Zahedan J Res Med Sci

Image Credit:Zahedan J Res Med Sci

 Identification of Two Siblings with PMM2-Congenital Disorder of Glycosylation Using Exome Sequencing in South East of Iran: Clinical and Genetic Findings

Author(s):
Atefeh MirAtefeh Mir1, Ali KhajehAli Khajeh2, Yongjun SongYongjun Song3, Hane LeeHane Lee3, Mohammad Amin TabatabaifarMohammad Amin TabatabaifarMohammad Amin Tabatabaifar ORCID4,*
1Genetics of Non-Communicable Disease Research Center, Zahedan University of Medical Sciences, Zahedan, Iran
2Children and Adolescence Research Center, Zahedan University of Medical Sciences, Zahedan, Iran
3Division of Medical Genetics, 3billion Company, Seoul, South Korea
4Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran

Zahedan Journal of Research in Medical Sciences:Vol. 28, issue 2; e167519
Published online:Dec 15, 2025
Article type:Research Article
Received:Oct 28, 2025
Accepted:Nov 11, 2025
How to Cite:Mir A, Khajeh A, Song Y, Lee H, Tabatabaifar MA.  Identification of Two Siblings with PMM2-Congenital Disorder of Glycosylation Using Exome Sequencing in South East of Iran: Clinical and Genetic Findings. Zahedan J Res Med Sci. 2026;28(2):e167519. doi: https://doi.org/10.5812/zjrms-167519

Abstract

Background:

Congenital disorders of glycosylation (CDG) encompass a broad spectrum of rare inborn errors of metabolism (IEMs), resulting in defective glycosylation of various proteins and/or lipids. PMM2-CDG is the most prevalent subtype of CDG, characterized by gene mutations leading to deficiency of the phosphomannomutase 2 (PMM2) enzyme. This research identified two Iranian patients from a consanguineous family with multiple organ dysfunctions, diagnosed with PMM2-CDG due to a pathogenic variant in the PMM2 gene. The study underscores the importance of identifying specific variants in different ethnic groups for effective genetic counseling for this disorder.

Methods:

The study utilized exome sequencing (ES) to identify pathogenic variants. Verification of the potential variant in affected siblings, along with segregation analysis involving the parents, affected individuals, and healthy siblings of the family, was performed using Sanger sequencing. Interpretation of the variant was informed by multiple in silico analysis tools, as well as by adhering to the guidelines set forth by the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP).

Results:

 In the genomic investigations of the two brothers with intellectual disability (ID) and progressive movement disability, the NM_000303.3:c.647A > T (NP_000294.1:p.Asn216Ile) homozygous variant in the PMM2 gene was identified. The variant was confirmed in the affected and other family members by segregation analysis. Multiple in silico tools supported the pathogenic classification of the identified variant.

Conclusions:

The findings provide broader insight into variants within the PMM2 gene and offer a thorough characterization of the phenotype related to this specific variant. The data have important applications for genetic diagnosis and counseling in relevant clinical contexts, as well as for identifying common gene variants associated with various ethnic groups. Additionally, this information could serve as a valuable resource in guiding therapeutic interventions.

1. Background

Congenital disorders of glycosylation (CDG) are a large class of rare inborn errors of metabolism (IEMs) in which glycosylation of a variety of tissue proteins and/or lipids is deficient. They are also recognized as carbohydrate-deficient glycoprotein syndromes (CDG syndromes). CDG can cause often severe and sometimes fatal dysfunctions of several different organ systems, particularly the nervous system, muscles, and intestines in affected infants (1). Jaeken et al. first described CDG in 1980 (2). These disorders are classified according to the incorrect glycosylation of biomolecules, including proteins, lipids, or glycosylphosphatidylinositol. Therefore, subdivisions of CDG are as follows: (A) Disorders related to protein N-glycosylation (type I and II), (B) Disorders associated with protein O-glycosylation, (C) Disorders pertaining to glycosphingolipid and GPI-anchor glycosylation, and (D) Disorders affecting multiple glycosylation and other pathways.
Protein glycosylation occurs in two main ways: N-glycosylation involves the assembly of glycans in the endoplasmic reticulum membrane and their subsequent attachment to the nitrogen (N-) group of asparagine residues, while O-glycosylation involves the attachment of sugars to the hydroxyl (O-) groups of serine or threonine. Disorders of N-glycosylation are widely recognized as the most prevalent types of CDG. These can be categorized into two subtypes: (A) defects of oligosaccharide assembly and transfer, and (B) defects in oligosaccharide trimming and processing that occur after they are bound to proteins (3). Over 160 various types of CDG have been discovered so far (1).
Recently, Jaeken et al. developed a classification pattern for naming types of CDG. This pattern involves using the official abbreviation of the abnormal gene followed by a dash and CDG to name each type of CDG (4, 5), such as PMM2-CDG, which is formally known as CDG-Ia, the most common subtype of CDG, in which the PMM2 gene defect causes loss of phosphomannomutase 2 (PMM2) enzyme that is responsible for the conversion of mannose-6-phosphate into mannose-1-phosphate (6). The majority of CDG exhibit autosomal recessive inheritance patterns and are known for their wide-ranging multisystem impact. This can include developmental disabilities, hypotonia with involvement of multiple organ systems, as well as symptoms such as hypoglycemia and protein-losing enteropathy (7, 8).
CDG are attributed to a deficiency or absence of specific enzymes or proteins crucial for synthesizing glycans, as well as their interactions with other proteins or lipids during glycosylation. The process of glycosylation is extensive and intricate, involving the modification of numerous proteins. This process engages hundreds of distinct genes and specific enzymes (3). Typical symptoms may indicate recognition of a CDG, a comprehensive patient history, and a thorough clinical assessment. Several specialized tests may be required to confirm a CDG diagnosis and identify the specific subtype. Due to the wide-ranging clinical manifestations observed in CDG patients, it is advised to thoroughly explore and eliminate any unexplained syndromes that involve multiple bodily systems (9). Exome sequencing (ES) is rapidly becoming an early test of an individual’s DNA when physicians suspect a genetic abnormality (3).
In the current study, two patients with multiple organ dysfunctions belonging to an Iranian consanguineous family were identified as PMM2-CDG. The study identified a pathogenic variant in the Sistan and Balouchestan province of Iran (Balouch ethnicity). It is essential to recognize pathogenic variants across various ethnicities to ensure effective genetic counseling for affected families.

2. Methods

2.1. Family Recruitment and DNA Extraction

The study was approved by the Ethics Committee of Isfahan University of Medical Sciences, Isfahan, Iran (IR.MUI.MED.REC.1400.042). Two siblings exhibiting severe intellectual disabilities were identified from a consanguineous family residing in the Sistan and Balouchestan province of Iran, belonging to the Balouch ethnic group. Genetic counseling was provided, and family pedigrees were constructed utilizing the Progeny Software. A detailed medical history was acquired, and informed written consent was obtained from the legal guardian prior to the collection of peripheral blood samples. DNA extraction was performed using the DNSol Miniprep Kit from ROJETECHNOLOGIES, Tehran, Iran.

2.2. Molecular Investigations

Exome sequencing was conducted utilizing the NovaSeq 6000 platform (Illumina, San Diego, CA, USA) by the 3billion Inc. research team in Seoul, South Korea. This advanced sequencing technology facilitated the generation of high-quality sequence data, which were subsequently aligned to the Genome Reference Consortium Human Build 37 (GRCh37) and the revised Cambridge Reference Sequence (rCRS) of the mitochondrial genome. The alignment process ensured that the sequenced bases were accurately mapped to the reference genomes, thereby allowing for a comprehensive analysis of genetic variants present in the exome. All variants were analyzed using the EVIDENCE software for interpretation (10) and prioritization. This analysis followed the guidelines established by the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP), ensuring a standardized and rigorous approach to the interpretation of genetic variants (11). During the process of genetic counseling, relevant family history and prior clinical assessments were thoroughly reviewed, and clinically significant variants pertinent to the patient's primary clinical conditions were duly considered.
The suspected genetic variant was confirmed by Sanger sequencing, and co-segregation analysis was conducted on both affected and unaffected family members. Specific primers for the variant were designed with the Primer3 online tool (Primer3web, version 4.1.0) and validated through additional online tools, including Primer-BLAST (12) and MFEprimer3.1 (13). The primer sequences used in this study are provided in Table 1.
Table 1.The Primers Used to Confirm the Pathogenic Variant by Sanger Sequencing and Co-Segregation Analysis.
Primer NameSequence (5’→3’)Product Size
F-PMM2TCCAGGGTCACATCAGCAAT470 bp
R-PMM2GCCAAAACTACATGATTGCACG

2.3. In Silico Analysis

We utilized the Phyre2 Web Server to model the three-dimensional (3D) structure of the proteins and selected the highest quality model for subsequent analysis. Visualization, mutagenesis, and structural analysis were performed using PyMOL software (Version 2.2.3, Schrodinger, LLC.). Population allele frequency analysis was conducted using the Genome Aggregation Database (gnomAD v2.1.1). The variants' potential pathogenicity was evaluated by utilizing the following prediction tools: FATHMM and FATHMM-MKL (Functional Analysis through Hidden Markov Models, v2.3), LIST-S2, M-CAP (Mendelian Clinically Applicable Pathogenicity), Mutation Assessor, MutPred, PROVEAN (PROVEAN scores, v1.1), SIFT (Scale-Invariant Feature Transform) and SIFT4G, EIGEN and EIGENPC, BayesDel (addAF and noAF), MetaLR (e!Ensembl), MetaRNN, REVEL (Rare Exome Variant Ensemble Learner, e! Ensembl), DEOGEN2, and MetaSVM_score (the support vector machine (SVM) based on ensemble prediction score).

3. Results

3.1. Clinical Findings

The proband (Figure 1) is an 18-year-old boy with severe intellectual disability (ID) and progressive movement disability. He experienced developmental delay (DD) and speech problems. He presents with a progressive movement disability and ataxia and cannot stand without assistance. He has facial features reminiscent of fragile X syndrome, including a long, thin face, prominent ears, prominent lips, and a broad nasal tip. He was previously molecularly tested for fragile X syndrome using Southern blot analysis, which resulted in a normal number (“28”) of CGG trinucleotide repeats in the FMR1 gene. His cytogenetic karyotyping showed a normal set of chromosomes, as 46, XY, consistent with an apparently normal male.
Brain magnetic resonance imaging (MRI) revealed normal size of cerebral ventricles and sulci, normal signal intensity of the cortex and white matter, no abnormality in the basal ganglia, internal capsule, corpus callosum, and thalamus, average signal intensity of brainstem and cerebellum, normal sella and pituitary, normal cerebellopontine angle area on each side, standard width of the internal acoustic meatus, normal development and pneumatization in paranasal sinuses and mastoid air cells, unremarkable orbital contents, and parasellar structures.
He has a younger brother, aged nine, with similar conditions, suffering from ID, DD, progressive movement disability, ataxia, and inability to stand or walk. They are the children of consanguineous parents. There is a family history of ID, movement disorder, seizure, ataxia, and abortions in the pedigree (Figure 1).
The pedigree of the studied family. An arrow points to the proband, and other affected members are shown with their apparent symptoms. Red: Intellectual Disability (ID), Blue: Movement Disorder, Green: Seizures, Yellow: Ataxia.
Figure 1.

The pedigree of the studied family. An arrow points to the proband, and other affected members are shown with their apparent symptoms. Red: Intellectual Disability (ID), Blue: Movement Disorder, Green: Seizures, Yellow: Ataxia.

3.2. Molecular and In Silico Findings

Exome sequencing identified a deleterious homozygous variant in NM_000303.3 (PMM2):c.647A>T related to CDG disorders. The suspected genetic variant was confirmed by Sanger sequencing (Figure 2), and co-segregation analysis was conducted. Table 2 lists the in silico findings regarding the identified variant. Based on ACMG and AMP (11) guidelines for variant interpretation, the identified variant meets the PP5, PM5, PP3, PM1, PM2, and PP1 criteria and has therefore been classified as a pathogenic variant.
Electropherograms of the involved sequences of the identified variant. Parents were heterozygotes for the identified variant, and two affected siblings showed homozygosity, confirming the variant in the family.
Figure 2.

Electropherograms of the involved sequences of the identified variant. Parents were heterozygotes for the identified variant, and two affected siblings showed homozygosity, confirming the variant in the family.

Table 2. Genomic and Bioinformatic Results of the Identified Pathogenic Gene/Variant
GenePMM2
Variant genomic position   16-8941588-A-T (GRCh37)
Variant cDNA positionNM_000303.3:c.647A>T
Variant protein changeNP_000294.1:p.Asn216Ile
Zygosity          Homozygous
Type of mutation    Missense
Allele frequency in gnomAD exome  Not applicable
Allele frequency in gnomAD genomeNot applicable
Bioinformatics tools showing damaging resultsMetaLR, MetaRNN, BayesDel addAF, BayesDel noAF, MetaSVM, REVEL, DEOGEN2, MutPred, EIGEN, FATHMM, LIST-S2, M-CAP, Mutation Assessor, PROVEAN, EIGEN PC, FATHMM-MKL, LRT, SIFT, SIFT4G
A structural modeling study showed that the p.Asn216Ile mutation causes the loss of hydrogen bonds between asparagine 216 and lysine 189, which may affect the protein's structure and function (Figure 3).
Structure modeling of the identified variant. It shows that p.Asn216Ile causes the loss of hydrogen bonds between asparagine 216 and lysine 189, leading to abnormality in the protein's structure and function.
Figure 3.

Structure modeling of the identified variant. It shows that p.Asn216Ile causes the loss of hydrogen bonds between asparagine 216 and lysine 189, leading to abnormality in the protein's structure and function.

4. Discussion

Various disorders and symptoms are included in CDG, and the severity and prognosis vary significantly based on the specific type of CDG, even among individuals with the same type or within the same family. Additionally, most CDG types have only been identified in a small number of individuals, making it difficult for clinicians to develop a comprehensive understanding of the related symptoms and long-term outlook. These conditions generally become apparent during infancy (7).
This study identified a causative variant in the PMM2 gene related to PMM2-CDG in two siblings from a consanguineous family. The PMM2 gene encodes an enzyme called PMM2, which is involved in glycosylation and attaches groups of oligosaccharides to proteins. The process of glycosylation enhances the functional diversity of proteins. Mutations in the PMM2 gene lead to the production of an aberrant PMM2 enzyme with decreased activity, causing the generation of improper oligosaccharides that are attached to proteins. PMM2-CDG manifests a wide array of signs and symptoms, including but not limited to developmental delays, seizures, failure to thrive, and various organ dysfunctions. This diverse clinical presentation is believed to be attributable to the abnormal glycosylation of proteins, affecting multiple organs and tissues throughout the body (6).
Over 100 pathogenic gene variants have been documented to be associated with PMM2-CDG worldwide. About 80% of these variants are missense mutations, according to the Human Gene Mutation Database (HGMD). The R141H variant is noteworthy due to its high prevalence among PMM2-CDG patients globally. In contrast, other mutations, such as D65Y, are restricted to specific ethnic or geographical populations, being found exclusively in individuals of Iberian ancestry (14), and 26G>A (five alleles) and 548T>C (seven alleles) variants, which were found only in Scandinavian families (15). As in other Caucasian populations, p.R141H was the most frequent mutation (16). The identified variant (NM_000303.3:c.647A>T (NP_000294.1:p.Asn216Ile)) is located on exon 8 of 8 (the longest exon) of the PMM2 gene in the homozygous state (17). It was previously reported in 1997 by Matthijs et al. (18) as a compound heterozygous variant leading to CDG. Bjursell et al. also reported another pathogenic alternative variant in the same codon, causing different amino acid residues related to CDG (15).
PMM2-CDG, the most prevalent type of congenital disorder of glycosylation, has over 1000 cases reported worldwide (19). Patients diagnosed with this condition exhibit a diverse constellation of clinical symptoms, which can vary significantly in presentation and severity. These symptoms often encompass a range of physiological and developmental challenges, reflecting the complex nature of the disorder. Mutations in the PMM2 gene can give rise to a spectrum of phenotypes that range from mild to severe. In some cases, these mutations may lead to critical complications that result in neonatal death (20). In almost all patients, the nervous system is impacted (21), with symptoms ranging from an inability to walk to a lack of speech, poor comprehension, autistic features, and mild ID (22). PMM2-CDG is associated with a range of clinical manifestations, including failure to thrive, gastrointestinal symptoms, hypotonia, developmental delay, cerebellar atrophy, epilepsy, strabismus, and other movement disorders. Patients may also experience liver disease and coagulopathy, pericardial effusion, endocrinological manifestations such as hypothyroidism and hypogonadotropic hypogonadism, as well as complications such as osteopenia and lipodystrophy (22). Severe forms of PMM2-CDG can be fatal in the first years of life, with a global mortality rate of up to 20% during this period (22).
In 2003, Neumann et al. (23) reported the first case of homozygosity for the 647A>T (N216I) variant of the PMM2 gene with CDG who developed postnatal macrosomia with an increase in weight, length, and occipitofrontal circumference (OFC) above the 95th percentile within his first year of life. In contrast to other CDG patients, the child did not have abnormal fat pads or inverted nipples, but unusual eyebrows were present (23). The currently studied patients, who are products of consanguineous marriage, exhibit severe ID with progressive movement disability, developmental delay, speech problems, ataxia, and strabismus. These symptoms are consistent with previous studies (24-27); they did not have a history of macrosomia, but some facial features, including a long thin face, prominent ears, prominent lips, and a broad nasal tip, which were not noted previously, have been presented.

4.1. Conclusions

The findings provide broader insight into variants within the PMM2 gene and offer a thorough characterization of the phenotype related to this specific variant. The data have important applications for genetic diagnosis and counseling in relevant clinical contexts, as well as for identifying common gene variants associated with various ethnic groups. Additionally, this information could serve as a valuable resource in guiding therapeutic interventions.

Acknowledgments

Footnotes

References

  • 1.
    Terrapon N, Henrissat B, Aoki-Kinoshita KF, Surolia A, Stanley P. A Genomic View of Glycobiology. In: Varki A, Cummings RD, Esko JD, Stanley P, Hart GW, Aebi M, et al., editors. Essentials of Glycobiology. 4th ed. New York, USA: Cold Spring Harbor; 2022. p. 93-102. eng. https://doi.org/10.1101/glycobiology.4e.8.
  • 2.
    Jaeken J, Vanderschueren-Lodeweyckx M, Casaer P, Snoeck L, Corbeel L, Eggermont E, et al. Familial psychomotor retardation with markedly fluctuating serum prolactin, FSH and GH levels, partial TBG-deficiency, increased serum arylsulphatase A and increased CSF protein: a new syndrome?: 90. Pediatric Research. 1980;14(2):179. https://doi.org/10.1203/00006450-198002000-00117.
  • 3.
    Peanne R, de Lonlay P, Foulquier F, Kornak U, Lefeber DJ, Morava E, et al. Congenital disorders of glycosylation (CDG): Quo vadis? Eur J Med Genet. 2018;61(11):643-63. [PubMed ID: 29079546]. https://doi.org/10.1016/j.ejmg.2017.10.012.
  • 4.
    Jaeken J, Hennet T, Matthijs G, Freeze HH. CDG nomenclature: time for a change!. Biochim Biophys Acta. 2009;1792(9):825-6. [PubMed ID: 19765534]. [PubMed Central ID: PMC3917312]. https://doi.org/10.1016/j.bbadis.2009.08.005.
  • 5.
    Jaeken J. Congenital disorders of glycosylation. Ann N Y Acad Sci. 2010;1214(1):190-8. [PubMed ID: 21175687]. https://doi.org/10.1111/j.1749-6632.2010.05840.x.
  • 6.
    Sparks SE, Krasnewich DM. Adam MP, Bick S, Mirzaa GM, Pagon RA, Wallace SE, Amemiya A, editors. Congenital Disorders of N-Linked Glycosylation and Multiple Pathway Overview. Seattle, USA: University of Washington; 1993. eng.
  • 7.
    Freeze HH, Eklund EA, Ng BG, Patterson MC. Neurological aspects of human glycosylation disorders. Annu Rev Neurosci. 2015;38:105-25. [PubMed ID: 25840006]. [PubMed Central ID: PMC4809143]. https://doi.org/10.1146/annurev-neuro-071714-034019.
  • 8.
    Freeze HH, Eklund EA, Ng BG, Patterson MC. Neurology of inherited glycosylation disorders. Lancet Neurol. 2012;11(5):453-66. [PubMed ID: 22516080]. [PubMed Central ID: PMC3625645]. https://doi.org/10.1016/S1474-4422(12)70040-6.
  • 9.
    Rind N, Schmeiser V, Thiel C, Absmanner B, Lubbehusen J, Hocks J, et al. A severe human metabolic disease caused by deficiency of the endoplasmatic mannosyltransferase hALG11 leads to congenital disorder of glycosylation-Ip. Hum Mol Genet. 2010;19(8):1413-24. [PubMed ID: 20080937]. https://doi.org/10.1093/hmg/ddq016.
  • 10.
    Seo GH, Kim T, Choi IH, Park JY, Lee J, Kim S, et al. Diagnostic yield and clinical utility of whole exome sequencing using an automated variant prioritization system, EVIDENCE. Clin Genet. 2020;98(6):562-70. [PubMed ID: 32901917]. [PubMed Central ID: PMC7756481]. https://doi.org/10.1111/cge.13848.
  • 11.
    Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405-24. [PubMed ID: 25741868]. [PubMed Central ID: PMC4544753]. https://doi.org/10.1038/gim.2015.30.
  • 12.
    Ye C, Ma ZS, Cannon CH, Pop M, Yu DW. Exploiting sparseness in de novo genome assembly. BMC Bioinformatics. 2012;13(1). S1. [PubMed ID: 22537038]. [PubMed Central ID: PMC3369186]. https://doi.org/10.1186/1471-2105-13-S6-S1.
  • 13.
    Wang K, Li H, Xu Y, Shao Q, Yi J, Wang R, et al. MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Res. 2019;47(W1):W610-3. [PubMed ID: 31066442]. [PubMed Central ID: PMC6602485]. https://doi.org/10.1093/nar/gkz351.
  • 14.
    Quelhas D, Quental R, Vilarinho L, Amorim A, Azevedo L. Congenital disorder of glycosylation type Ia: searching for the origin of common mutations in PMM2. Ann Hum Genet. 2007;71(Pt 3):348-53. [PubMed ID: 17166182]. https://doi.org/10.1111/j.1469-1809.2006.00334.x.
  • 15.
    Bjursell C, Erlandson A, Nordling M, Nilsson S, Wahlstrom J, Stibler H, et al. PMM2 mutation spectrum, including 10 novel mutations, in a large CDG type 1A family material with a focus on Scandinavian families. Hum Mutat. 2000;16(5):395-400. [PubMed ID: 11058896]. https://doi.org/10.1002/1098-1004(200011)16:5<395::AID-HUMU3>3.0.CO;2-T.
  • 16.
    Perez B, Briones P, Quelhas D, Artuch R, Vega AI, Quintana E, et al. The molecular landscape of phosphomannose mutase deficiency in iberian peninsula: identification of 15 population-specific mutations. JIMD Rep. 2011;1:117-23. [PubMed ID: 23430838]. [PubMed Central ID: PMC3509825]. https://doi.org/10.1007/8904_2011_26.
  • 17.
    Ensembl Project; Ensembl Project. Exons for transcript ENST00000268261 (PMM2-001) in Homo sapiens (GRCh37). Cambridge, UK: Ensembl GRCh37 Archive; 2025. Available from: https://grch37.ensembl.org/Homo_sapiens/Transcript/Exons?db=core;g=ENSG00000140650;r=16:8882680-8943188;t=ENST00000268261.
  • 18.
    Matthijs G, Schollen E, Pardon E, Veiga-Da-Cunha M, Jaeken J, Cassiman JJ, et al. Mutations in PMM2, a phosphomannomutase gene on chromosome 16p13, in carbohydrate-deficient glycoprotein type I syndrome (Jaeken syndrome). Nat Genet. 1997;16(1):88-92. [PubMed ID: 9140401]. https://doi.org/10.1038/ng0597-88.
  • 19.
    Verheijen J, Tahata S, Kozicz T, Witters P, Morava E. Therapeutic approaches in Congenital Disorders of Glycosylation (CDG) involving N-linked glycosylation: an update. Genet Med. 2020;22(2):268-79. [PubMed ID: 31534212]. [PubMed Central ID: PMC8720509]. https://doi.org/10.1038/s41436-019-0647-2.
  • 20.
    Alton G, Kjaergaard S, Etchison JR, Skovby F, Freeze HH. Oral ingestion of mannose elevates blood mannose levels: a first step toward a potential therapy for carbohydrate-deficient glycoprotein syndrome type I. Biochem Mol Med. 1997;60(2):127-33. [PubMed ID: 9169093]. https://doi.org/10.1006/bmme.1997.2574.
  • 21.
    Gao N, Shang J, Lehrman MA. Analysis of glycosylation in CDG-Ia fibroblasts by fluorophore-assisted carbohydrate electrophoresis: implications for extracellular glucose and intracellular mannose 6-phosphate. J Biol Chem. 2005;280(18):17901-9. [PubMed ID: 15708848]. [PubMed Central ID: PMC1282451]. https://doi.org/10.1074/jbc.M500510200.
  • 22.
    Gamez A, Serrano M, Gallego D, Vilas A, Perez B. New and potential strategies for the treatment of PMM2-CDG. Biochim Biophys Acta Gen Subj. 2020;1864(11):129686. [PubMed ID: 32712172]. https://doi.org/10.1016/j.bbagen.2020.129686.
  • 23.
    Neumann LM, von Moers A, Kunze J, Blankenstein O, Marquardt T. Congenital disorder of glycosylation type 1a in a macrosomic 16-month-old boy with an atypical phenotype and homozygosity of the N216I mutation. Eur J Pediatr. 2003;162(10):710-3. [PubMed ID: 12905014]. https://doi.org/10.1007/s00431-003-1278-8.
  • 24.
    de Lonlay P, Seta N, Barrot S, Chabrol B, Drouin V, Gabriel BM, et al. A broad spectrum of clinical presentations in congenital disorders of glycosylation I: a series of 26 cases. J Med Genet. 2001;38(1):14-9. [PubMed ID: 11134235]. [PubMed Central ID: PMC1734729]. https://doi.org/10.1136/jmg.38.1.14.
  • 25.
    Grunewald S. The clinical spectrum of phosphomannomutase 2 deficiency (CDG-Ia). Biochim Biophys Acta. 2009;1792(9):827-34. [PubMed ID: 19272306]. https://doi.org/10.1016/j.bbadis.2009.01.003.
  • 26.
    Monin ML, Mignot C, De Lonlay P, Heron B, Masurel A, Mathieu-Dramard M, et al. 29 French adult patients with PMM2-congenital disorder of glycosylation: outcome of the classical pediatric phenotype and depiction of a late-onset phenotype. Orphanet J Rare Dis. 2014;9:207. [PubMed ID: 25497157]. [PubMed Central ID: PMC4266234]. https://doi.org/10.1186/s13023-014-0207-4.
  • 27.
    Altassan R, Peanne R, Jaeken J, Barone R, Bidet M, Borgel D, et al. International clinical guidelines for the management of phosphomannomutase 2-congenital disorders of glycosylation: Diagnosis, treatment and follow up. J Inherit Metab Dis. 2019;42(1):5-28. [PubMed ID: 30740725]. https://doi.org/10.1002/jimd.12024.

Similar Articles

31
Mar
2020

Pathological Variants of Aminoacyl-tRNA-synthetase-Interacting Multifunctional Protein 1 Gene in an Iranian Consanguineous Family With Autosomal Recessive Intellectual Disability

Sara Cheraghee,
Sahar Moghbelinejad,
Reza Najafipour

Cheraghee S, Moghbelinejad S, Najafipour R. Pathological Variants of Aminoacyl-tRNA-synthetase-Interacting Multifunctional Protein 1 Gene in an Iranian Consanguineous Family With Autosomal Recessive Intellectual Disability. J Inflamm Dis. 2024;23(6):e156189. doi:

8
Aug
2021
Zahedan J Res Med Sci

Mutational Analysis of Mucopolysaccharidosis in Iranian Patients

Seyed Hoseinali Saberi,
Shahla Farshidi,
Behnam Kamalidehghan,
Roshanak Jazayeri,
Massoud Houshmand

Saberi SH, Farshidi S, Kamalidehghan B, Jazayeri R, Houshmand M. Mutational Analysis of Mucopolysaccharidosis in Iranian Patients. Zahedan J Res Med Sci. 2021;23(3):e104794. doi: https://doi.org/10.5812/zjrms.104794

19
Jun
2023
Gene Cell Tissue

Exome Sequencing Identifies a Novel SGCA Gene Mutation in an Iranian Family with Limb Girdle Muscular Dystrophy: A Case Report

Safieh Khajeh,
Javad Mohammadi Asl,
Hashem Kazemi,
Mostafa Neissi,
Zahra Khoshnood

Khajeh S, Mohammadi Asl J, Kazemi H, Neissi M, Khoshnood Z. Exome Sequencing Identifies a Novel SGCA Gene Mutation in an Iranian Family with Limb Girdle Muscular Dystrophy: A Case Report. Gene Cell Tissue. 2023;10(4):e135317. doi: https://doi.org/10.5812/gct-135317

26
Dec
2018
Novel Insight Into Intellectual Disability; A Review Article

Novel Insight Into Intellectual Disability; A Review Article

Negin Parsamanesh,
Ebrahim Miri-Moghaddam

Parsamanesh N, Miri-Moghaddam E. Novel Insight Into Intellectual Disability; A Review Article. Gene Cell Tissue. 2018;5(4):e84401. doi: https://doi.org/10.5812/gct.84401

31
Aug
2021
Gene Cell Tissue

Role of DYSF Genetic Variant in Limb Girdle Muscular Dystrophy: A Case Report

Hadis Malek,
Khadijeh Shahrokhabadi,
Saeid Ghavami,
Mohsen Taheri,
Ehsan Ghayoor Karimiani

Malek H, Shahrokhabadi K, Ghavami S, Taheri M, Ghayoor Karimiani E. Role of DYSF Genetic Variant in Limb Girdle Muscular Dystrophy: A Case Report. Gene Cell Tissue. 2022;9(1):e115993. doi: https://doi.org/10.5812/gct.115993


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles