this study had moderate microcytosis and hypochromia without hemolysis, jaundice and splenomegaly. Molecular analysis in these patients revealed a non-deletion type of mutation in the promoter region, which is highly consistent with findings of other studies.

1. Background

Alpha-Thalassemia (-thal), one of the most common genetic disorders in the world, is characterized by deficient (+) or absent () synthesis of the alpha chain of the hemoglobin (Hb) molecule (1). Most -thal determinants are deletions involving one or both of the duplicated alpha-globin genes. However, non-deletion -thal mutations have been reported, which include termination codon mutations such as Hb Constant Spring (2), splicing defect caused by a 5-basepair (bp) deletion of the first intervening sequence (3), Hb Quong Sze, extremely unstable a-globin structural variant (4, 5), single nucleotide substitution of the polyadenylation site (6), two nucleotide deletions at position -1 and -2 of the 5' untranslated region preceding the AUG codon (7), initiation codon mutation (AUG-ACG) (8) and nonsense mutation (a 116 GAG-UAG) (8). Apart from the -1, -2 deletion that occurs in a single a-globin gene chromosome, each of these mutations affects the 2-globin gene.

2. Objectives

Here, we report on a novel mutation in two unrelated families with moderate microcytosis aneamia. Sequencing of the 2 and 1 globin genes revealed a novel heterozygous point mutation at the 5'UTR region of the 2-globin gene.

3. Materials and Methods

3.1. Patients

Among patients referred to the Genetic Antenatal Clinic at the Ghaem Hospital of Mashhad, two families showed an inherited novel mutation. Prior to any laboratory work, according to the ethics community, a written consent was obtained from all patients. In the first family, the proband (II-1) and her parents (I-1 and I-2) were studied (Table 1). The proband (II-1) and her mother (I-2) carried the mutation while the father (I-1) had a normal genotype. In the case of the second family (Table 2) the proband (II-1) and his mother (I-2) carried the mutation while his sister (II-2) had a normal genotype. The red blood cell (RBC) indices, and Hb A2 and Hb F percentages were determined and alkaline electrophoresis on cellulose acetate and citrate agar electrophoresis were carried out according to standard procedures (9). The red cell lysates were also analyzed by isoelectric focusing (IEF) and exchanges high performance liquid chromatography (HPLC) (10).
Table 1. Family 1 Hematological Data and α-Globin Genotype of the Proband and Her Family Members
PARAMETERSII-1I-1I-2
SEX-AGE, YF-16M-42F-36
GENOTYPEΑΑ/ΑTΑΑΑ/ΑΑΑΑ/ΑTΑ
RBC, 1012/L5.177.035.32
HB, G/DL13.217.513.2
MCV, FL78.380.079.5
MCH, PG25.527.024.8
HBA2, %2.52.72.0
HBF, %1.90.61.6
FERRITIN (ECL)31.23715.4
Β-GENOTYPE (SEQUENCING)NORMALNORMALNORMAL
Table 2. Family 2 Hematological Data and α-Globin Genotype of the Proband and His Family Members
ParametersII-1II-2I-2
Sex-age, yM-24F-32F-68
Genotypeαα/αTααα/αααα/αTα
RBC, 1012/L6.064.714.67
Hb, g/dL14.913.412.8
MCV, fL73.890.071.2
MCH, pg24.628.523.2
HbA2, %3.02.52.4
HbF, %1.21.01.4
Ferritin, ECL265413
β-Genotype (sequencing)NormalNormalNormal

3.2. Molecular Analysis

For molecular analysis genomic DNA was isolated from peripheral blood cells by a salting out procedure (11). The common alpha deletion mutations were ruled out using the published primers and conditions (12). The amplification of the entire and 1 globin genes was also carried out and their DNA was sequenced. No was mutation detected (the primers and PCR conditions are available upon request). The 2-globin gene was amplified in an Applied Biosystems 2720 thermal cycler using 10 pmol of the following primers: forward (5΄- GCTCCGCGCCAGCCAATGAG -3΄); reverse (5΄- GAGAGGTCCTTGGTCTGAGACAG -3΄) using Hot star Taq DNA polymerase (Qiagen). The 2-globin gene was sequenced in both forward and reverse directions using an ABI PRISMTM 310 Genetic Analyzer (PE Applied BioSystems, Foster City, CA, USA) and the ABI PRISM Big Dye Terminator v3.1 Cycle Sequencing Kit (PE BioSystems).

3.3. Gene Expression Analyses by Real-Time Polymerase Chain Reaction (PCR)

Cytoplasmic RNA was isolated by the use of QIAamp RNA Blood Mini Kit (Qiagen) according to manufacturer’s protocol. RNA was reverse transcribed by the use of oligo (dT) and superscript reverse transcriptase (Gibco-BRL). Real-time polymerase chain reaction (RT-PCR) was performed on the StepOne™ (48-well) Real-Time PCR system (Applied Biosystems) in MicroAmp™ Fast Optical 48-Well reaction plate (applied biosystems) with a total volume of 15 µL, containing cDNA (1.5 µL), forward and reverse primers (300 nM), SYBR® Premix Ex TaqTM (7.5 µL) (Takara, Japan) and ROXTM Reference Dye II (0.3 µL) (Takara, Japan) and dH2O 5.1 µL with Optical Adhesive Film (Applied Biosystems) in triplicates. Thermal cycling conditions were as follows: stage one, 95°C for 60 seconds; stage two (repeated 40 times), melting at 95°C for 10 seconds; stage three annealing and polymerizing at 60°C for 30 seconds. The relative standard curve method was applied for cDNA quantification. The quantities of the target genes were normalized with the quantity of beta-2 microglobulin (β2M) as the endogenous control gene. To obtain the final relative quantification (RQ), the normalized quantity of the unknown sample was compared with the normalized quantity of the control sample. Primer sequences were: β2M forward 5΄- GTA TGC CTG CCG TGT GAA C-3΄, reverse 5΄-AAC CTC CAT GAT GCT GCT TAC-3΄; alpha-2 (HBA2) forward 5΄-ACG CTG GCG AGT ATG GT -3΄, reverse 5΄- GCT TAG GAG CTT GAA GTT GAC -3΄.

4. Results

The hematological data of the probands and their families are presented in Tables 1 and 2. Hypochromia and microcytosis were found in the probands and in I-2 of both families. The father of the second family was deceased and the sister (II-2) did not carry the thalassemia mutation. No abnormal globin chain was detected by reversed phase HPLC. The common deletion mutations for 1 and 2 globin genes (12) and non-deletion 1 globin gene mutations and also anemia due to iron deficiency were ruled out. Molecular analysis of the beta-globin gene did not reveal any defect in any family member. In the probands and other affected members of the families, DNA sequencing of the 2 gene, showed a novel heterozygous C > G substitution, 23 nucleotides upstream of the ATG translation initiation codon. This was confirmed by reverse sequencing (Figure 1).
Forward sequence in the patient showing a substitution in the heterozygous state at position -23 (C > G substitution); 5΄ flanking of the ATG translation initiation codon of the ‘2 globin gene.
Figure 1.

Forward sequence in the patient showing a substitution in the heterozygous state at position -23 (C > G substitution); 5΄ flanking of the ATG translation initiation codon of the ‘2 globin gene.

4.1. Alpha-2 Gene Expression

To evaluate whether this variant correlated with reduced mRNA levels, we measured α2-globin mRNA levels by real-time PCR. Real-time PCR results were analyzed automatically using the StepOne software v. 2.1 (Applied Biosystems). As shown in Figure 1, in this case, expression level of alpha-2 with respect to the control decreased dramatically. From our results a reduction of 277 folds is evident in alpha-2 gene expression (Figure 2).
Gene expression data is given in terms of the base-2 logarithm of the ratio and negative values represent decreased expression.
Figure 2.

Gene expression data is given in terms of the base-2 logarithm of the ratio and negative values represent decreased expression.

5. Discussion

The mutation identified in our study was located on an AP-1 transcription factor binding site at position 222890 on chromosome 16. This mutation is within the 5'UTR region of the HbA2 gene. Although most mutations reported in the 5'UTR of the 2-globin gene are deletions (13-16) a T to G transversion in the regulatory binding motif of the -globin gene cluster can affect the regulation of gamma-globin gene expression (17). A high level of -globin expression depends on cis-acting regulatory sequences located upstream of the -globin gene. It has been shown that sequences containing the -globin positive regulatory element, activate globin expression in transgenic mice (18). The AP-1 transcription factor binding site in murine -globin contributes to long range -globin gene activation. Loyd et al. (19) demonstrated that a mutation in an AP-1/NFE2 transcription factor binding site motif could function over large distances and affect activation of - globin gene expression. They also demonstrated that the AP-1 binding sites are required for full enhancer activity and -globin gene transcription. Therefore, since a normal individual has four active α genes (αα/αα) and severity of α-thalassemia is related to the number of active α genes, fetuses with Hb Bart’s hydrop (−−/−−) died in utero. Patients with HbH disease have only one active α gene (−−/−α) and moderately severe but variable anemia. A person having two α genes (−α/−α or −−/αα) shows only a mild and sometimes asymptomatic form of α-thalassemia, whereas silent carriers (αα/−α) are generally normal. The disease is usually characterized by two main types; deletion HbH disease (−−/−α) and non-deletion HbH disease (−/−αTα).
The patients in this study had moderate microcytosis and hypochromia without hemolysis, jaundice and splenomegaly. Molecular analysis of these patients revealed a non-deletion type of mutation in the promoter region, which is highly consistent with the findings of previous studies (14-16).

Acknowledgments

Footnotes

  • Implication for health policy/practice/research/medical education:In the present study we described a novel non-deletion α-thalassemia defect in the 5'UTR region of the α2-globin gene.

  • Authors’ Contributions:All authors participated equally in this study.

  • Financial Disclosure:There was no conflict of interest.

  • Funding/Support:This study was self funded.

References

  • 1.
    Higgs. D. R. 5 α-Thalassaemia. Bailliere’s Clin Haematol. 1993;6(1):117-50. https://doi.org/10.1016/s0950-3536(05)80068-x.
  • 2.
    Clegg JB, Weatherall DJ, Milner PF. Haemoglobin Constant Spring--a chain termination mutant? Nature. 1971;234(5328):337-40. [PubMed ID: 4944483].
  • 3.
    Orkin SH, Goff SC, Hechtman RL. Mutation in an intervening sequence splice junction in man. Proc Natl Acad Sci U S A. 1981;78(8):5041-5. [PubMed ID: 6946451].
  • 4.
    Goossens M, Lee KY, Liebhaber SA, Kan YW. Globin structural mutant alpha 125Leu leads to Pro is a novel cause of alpha-thalassaemia. Nature. 1982;296(5860):864-5. [PubMed ID: 7070526].
  • 5.
    Liebhaber SA, Kan YW. alpha-Thalassemia caused by an unstable alpha-globin mutant. J Clin Invest. 1983;71(3):461-6. [PubMed ID: 6826718].
  • 6.
    Higgs DR, Goodbourn SE, Lamb J, Clegg JB, Weatherall DJ, Proudfoot NJ. Alpha-thalassaemia caused by a polyadenylation signal mutation. Nature. 1983;306(5941):398-400. [PubMed ID: 6646217].
  • 7.
    Morle F, Lopez B, Henni T, Godet J. alpha-Thalassaemia associated with the deletion of two nucleotides at position -2 and -3 preceding the AUG codon. EMBO J. 1985;4(5):1245-50. [PubMed ID: 4006915].
  • 8.
    Pirastu M, Saglio G, Chang JC, Cao A, Kan YW. Initiation codon mutation as a cause of alpha thalassemia. J Biol Chem. 1984;259(20):12315-7. [PubMed ID: 6490612].
  • 9.
    Huisman THJ, Jonxis JHP. Clinical and Biochemical Analysis. New York: Marcel Dekker Inc; 1997.
  • 10.
    Bisse E, Wieland H. High-performance liquid chromatographic separation of human haemoglobins. Simultaneous quantitation of foetal and glycated haemoglobins. J Chromatogr. 1988;434(1):95-110. [PubMed ID: 2468680].
  • 11.
    Nasiri H, Forouzandeh M, Rasaee MJ, Rahbarizadeh F. Modified salting-out method: high-yield, high-quality genomic DNA extraction from whole blood using laundry detergent. J Clin Lab Anal. 2005;19(6):229-32. [PubMed ID: 16302208]. https://doi.org/10.1002/jcla.20083.
  • 12.
    Tan ASC. A rapid and reliable 7-deletion multiplex polymerase chain reaction assay for alpha -thalassemia. Blood. 2001;98(1):250-1. https://doi.org/10.1182/blood.V98.1.250.
  • 13.
    Hatton CS, Wilkie AO, Drysdale HC, Wood WG, Vickers MA, Sharpe J, et al. Alpha-thalassemia caused by a large (62 kb) deletion upstream of the human alpha globin gene cluster. Blood. 1990;76(1):221-7. [PubMed ID: 2364173].
  • 14.
    Liebhaber SA, Griese EU, Weiss I, Cash FE, Ayyub H, Higgs DR, et al. Inactivation of human alpha-globin gene expression by a de novo deletion located upstream of the alpha-globin gene cluster. Proc Natl Acad Sci U S A. 1990;87(23):9431-5. [PubMed ID: 1701260].
  • 15.
    Romao L, Osorio-Almeida L, Higgs DR, Lavinha J, Liebhaber SA. Alpha-thalassemia resulting from deletion of regulatory sequences far upstream of the alpha-globin structural genes. Blood. 1991;78(6):1589-95. [PubMed ID: 1715793].
  • 16.
    Wilkie AO, Lamb J, Harris PC, Finney RD, Higgs DR. A truncated human chromosome 16 associated with alpha thalassaemia is stabilized by addition of telomeric repeat (TTAGGG)n. Nature. 1990;346(6287):868-71. [PubMed ID: 1975428]. https://doi.org/10.1038/346868a0.
  • 17.
    Chen FE, Ooi C, Ha SY, Cheung BM, Todd D, Liang R, et al. Genetic and clinical features of hemoglobin H disease in Chinese patients. N Engl J Med. 2000;343(8):544-50. [PubMed ID: 10954762]. https://doi.org/10.1056/NEJM200008243430804.
  • 18.
    Grosveld F, van Assendelft GB, Greaves DR, Kollias G. Position-independent, high-level expression of the human β-globin gene in transgenic mice. Cell. 1987;51(6):975-85. https://doi.org/10.1016/0092-8674(87)90584-8.
  • 19.
    Loyd MR, Okamoto Y, Randall MS, Ney PA. Role of AP1/NFE2 binding sites in endogenous alpha-globin gene transcription. Blood. 2003;102(12):4223-8. [PubMed ID: 12920035]. https://doi.org/10.1182/blood-2003-02-0574.

Copyright

Copyright © 2014, Shiraz University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

19
Mar
2011

Molecular analysis of alpha globin gene deletions among patients with microcytic hypochromic anemia in Kermanshah-Iran

Reza Alibakhshi,
Majid Arash,
Reza Akramipour,
Hamid Nomani,
Mohammad-Reza Farshchi,
Soheila Fathollahi
,et al.

Alibakhshi R, Arash M, Akramipour R, Nomani H, Farshchi M, et al. Molecular analysis of alpha globin gene deletions among patients with microcytic hypochromic anemia in Kermanshah-Iran. J Kermanshah Univ Med Sci. 2011;14(4):e79447. doi:

30
Jun
2010

Wide Spectrum of Mutations in the Beta-Globin Gene Causing Beta-Thalassemia Major in Southwest Iran

Hamid Galehdari,
Mohammad Pedram,
Bahaoddin Salehi,
Behnaz Andashti

Galehdari H, Pedram M, Salehi B, Andashti B. Wide Spectrum of Mutations in the Beta-Globin Gene Causing Beta-Thalassemia Major in Southwest Iran. J Compr Ped. 2010;2(1):. doi:

29
Aug
2015

Prevalence of Alpha and Beta-Thalassemia Mutations Among Carriers of Thalassemia in Shadegan City, Southwest of Iran

Amin Doosti Irani,
Zahra Cheraghi,
Saied Bitaraf,
Parvin Cheraghi,
Saeid Safiri

Doosti Irani A, Cheraghi Z, Bitaraf S, Cheraghi P, Safiri S. Prevalence of Alpha and Beta-Thalassemia Mutations Among Carriers of Thalassemia in Shadegan City, Southwest of Iran. Zahedan J Res Med Sci. 2015;17(8):e1032. doi: https://doi.org/10.17795/zjrms1032

31
May
2015

A Patient With Coinheritance of Alpha-Globin Gene Triplication and IVSI-5 Mutation of Beta-Globin Gene

Majid Naderi,
Ibrahim Miri-Moghaddam,
Akbar Dorgalaleh,
Shaban Alizadeh,
Shadi Tabibian,
Masoud Pishjoo

Naderi M, Miri-Moghaddam I, Dorgalaleh A, Alizadeh S, Tabibian S, et al. A Patient With Coinheritance of Alpha-Globin Gene Triplication and IVSI-5 Mutation of Beta-Globin Gene. Zahedan J Res Med Sci. 2015;17(5):-. doi: https://doi.org/10.17795/zjrms975

15
Aug
2005

Survey of prevalence of beta-globin gene mutations of beta thalassemia in province of Ghazven

Masomeh Tafzili,
Isa Normohammadi,
Farhad Zaker,
Sima KheradmandKia

Tafzili M, Normohammadi I, Zaker F, KheradmandKia S. Survey of prevalence of beta-globin gene mutations of beta thalassemia in province of Ghazven. koomesh. 2005;6(4):e152063. doi:

Download PDF335.64 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles