The Frequency of BCR-ABL1 Fusion Transcripts in Iranian Patients with Three Different Types of Leukemia

Author(s):
Mohammad HamidMohammad Hamid1,*, Hanieh BokharaeiHanieh Bokharaei1
1Department of Molecular Medicine, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran
*Corresponding Author: Corresponding author: Mohammad Hamid, Molecular Medicine Dept., Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran. Tel/Fax: +98-2166480780, E-mail: Email: [email protected]

Zahedan Journal of Research in Medical Sciences:Vol. 19, issue 7; e10197
Published online:Jul 31, 2017
Article type:Research Article
Received:Dec 26, 2016
Accepted:May 08, 2017
How to Cite:Hamid M, Bokharaei H. The Frequency of BCR-ABL1 Fusion Transcripts in Iranian Patients with Three Different Types of Leukemia. Zahedan J Res Med Sci. 2017;19(7):e10197. doi: https://doi.org/10.5812/zjrms.10197

Abstract

Background:

Different BCR-ABL fusion transcripts occur more or less frequently, in three different types of leukemia

Objectives:

This study was done to determine the frequencies of BCR-ABL fusion transcripts in leukemia patients from Iran.

Methods:

This experimental study was carried out from 2001 to 2015 in Pasteur Institute of Iran. The leukemia patients containing 348 chronic myeloid leukemia (CML), 72 acute lymphoblastic leukemia (ALL), and 34 acute myeloid leukemia (AML) were studied. Total RNA was extracted from peripheral blood samples and analyzed by multiplex RT-PCR in 486 leukemia patients to detect different types of BCR-ABL transcripts. Fisher’s exact test was used in comparing qualitative variables in the case control study. Associations with a P value < 0.05 were considered significant.

Results:

The BCR-ABL transcript frequencies for CML, ALL and AML patients were 92.0%, 12.5% and 14.7% respectively for all transcripts. The majority of CML patients with positive BCR-ABL expressed one of the p210BCR-ABL transcripts (86.6%) while the remaining showed other transcripts (p190BCR-ABL 25 (7.8%)) and p230BCR-ABL 2 (0.6%)). The rate of co-expression of the p190/p210 transcripts were 16 (5%). In other types of leukemia patients the rates of expression of those transcripts were different.

Conclusions:

For the first time, we reported co-expression of p210/p190 which may be caused by alternative splicing in Iranian patients. This study we showed no significant correlation between BCR-ABL1 variants, age, sex type, and WBC count of studied leukemia patients.

1. Background

The Philadelphia chromosome is basically caused by reciprocal translocation between chromosomes 9 and 22: t (9; 22)(q34;q11). This translocation causes the formation of BCR-ABL fusion gene, and is associated often with chronic myeloid leukemia (CML) [1]. More than 95% of patients with CML are positive for a BCR-ABL gene in their leukemia cells [2].
However, the BCR-ABL gene is just not limited to CML type. It is also reported in 10% to 20% of adults and in 2% to 5% of children with acute lymphoblastic leukemia (ALL), and in very rarely cases of acute myeloid leukemia (AML) [1, 3].
In the majority of CML patients (95%) the breakpoint in the BCR gene falls within the major breakpoint cluster region (Mbcr), and the resultant BCR-ABL mRNA molecules with a b2a2 (40%) or b3a2 (55%) junction encode a 210 kDa fusion protein (p210BCR-ABL) [1]. In 5% of CML patients, both b3a2 and b2a2 transcripts can be made as a result of alternative splicing [1, 3]. In approximately 60% of Philadelphia chromosome positive ALL patients and in some cases of CML and AML the BCR breakpoint falls within the minor breakpoint cluster region (mbcr ) that causes hybrid transcript containing an e1a2 junction, which is translated into a 190 kDa fusion protein (p190BCR-ABL) [4, 5]. In the remaining Ph positive ALL patients (40%), the breakpoint occurs in the Mbcr region [1, 6]. The micro breakpoint cluster region (μ-bcr) between BCR exon 19 and 20, result in the joining of exon 19 (e19) of bcr with a2, e19a2, coding for a 230-kDa (p230) protein has been report in rare cases of CML [7].

2. Objectives

This study was done to define the frequency BCR-ABL transcript variants among Iranian patients with different type of leukemia. This is the first report of the frequency of BCR-ABL transcript variants among ALL and AML patients from Iran.

3. Methods

This study was carried out in Pasteur Institute of Iran. The type of BCR-ABL rearrangement was studied in 348 chronic myloid leukemia (CML), 72 acute lymphoblastic leukemia (ALL) and 34 acute myeloid leukemia (AML) from 2001 to 2015. Written informed consent was obtained from all the patients or their family members. Initial diagnosis was carried out based on clinical presentation and morphological criteria of blood and bone marrow.
Peripheral blood (10 mL) in EDTA tubes was collected. Buffy coat was isolated by density gradient centrifugation on Ficol-Hypaque. Total RNA was extracted by Trizol (Invitrogen). One microgram of total RNA was reverse transcribed with random hexamer primers and Super-Script III Reverse Transcriptase (Invitrogen, Carlsbad, CA). The concentration of cDNA was determined by a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Rockland, DE) at 260 /280 nm.
The BCR/ABL transcript was amplified using multiplex RT-PCR. The primers were designed based on a previous study [8, 9], which are adapted to detect the following fusion transcripts: p190 (e1a2), p210 (b2a2, b3a2), p230 (e19a2) and p203 (b3a3, b2a3).
The following sequence of primers were used in multiplex RT-PCR for BCR-ABL fusion transcripts: C5e 5’ATAGGATCCTTTGCAACCGGGTCTGAA 3’, B2B 5’ACAGAATTCCGCTGACCATCAATAAG3’, BCR-C 5’ ACCGCATGTTCCGGGACAAAAG 3’ and CA3 5’TGTTGACTGGCGTGATGTAGTTGCTTG G3’. The multiplex RT- PCR program was 4 minutes at 95°C for initial denaturation followed by three steps, including 94°C for 30 seconds, 64°C for 50 seconds and 72°C for 50 seconds with 32 cycles later than a final 10 minutes at 73°C in the thermocycler 9700 (Applied Biosystems, Foster City, CA, USA).
In statistical analysis quantitative variables were expressed as mean ± SD, while qualitative variables were shown as percentages. Fisher’s exact test was used in comparing qualitative variables. P values lower than 0.05 were considered as statistically significant.

4. Results

The BCR-ABL transcript frequencies for CML, ALL and AML patients were 92.0%, 12.5% and 14.7% respectively for all different of transcript. The majority of CML patients with BCR-ABL positive expressed one of the p210BCR-ABL transcripts (86.6%) while the rest had other transcripts (p190BCR-ABL 25 (7.8%)) and p230BCR-ABL 2 (0.6%)) or co-expression of p210BCR-ABL and p190BCR-ABL (16 (5%)). The b3a2 and b2a2 transcripts were detected in 173 (62.5%) and 104 (37.5%) of the BCR-ABL transcript positive CML patients respectively. In 66.7% of all patients with Philadelphia chromosome positive ALL were produced the shorter isotype p190 BCR-ABL1 from the e1a2 type mRNA. Table 1 shows BCR-ABL transcript types, age, gender and WBC count data for the patients according to leukemia types.
Table 1.BCR-ABL Transcript Frequencies and Clinical Data in Iranian Leukemia Patients
DiseaseBCR-ABL PositiveaProtein Variant, kDaCaseaAge, ybGender, M/FWBC Count (109/L) in BCR-ABL PositivebWBC Count (109/L) in BCR-ABL Negativeb
CML, (n = 348)320 (92)p210277 (86.6)45.9 ± 16.9185/163303 ± 250247 ± 237
p19025 (7.8)141 ± 183
p210/p19016 (5)43 ± 46
p2302 (0.6)560
Total: 277 ± 249
ALL, (n = 72)9 (12.5)p2103 (33.3)31.8 ± 15.648/24227 ± 224193 ± 199
p1906 (66.7)
AML, (n = 34)5 (14.7)p2102 (40)39.7 ± 13.315/19349 ± 419219 ± 190
p1903 (60)

aValues are expressed as No. (%).

bValues are expressed as maen ± SD.

We didn’t find any correlation between the obtained BCR-ABL1 variants, sex type, age and WBC count of studied leukemia patients.

5. Discussion

The frequencies of BCR-ABL gene in CML patients obtained by this study is consistent with frequencies reported in related studies [1]. The transcript distribution in CML has been reported in European and some other populations with frequencies for b2a2 and b3a2 transcripts being nearly of the order of 40% and 55% [10-13], which is relatively close to the previous from Iran report [8] and our study. However, a study on an Ecuadorian population, showed very different frequencies: 5% for b3a2 and 95% for b2a2 [6]. This difference in frequencies may possibly be due to the genetic background of the populations. Moreover, it was found that CML patients at diagnosis expressed low e1a2 transcript frequency, besides the usual BCR-ABL1 p210 [14, 15] or only 5% [16], or no co-expression whatsoever in previous Iranian study [8]. In this study, co-expression of p210 and p190 in 5%, which is closed to Mexican study, was detected [16].
There are rare reports about frequency of BCR-ABL1 variants in ALL type. In 49 patients diagnosed with ALL in Ecuadorian patients, 42.8% presented BCR-ABL fusion transcript, from these; all of them presented the e1/a2 rearrangement [6]. Moreover, it is found in 10% to 20% of adults and in 2% to 5% of children which two thirds of ALLs had e1/a2 transcript in Caucasian patients [1]. In this study, the frequencies of BCR-ABL gene were 12.5% which p190BCR-ABL was predominantly associated with ALL (66.7%). This may indicate a preferential functional involvement of this form of hybrid product in metabolic pathways of the lymphoid lineage progenitors.
There were very rare reported of BCR-ABL rearrangement in AML, which is reported in this investigation for the first time [1] (Table 1).
We didn’t find correlation between BCR-ABL1 variants, sex type, age and WBC count of studied leukemia patients significantly. As a final point, the frequencies study of different BCR-ABL transcript variants involved in leukemia in ethnic groups valuable to approach for a better understanding of the causes that lead to different BCR-ABL transcript variants in different types of leukemia.

Acknowledgments

Footnotes

  • Authors’ Contribution:Mohammad Hamid, designed the study and wrote the manuscript; Hanieh Bokharaei performed the experiments and analyzed the data.

  • Conflict of Interest:No conflict of interest

References

  • 1.
    Rostami G, Hamid M, Yaran M, Khani M, Karimipoor M. Incidence and clinical importance of BCR-ABL1 mutations in Iranian patients with chronic myeloid leukemia on imatinib. J Hum Genet. 2015;60(5):253-8. [PubMed ID: 25740611]. https://doi.org/10.1038/jhg.2015.11.
  • 2.
    Luatti S, Baldazzi C, Marzocchi G, Ameli G, Bochicchio MT, Soverini S, et al. Cryptic BCR-ABL fusion gene as variant rearrangement in chronic myeloid leukemia: molecular cytogenetic characterization and influence on TKIs therapy. Oncotarget. 2017;8(18):29906-13. [PubMed ID: 28404889]. https://doi.org/10.18632/oncotarget.15369.
  • 3.
    Sugapriya D, Preethi S, Shanthi P, Chandra N, Jeyaraman G, Sachdanandam P, et al. BCR-ABL Translocation in Pediatric Acute Lymphoblastic Leukemia in Southern India. Indian J Hematol Blood Transfus. 2012;28(1):37-41. [PubMed ID: 23449388]. https://doi.org/10.1007/s12288-011-0096-9.
  • 4.
    Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2012 update on diagnosis, monitoring, and management. Am J Hematol. 2012;87(11):1037-45. [PubMed ID: 23090888]. https://doi.org/10.1002/ajh.23282.
  • 5.
    Osman EA, Hamad K, Elmula IM, Ibrahim ME. Frequencies of BCR-ABL1 fusion transcripts among Sudanese chronic myeloid leukaemia patients. Genet Mol Biol. 2010;33(2):229-31. [PubMed ID: 21637474]. https://doi.org/10.1590/S1415-47572010005000037.
  • 6.
    Bjorkholm M, Ohm L, Eloranta S, Derolf A, Hultcrantz M, Sjoberg J, et al. Success story of targeted therapy in chronic myeloid leukemia: a population-based study of patients diagnosed in Sweden from 1973 to 2008. J Clin Oncol. 2011;29(18):2514-20. [PubMed ID: 21576640]. https://doi.org/10.1200/JCO.2011.34.7146.
  • 7.
    Goh HG, Hwang JY, Kim SH, Lee YH, Kim YL, Kim DW. Comprehensive analysis of BCR-ABL transcript types in Korean CML patients using a newly developed multiplex RT-PCR. Transl Res. 2006;148(5):249-56. [PubMed ID: 17145570]. https://doi.org/10.1016/j.trsl.2006.07.002.
  • 8.
    Yaghmaie M, Ghaffari SH, Ghavamzadeh A, Alimoghaddam K, Jahani M, Mousavi SA, et al. Frequency of BCR-ABL fusion transcripts in Iranian patients with chronic myeloid leukemia. Arch Iran Med. 2008;11(3):247-51. [PubMed ID: 18426313].
  • 9.
    Burmeister T, Reinhardt R. A multiplex PCR for improved detection of typical and atypical BCR-ABL fusion transcripts. Leuk Res. 2008;32(4):579-85. [PubMed ID: 17928051]. https://doi.org/10.1016/j.leukres.2007.08.017.
  • 10.
    Ferreira DC, de Oliveira JS, Parisio K, Ramalho FM. Pericardial effusion and cardiac tamponade: clinical manifestation of chronic graft-versus-host disease after allogeneic hematopoietic stem cell transplantation. Rev Bras Hematol Hemoter. 2014;36(2):159-61. [PubMed ID: 24790543]. https://doi.org/10.5581/1516-8484.20140034.
  • 11.
    Burmeister T, Groger D, Kuhn A, Hoelzer D, Thiel E, Reinhardt R. Fine structure of translocation breakpoints within the major breakpoint region in BCR-ABL1-positive leukemias. DNA Repair (Amst). 2011;10(11):1131-7. [PubMed ID: 21944569]. https://doi.org/10.1016/j.dnarep.2011.08.010.
  • 12.
    Bennour A, Ouahchi I, Achour B, Zaier M, Youssef YB, Khelif A, et al. Analysis of the clinico-hematological relevance of the breakpoint location within M-BCR in chronic myeloid leukemia. Med Oncol. 2013;30(1):348. [PubMed ID: 23269583]. https://doi.org/10.1007/s12032-012-0348-z.
  • 13.
    Park KJ, Woo YM, Kim K, Lee ST, Ki CS, Kim HJ, et al. Clinical application of catalytically cleavable fluorescence probe technology for multiplexing quantification of BCR-ABL1 fusion transcripts. Clin Chim Acta. 2013. [PubMed ID: 24513328]. https://doi.org/10.1016/j.cca.2013.10.016.
  • 14.
    Scrideli CA, de Oliveira FM, Brassesco MS, de Paula Queiroz R, Bernardes JE, Valera ET, et al. Is p190 bcr-abl rearrangement necessary for acute transformation in some p210 CML of childhood? Leuk Res. 2009;33(3):495-9. [PubMed ID: 18495245]. https://doi.org/10.1016/j.leukres.2008.04.007.
  • 15.
    Han JY, Theil KS. The Philadelphia chromosome as a secondary abnormality in inv(3)(q21q26) acute myeloid leukemia at diagnosis: confirmation of p190 BCR-ABL mRNA by real-time quantitative polymerase chain reaction. Cancer Genet Cytogenet. 2006;165(1):70-4. [PubMed ID: 16490599]. https://doi.org/10.1016/j.cancergencyto.2005.07.015.
  • 16.
    Uchida N, Hanawa H, Dan K, Inokuchi K, Shimada T. Leukemogenesis of b2a2-type p210 BCR/ABL in a bone marrow transplantation mouse model using a lentiviral vector. J Nippon Med Sch. 2009;76(3):134-47. [PubMed ID: 19602820]. https://doi.org/10.1272/jnms.76.134.

Copyright

Copyright © 2017, Zahedan Journal of Research in Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

27
May
2015

Characterizing of Four Common BCR-ABL Kinase Domain Mutations (T315I, Y253H, M351T and E255K) in Iranian Chronic Myelogenous Leukemia Patients With Imatinib Resistance

Leili Rejali,
Behzad Poopak,
Mandana Hasanzad,
Fatemeh Sheikhsofla,
Ameneh Saadat Varnoosfaderani,
Nazila Safari
,et al.

Rejali L, Poopak B, Hasanzad M, Sheikhsofla F, Varnoosfaderani AS, et al. Characterizing of Four Common BCR-ABL Kinase Domain Mutations (T315I, Y253H, M351T and E255K) in Iranian Chronic Myelogenous Leukemia Patients With Imatinib Resistance. Int J Cancer Manag. 2015;8(3):e2334. doi: https://doi.org/10.17795/ijcp2334

10
Dec
2013

Prevalence of ETV6/RUNX1 Fusion Gene in Pediatric Patients with Acute Lymphoblastic Leukemia in Iran

Ahmad-Reza Rahnemoon,
Farhad Zaker,
Mina Izadyar,
Shahla Ansari,
Behzad Poopak,
Yuri Tadavosyan

Rahnemoon A, Zaker F, Izadyar M, Ansari S, Poopak B, et al. Prevalence of ETV6/RUNX1 Fusion Gene in Pediatric Patients with Acute Lymphoblastic Leukemia in Iran. Inn J Pediatr. 2013;23(6):. doi:

1
Oct
2009

Investigation of TEL/AML1 and BCR/ABL genes fusion in Acute lymphoblastic leukemia (ALL) Patients and Follow-up Study in 25 Bone Marrow Transplanted (BMT) Patients Using Interphase Fluorescence In Situ Hybridization (FISH).

SA Rahmani,
P Mehdipour,
F Aboualsoltani,
M Izadyar,
M Zamani,
AM Aghazadeh

Rahmani S, Mehdipour P, Aboualsoltani F, Izadyar M, Zamani M, et al. Investigation of TEL/AML1 and BCR/ABL genes fusion in Acute lymphoblastic leukemia (ALL) Patients and Follow-up Study in 25 Bone Marrow Transplanted (BMT) Patients Using Interphase Fluorescence In Situ Hybridization (FISH).. Shiraz E-Med J. 2009;10(4):. doi:

29
May
2018
RETRACTED ARTICLE: <i>E2A/PBX1</i>, <i>MLL/AF4</i>, <i>BCR/ABL (M-BCR)</i>, <i>BCR/ABL(m-BCR)</i> Gene Rearrangements in Acute Lymphoblastic Leukemia in Iranian Children

RETRACTED ARTICLE: E2A/PBX1, MLL/AF4, BCR/ABL (M-BCR), BCR/ABL(m-BCR) Gene Rearrangements in Acute Lymphoblastic Leukemia in Iranian Children

Ahmad Reza Rahnemoon,
Leila Koochakzadeh,
Shahla Ansari,
Anna Boyajyan,
Arsen Arakelyan

Rahnemoon AR, Koochakzadeh L, Ansari S, Boyajyan A, Arakelyan A. RETRACTED ARTICLE: E2A/PBX1, MLL/AF4, BCR/ABL (M-BCR), BCR/ABL(m-BCR) Gene Rearrangements in Acute Lymphoblastic Leukemia in Iranian Children. Inn J Pediatr. 2018;28(3):e5371. doi: https://doi.org/10.5812/ijp.5371

22
Feb
2016

New Developments in Chronic Myeloid Leukemia: Implications for Therapy

Sanaz Tabarestani,
Abolfazl Movafagh

Tabarestani S, Movafagh A. New Developments in Chronic Myeloid Leukemia: Implications for Therapy. Int J Cancer Manag. 2016;9(1):e3961. doi: https://doi.org/10.17795/ijcp-3961

Download PDF106.91 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles