Arch Clin Infect Dis

Image Credit:Arch Clin Infect Dis

Characterization of Staphylococcus aureus Nasal Carriage Among Healthcare Providers in an Intensive Care Unit: Insights into Antibiotic Resistance Profiles and Virulence Gene Distribution

Author(s):
Javad MoazenJavad MoazenJavad Moazen ORCID1, 2, Fatemeh Riyahi ZanianiFatemeh Riyahi ZanianiFatemeh Riyahi Zaniani ORCID1, 2,*, Reihane RajeReihane Raje2
1Infectious and Tropical Diseases Research Center, Dezful University of Medical Sciences, Dezful, Iran
2School of Medicine, Dezful University of Medical Sciences, Dezful, Iran

Archives of Clinical Infectious Diseases:Vol. 18, issue 6; e137545
Published online:Dec 24, 2023
Article type:Research Article
Received:May 10, 2023
Accepted:Dec 03, 2023
How to Cite:Moazen J, Riyahi Zaniani F, Raje R. Characterization of Staphylococcus aureus Nasal Carriage Among Healthcare Providers in an Intensive Care Unit: Insights into Antibiotic Resistance Profiles and Virulence Gene Distribution. Arch Clin Infect Dis. 2023;18(6):e137545. doi: https://doi.org/10.5812/archcid-137545

Abstract

Background:

Staphylococcus aureus ranks among the leading causes of serious nosocomial infections. One critical route for the spread of this bacterium within hospitals is via asymptomatic carriers, particularly healthcare providers. Staphylococcus aureus can exist as part of the normal skin flora and within the anterior nostrils of individuals, making healthcare providers a significant vector for transmission. Several genes associated with virulence, such as toxic shock syndrome toxin-1 (tsst-1), alpha-toxin (hla), and panton-valentine leucocidin (pvl), play pivotal roles in the pathogenicity and severity of infections caused by S. aureus.

Objectives:

This study aimed to characterize S. aureus nasal carriage among healthcare providers in an intensive care unit (ICU), with a particular focus on antibiotic resistance profiles and the prevalence of virulence genes.

Methods:

Nasal swabs were collected from 120 healthcare workers in the ICU of Ganjavian hospital, Dezful, Iran. Standard microbiological procedures were employed for S. aureus detection. Antibiotic susceptibility testing was conducted using both disk diffusion and minimum inhibitory concentration methods. Polymerase chain reaction (PCR) was employed to identify the presence of the mecA gene and the virulence genes hla, tsst-1, and pvl. A statistical analysis was performed to evaluate the data.

Results:

The study revealed that 12.5% of healthcare providers were carriers of S. aureus, with 26.6% of them harboring methicillin-resistant S. aureus (MRSA) strains. Antibiotic resistance patterns varied, with a notable resistance to erythromycin and penicillin. The hla gene was detected in 66.6% of S. aureus strains; nevertheless, the tsst-1 and pvl genes were not identified. The study suggests a potential association between high expression of the hla and mecA genes and antibiotic resistance.

Conclusions:

This study underscores the prevalence of S. aureus nasal carriage, antibiotic resistance patterns, and the distribution of virulence genes among healthcare providers in an ICU setting. The findings emphasize the significance of continuous surveillance and infection control strategies to mitigate the transmission of S. aureus and associated infections within healthcare facilities. The study recommends routine screening of ICU healthcare providers for asymptomatic S. aureus carriers and appropriate interventions to eliminate colonization.

1. Background

Staphylococcus aureus stands as one of the leading culprits behind nosocomial infections, capable of causing severe and invasive diseases (1). A majority of the strains encountered in healthcare settings are methicillin-resistant S. aureus (MRSA) variants, rendering them impervious to all beta-lactam antibiotics (2). The rise of MRSA has presented a significant therapeutic challenge, primarily due to the mounting resistance of these bacteria, particularly in healthcare-acquired infections (3, 4).
Staphylococcus aureus can naturally inhabit the skin’s surface in individuals, with 20 - 40% of the general population carrying it in their anterior nostrils. Healthcare providers who are asymptomatic carriers represent a pivotal means through which this organism can spread within the hospital (5).
Virulence genes play a crucial role in producing toxins and other factors that intensify the severity of diseases. The presence of specific virulence genes, such as toxic shock syndrome toxin-1 (tsst-1), alpha-toxin (hla), and panton-valentine leucocidin (pvl), has been linked to heightened pathogenicity and the potential for severe infections.
Panton-Valentine leukocidin, originating from the pvl gene, encodes a cytolytic toxin that triggers the entry of cations and subsequent neutrophil destruction by forming pores. Due to its ability to induce leukocyte lysis, leukocidin can serve as a virulence factor, leading to a reduction in leukocyte populations within the host’s body. Toxic shock syndrome toxin-1 (TSST) belongs to the pyrogenic toxin superantigen (PTSAg) group. Superantigens exert their influence by stimulating T cells through interaction with the variable region on the T-cell receptor (TCR) and class II major histocompatibility complex molecules (MHC class 2). Following activation, T cells release cytokines, including interleukin 1 and tumor necrosis factor-alpha (TNF-α), resulting in both shock and tissue damage (6, 7).

2. Objectives

In this study, an in-depth examination of S. aureus nasal carriage was conducted among healthcare providers in an intensive care unit (ICU). The primary focus was on antibiotic resistance profiles and the distribution of virulence genes. This knowledge holds the potential to contribute to the prevention of the spread of S. aureus and the enhancement of patient care outcomes.

3. Methods

3.1. Sampling and Detection of Staphylococcus aureus

In this cross-sectional descriptive study, after obtaining approval from the Ethics Committee of Dezful University of Medical Sciences, Dezful, Iran, 120 healthcare workers in the Special Care Department of Ganjavian Dezful hospital were screened for S. aureus.

3.1.1. Inclusion and Exclusion Criteria

The study included medical professionals, such as physicians, nurses, students, and other ICU personnel, who willingly agreed to participate. Individuals who did not provide consent or were experiencing a respiratory tract infection during the sample collection period were excluded based on the established criteria. A trained research assistant collected nasal swabs from both nostrils using 2 sterile cotton swab sticks, one for each nostril. Each swab stick was moistened with sterile saline solution and inserted approximately one centimeter into each nostril. The swab stick was then rotated five times along the inner wall of the ala and nasal septum. After collection, the swab stick was placed in a test tube container sealed with cotton wool and promptly sent to the microbiology laboratory for culture on mannitol salt agar and blood agar media (Merck, USA). Standard microbiological procedures, including Gram staining, catalase, coagulase, and mannitol fermentation on mannitol salt agar (Merck, USA), were performed to detect S. aureus (8). Information about healthcare workers, such as age, gender, occupational role, duration of professional experience, antibiotic use in the last three months, and history of a specific disease, was recorded.

3.2. Antibiotic Susceptibility Testing

Antibiotic susceptibility testing (AST) was conducted for all isolates following the guidelines of the Clinical and Laboratory Standards Institute (CLSI) using disk diffusion (DD) and minimum inhibitory concentration (MIC) methods (9). The DD method involved testing with gentamicin (10 µg), rifampicin (5 µg), levofloxacin (5 µg), ciprofloxacin (5 µg), cefoxitin (30 µg), trimethoprim/sulfamethoxazole (1.25/23.75 µg), quinupristin/dalfopristin (15 µg), clindamycin (2 µg), erythromycin (15 µg), penicillin (10 U), and linezolid (30 µg) (BD, USA). Minimum inhibitory concentration testing was conducted for teicoplanin, daptomycin, and vancomycin antibiotics. Cefoxitin disks (30 µg) (BD, USA) were used to detect MRSA using the DD method. Staphylococcus aureus ATCC 25923 served as the control strain (10).

3.3. Polymerase Chain Reaction Analysis

Deoxyribonucleic acid (DNA) was extracted from bacterial cells using a boiling method. Primers specific to the uni (PCR control), tsst-1, pvl, hla, and mecA genes were synthesized by Metabion in Germany (Table 1). Each gene was amplified through polymerase chain reaction (PCR), and the resulting products were analyzed by electrophoresis on agarose gel.
Table 1.Oligonucleotide Primers Used in This Study
Sequence NameSequence (5’ → 3’)AnnealingAmplicon Length, bpReferences
uni FCCAGCAGCCGCGGTAATACG60996-
uni RATCGGTTACCTTGTTACGACTTC
hla FCGGTACTACAGATATTGGAAGC55744(11)
hla RTGGTAATCATCACGAACTCG
pvl FGGAAACATTTATTCTGGCTATAC55502(11)
pvl RCTGGATTGAAGTTACCTCTGG
tsst-1 FTTATCGTAAGCCCTTTGTTG54398(11)
tsst-1 RTAAAGGTAGTTCTATTGGAGTAGG
mecA FAGAAGATGGTATGTGGAAGTTAG55584(10)
mecA RATGTATGTGCGATTGTATTGC

3.4. Statistical Analysis

Data analysis was performed using WHONET 2020 and IBM SPSS software (version 21). Qualitative variables were described using frequency and percentage. The chi-square test was employed to analyze the data, with a significance level set at P < 0.05.

4. Results

A total of 120 healthcare provider specimens were collected, comprising 32 (26.7%) males and 88 (73.3%) females. The age of the study participants ranged from 22 to 63 years. Detailed demographic data are presented in Table 2.
Table 2.Characteristics of the Healthcare Workers a
VariablesTotalStaphylococcus aureus Nasal CarrierP-ValueMRSA Nasal Carrier
Age (y)-
Median (range)33 (22 - 63)41 (24 - 63)35 (29 - 47)
Gender0.223
Male32 (26.7)6 (18.8)2 (6.3)
Female88 (73.3)9 (10.2)2 (2.3)
Occupational role0.729
Physician10 (8.3)00
Student3 (2.5)00
Nurse72 (60)7 (9.7)2 (2.8)
Nurse’s aide35 (29.2)7 (20)2 (5.8)
Duration of professional experience0.213
1 - 6 months6 (5)00
6 - 12 months5 (4.2)00
> 1 year109 (90.8)15 (13.8)4 (3.7)
Using antibiotics in the last three months0.713
Yes42 (35)6 (40)1 (2.4)
No78 (65)9 (60)3 (97.6)
History of a special disease0.543
Immunosuppression000
Diabetes2 (1.7)00
Recent sinusitis1 (0.8)00
None109 (90.8)15 (13.8)4 (3.7)
Total120 (100)15 (12.5)-4 (3.3)

Abbreviation: MRSA, methicillin-resistant Staphylococcus aureus.

a Values are expressed as No. (%) unless otherwise indicated.

Fifteen samples (12.5%) tested positive as carriers of S. aureus, with 40% (n = 6) being male and 40% (n = 6) having a history of antibiotic use in the past 3 months. Among the strains, 26.6% (n = 4) were identified as MRSA. The overall rate of nasal colonization by MRSA amounted to 3.3%. The collected findings strongly suggest that 20% (7/35) of nurse’s aides investigated were carriers of S. aureus in their nasal cavities. However, based on the obtained results (P-value), it can be concluded that the presence of S. aureus nasal carriers was not significantly associated with gender, occupational role, duration of professional experience, recent antibiotic usage, or a history of any specific ailment.
The results of the AST for the S. aureus isolates are depicted in Figure 1. The data demonstrated that the resistance patterns of these isolates toward erythromycin were observed in 73% of cases; nevertheless, resistance to penicillin was 100%. Furthermore, clindamycin, ciprofloxacin, levofloxacin, cefoxitin, gentamicin, and cotrimoxazole exhibited a resistance pattern of 66.6%, 46.6%, 53.3%, 26.6%, 6.6%, and 6.6%, respectively. All strains showed sensitivity to rifampin, linezolid, vancomycin, daptomycin, quinupristin-dalfopristin, and teicoplanin.
Antimicrobial resistance profiles of <i>Staphylococcus aureus</i> isolates (Abbreviations: E, erythromycin; CD, clindamycin; FOX, cefoxitin; PEN, penicillin; CIP, ciprofloxacin; LEVO, levofloxacin; GM, Gentamycin; TS, trimethoprim/Sulfamethoxazole; RIF, rifampin; LZD, linezolid; V, vancomycin; DAP, daptomycin; TEC, teicoplanin; SYN, quinupristin-Dalfopristin).
Figure 1.

Antimicrobial resistance profiles of Staphylococcus aureus isolates (Abbreviations: E, erythromycin; CD, clindamycin; FOX, cefoxitin; PEN, penicillin; CIP, ciprofloxacin; LEVO, levofloxacin; GM, Gentamycin; TS, trimethoprim/Sulfamethoxazole; RIF, rifampin; LZD, linezolid; V, vancomycin; DAP, daptomycin; TEC, teicoplanin; SYN, quinupristin-Dalfopristin).

The PCR product specific to the uni gene was detected in all isolates. Additionally, all four MRSA strains harbored the mecA gene. The hla gene was detected in 66.6% of S. aureus strains; nonetheless, neither the tsst-1 nor pvl genes were observed in any of the isolates (Figure 2).
Agarose gel electrophoresis of polymerase chain reaction (PCR) products; lane M, DNA size marker, 100 bp; lanes 1 and 2, <i>hla</i> (744 bp); lanes 3, 4, and 5, <i>mecA</i> (584 bp); negative template control (NTC); lanes 6, 7, 8, and 9, <i>uni</i> (996 bp).
Figure 2.

Agarose gel electrophoresis of polymerase chain reaction (PCR) products; lane M, DNA size marker, 100 bp; lanes 1 and 2, hla (744 bp); lanes 3, 4, and 5, mecA (584 bp); negative template control (NTC); lanes 6, 7, 8, and 9, uni (996 bp).

5. Discussion

5.1. Frequency of Staphylococcus aureus

The prevalence rate of S. aureus in the present study was slightly lower than in similar studies conducted in Iran (12.5% vs. 19.2%, 22.5%, 21.5%, and 24%) (12-14). The rate of MRSA carrier cases was 26.6%. However, the prevalence of MRSA cases among all samples was 3.3%, which aligns closely with the findings of other studies (15). The prevalence of different Staphylococcus isolates can be crucial in determining the appropriate antibiotic coverage against these species. In accordance with the 2016 Infectious Diseases Society of America (IDSA) guidelines on hospital-acquired pneumonia (HAP) and ventilator-associated pneumonia (VAP), if more than 10 - 20% of isolated S. aureus strains are MRSA, empiric treatment for these strains should be considered (16). Therefore, this issue holds significant clinical importance when deciding the best treatment regimen. The recommendation is to consider MRSA treatment for HAP/VAP cases of ICU patients in this medical center.

5.2. Frequency of Toxin Genes

The mecA gene encodes a protein known as a penicillin-binding protein with low affinity (PBP2a), responsible for S. aureus resistance to methicillin and many beta-lactam drugs (17, 18). The prevalence of mecA and hla genes in S. aureus strains has varied in various studies, likely due to multifactorial factors (environmental factors, ethnic differences, and antibiotic use). In the current study, similar to Hoseini Alfatemi et al.’s study, the hla gene had the highest frequency among all S. aureus strains (19). The mecA gene was present in all MRSA strains in the current study. In a study by Jafari-Sales et al., over 51% of MRSA strains were observed to contain the mecA gene (20). Given the frequency of these genes in the present study, we believe that the presence of the mecA gene might indicate high antibiotic resistance, particularly to beta-lactams, and these strains require increased attention as they might lead to more severe and aggressive diseases. Additionally, understanding the expression of these genes and the status of staphylococcal strains can enhance treatment strategies for S. aureus infections.
The detection of tsst-1 and pvl genes is clinically significant because their expression can be associated with severe infections caused by this organism, such as severe pneumonia and toxic shock syndrome (21). In Tabassum et al.’s study, 49% of MRSA strains in the normal population and 46% in pathogenic MRSA strains carried the pvl gene, raising public health concerns (22). In another study, 19% of S. aureus strains were observed to be pvl-positive (23).
In two studies conducted in Nigeria and Ethiopia, 67% and 13% of clinical samples encoded the test-1 gene, leading to resistance to various antibiotics (24, 25). However, in the current study, neither the pvl nor tsst-1 genes were detected in any of the strains. The difference might be related to the selection of samples from healthy carriers or the small size of the sample pool.

5.3. Antibiotic Susceptibility Testing

Currently, MRSA poses a global health threat. Treating these infections is increasingly challenging, necessitating prolonged hospitalization, and is associated with elevated mortality rates (26, 27). Improper antibiotic usage ranks among the most critical factors contributing to antibiotic resistance (28). Reports from the World Health Organization reveal that in most countries, over 51% of antibiotics are used inappropriately or at inadequate dosages (29). Given variations in microbial resistance patterns, conducting continuous studies to investigate these patterns in different countries is crucial. In this study, all S. aureus strains demonstrated sensitivity to vancomycin, teicoplanin, linezolid, rifampin, quinopristin-dalfopristin, and daptomycin, with no resistance observed to these drugs. It is recommended to reserve these options solely for cases involving MRSA strains, with AST results guiding treatment decisions.
Quinolones (levofloxacin and ciprofloxacin) have historically been considered effective drugs for S. aureus infections. However, in recent years, due to their excessive and improper use, resistance to quinolones among S. aureus strains has increased (30, 31). In the current study, relatively high resistance to quinolones was noted (46.7% for ciprofloxacin and 53.3% for levofloxacin). Although quinolones remain a suitable choice for treating S. aureus infections, it is imperative to always consider microbial susceptibility results. Moreover, given the substantial resistance observed in this study, it is not recommended to use penicillin, clindamycin, or erythromycin for the treatment of S. aureus infections at this treatment center. It appears that this pattern of microbial resistance is linked to the heightened expression of the mecA and hla genes.
Several studies have failed to establish a significant relationship between individuals' career status and their occupational roles (13, 32). However, a study conducted by Rahimi-Alang et al. in the hospitals of Gorgan, Iran, reported a significant association between a healthcare provider’s role and their carrier status (14). In the present study, although no statistically significant difference was observed between occupational roles and S. aureus carriers (P = 0.42), it appears that nurses and nurse’s aides might play pivotal roles in transmitting S. aureus organisms to patients in ICUs. These results might be connected to the duration of work shifts and the consistency of presence in this ward. Regular training for this group on standard precautions, particularly emphasizing hand hygiene principles, is of utmost importance.
In this study, there was no statistically significant relationship between the duration of professional experience and being a carrier of S. aureus (P = 0.78). However, one noteworthy finding was that all asymptomatic carriers had more than one year of experience. The aforementioned results might be influenced by the relatively small sample size in this study. Similar studies have also failed to establish a significant relationship between individuals’ length of professional experience and being carriers of S. aureus (12).
It appears that there could be a connection between the duration of professional experience among ICU staff and the likelihood of being a carrier. Therefore, it is advisable to conduct routine screenings for asymptomatic carriers of S. aureus among all healthcare providers with a history of more than one year of service in the ICU. Additionally, avoiding prolonged stays in this ward might prove effective in controlling these conditions.

5.4. Conclusions

In conclusion, this study offers valuable insights into the prevalence, antibiotic resistance profiles, and distribution of virulence genes among healthcare providers carrying S. aureus in their nasal passages within an ICU setting. These findings underscore the necessity for ongoing surveillance and the implementation of infection control strategies to mitigate the risk of S. aureus transmission and associated infections in healthcare settings. It is recommended that ICU staff with more than one year of work experience undergo regular screening for asymptomatic carriers of S. aureus and receive treatment if colonization is detected in the anterior nostrils.

5.5. Limitations

This study did not include the determination of the clonal lineage of the isolated S. aureus. Another significant limitation of the current investigation was the lack of testing for mupirocin, an agent recommended for eradicating staphylococci nasal carriage.

Acknowledgments

Footnotes

References

  • 1.
    Arjyal C, Kc J, Neupane S. Prevalence of Methicillin-Resistant Staphylococcus aureus in Shrines. Int J Microbiol. 2020;2020:7981648. [PubMed ID: 32190054]. [PubMed Central ID: PMC7068152]. https://doi.org/10.1155/2020/7981648.
  • 2.
    John JJ. The treatment of resistant staphylococcal infections. F1000Res. 2020;9. [PubMed ID: 32148777]. [PubMed Central ID: PMC7047908]. https://doi.org/10.12688/f1000research.17718.1.
  • 3.
    Kanjilal S, Sater MRA, Thayer M, Lagoudas GK, Kim S, Blainey PC, et al. Trends in antibiotic susceptibility in staphylococcus aureus in boston, massachusetts, from 2000 to 2014. J Clin Microbiol. 2018;56(1). [PubMed ID: 29093105]. [PubMed Central ID: PMC5744217]. https://doi.org/10.1128/JCM.01160-17.
  • 4.
    Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, et al. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat Rev Microbiol. 2019;17(4):203-18. [PubMed ID: 30737488]. [PubMed Central ID: PMC6939889]. https://doi.org/10.1038/s41579-018-0147-4.
  • 5.
    Shih HI, Chang CM, Shen FC, Lee YJ, Wu CH, Hsu HC, et al. High prevalence nasal carriage of methicillin-resistant Staphylococcus aureus among long term care facility healthcare workers in relation to patient contact. Infect Prev Pract. 2021;3(1):100117. [PubMed ID: 34368736]. [PubMed Central ID: PMC8336196]. https://doi.org/10.1016/j.infpip.2021.100117.
  • 6.
    Algammal AM, Hetta HF, Elkelish A, Alkhalifah DHH, Hozzein WN, Batiha GE, et al. Methicillin-resistant staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020;13:3255-65. [PubMed ID: 33061472]. [PubMed Central ID: PMC7519829]. https://doi.org/10.2147/IDR.S272733.
  • 7.
    Que Y, Moreillon P. Staphylococcus aureus (Including Staphylococcal Toxic Shock). Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases. 2010. p. 2543-78. https://doi.org/10.1016/b978-0-443-06839-3.00195-8.
  • 8.
    Tille P. Bailey & Scott's diagnostic microbiology-E-Book. Elsevier Health Sciences; 2015.
  • 9.
    Wayne PA. Clinical and laboratory standards institute: Performance standards for antimicrobial susceptibility testing: 20th informational supplement. CLSI document M100-S20. 2010.
  • 10.
    Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern Iran. J Clin Microbiol. 2012;50(11):3581-5. [PubMed ID: 22933598]. [PubMed Central ID: PMC3486207]. https://doi.org/10.1128/JCM.01727-12.
  • 11.
    Havaei SA, Azimian A, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic characterization of methicillin resistant and sensitive, vancomycin intermediate staphylococcus aureus strains isolated from different Iranian Hospitals. ISRN Microbiol. 2012;2012:215275. [PubMed ID: 23762750]. [PubMed Central ID: PMC3664199]. https://doi.org/10.5402/2012/215275.
  • 12.
    Jomehpour N. Investigation of the frequency of Staphylococcus aureus carriers and its methicillin-resistant pattern in Torbat Heydariyeh hospitals staff in 2013. J Torbat Heydariyeh Univ Med Sci. 2016;4(1):42-9.
  • 13.
    Khalili Mohammad B, Moshref M, Sharifi M, Sadeh M, Sazmand A. Prevalence of staphylococcus aureus (SA) and methicillin resistant staphylococcus aureus (MRSA) in personnel of operation room of Shahid Sadoughi Hospital, Yazd, Iran. Payavard Salamat. 2013;6(5).
  • 14.
    Rahimi-Alang S, Asmar M, Cheraghali F, Yazarlou S, Amini A, Shakeri F, et al. Frequency of methicillin resistant Staphylococcus aureus in health care. Zahedan J Res Med Sci. 2011;13(1).
  • 15.
    Schaumburg F, Ngoa UA, Kosters K, Kock R, Adegnika AA, Kremsner PG, et al. Virulence factors and genotypes of Staphylococcus aureus from infection and carriage in Gabon. Clin Microbiol Infect. 2011;17(10):1507-13. [PubMed ID: 21595798]. https://doi.org/10.1111/j.1469-0691.2011.03534.x.
  • 16.
    Kalil AC, Metersky ML, Klompas M, Muscedere J, Sweeney DA, Palmer LB, et al. Management of adults with hospital-acquired and ventilator-associated pneumonia: 2016 clinical practice guidelines by the infectious diseases society of America and the American Thoracic Society. Clin Infect Dis. 2016;63(5):e61-e111. [PubMed ID: 27418577]. [PubMed Central ID: PMC4981759]. https://doi.org/10.1093/cid/ciw353.
  • 17.
    Lade H, Kim JS. Molecular determinants of beta-lactam resistance in methicillin-resistant staphylococcus aureus (MRSA): An Updated Review. Antibiotics (Basel). 2023;12(9). [PubMed ID: 37760659]. [PubMed Central ID: PMC10525618]. https://doi.org/10.3390/antibiotics12091362.
  • 18.
    Musa I, Saadu M, Jibril F. Antibiogram and detection of mecA gene among MRSA at Specialist Hospital Sokoto. Microbes Infectious Diseases. 2023;4(3):800-8.
  • 19.
    Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of virulence genes among methicillin resistant staphylococcus aureus (MRSA) strains. Jundishapur J Microbiol. 2014;7(6). e10741. [PubMed ID: 25371805]. [PubMed Central ID: PMC4217665]. https://doi.org/10.5812/jjm.10741.
  • 20.
    Jafari-Sales A, Sadeghi Deylamdeh Z, Shariat A. Evaluation of antibiotic resistance pattern and mecA gene frequency in methicillin-resistant Staphylococcus aureus strains collected from clinical specimens in Marand hospital and treatment centers, Iran. Tabari Biomed Student Res J. 2021. https://doi.org/10.18502/tbsrj.v2i4.5469.
  • 21.
    Kaneko H, Yanagi Y, Otake S, Sato M, Saito T, Nakaminami H. The emerging threat of methicillin-resistant Staphylococcus aureus (MRSA) clone ST22-PT, carrying both Panton-Valentine leucocidin and toxic shock syndrome toxin 1 genes. J Antimicrob Chemother. 2023;78(4):1023-7. [PubMed ID: 36814074]. https://doi.org/10.1093/jac/dkad039.
  • 22.
    Tabassum H, Gull M, Rasheed A, Bano A, Ejaz H, Javed N. Molecular analysis of Panton-Valentine Leucocidin (pvl) gene among MRSA and MSSA isolates. Braz J Biol. 2023;83. e250351. [PubMed ID: 36753148]. https://doi.org/10.1590/1519-6984.250351.
  • 23.
    Vittorakis E, Vica ML, Zervaki CO, Vittorakis E, Maraki S, Mavromanolaki VE, et al. Examining the prevalence and antibiotic susceptibility of s. Aureus strains in hospitals: An analysis of the pvl gene and its co-occurrence with other virulence factors. Microorganisms. 2023;11(4). [PubMed ID: 37110264]. [PubMed Central ID: PMC10140963]. https://doi.org/10.3390/microorganisms11040841.
  • 24.
    Ade T, Odewale G, Daji M, Ohirhian J, Ojedele R. Association of TSST-1 gene with phenotypic antibiotic resistance among clinical Staphylococcus aureus isolates in a tertiary healthcare centre. Microbes Infectious Diseases. 2022;0(0):0. https://doi.org/10.21608/mid.2022.150189.1348.
  • 25.
    Ibrahim RA, Berhe N, Mekuria Z, Seyoum ET, Balada-Llasat JM, Abebe T, et al. Antimicrobial resistance and virulence gene profile of clinical staphylococcus aureus: A multi-center study from ethiopia. Infect Drug Resist. 2023;16:4835-44. [PubMed ID: 37520455]. [PubMed Central ID: PMC10386829]. https://doi.org/10.2147/IDR.S419577.
  • 26.
    Kanj SS, Bassetti M, Kiratisin P, Rodrigues C, Villegas MV, Yu Y, et al. Clinical data from studies involving novel antibiotics to treat multidrug-resistant Gram-negative bacterial infections. Int J Antimicrob Agents. 2022;60(3):106633. [PubMed ID: 35787918]. https://doi.org/10.1016/j.ijantimicag.2022.106633.
  • 27.
    Gentry EM, Kester S, Fischer K, Davidson LE, Passaretti CL. Bugs and drugs: Collaboration between infection prevention and antibiotic stewardship. Infect Dis Clin North Am. 2020;34(1):17-30. [PubMed ID: 31836329]. https://doi.org/10.1016/j.idc.2019.10.001.
  • 28.
    Bitew A, Adane A, Abdeta A. Bacteriological spectrum, extended-spectrum beta-lactamase production and antimicrobial resistance pattern among patients with bloodstream infection in Addis Ababa. Sci Rep. 2023;13(1):2071. [PubMed ID: 36746979]. [PubMed Central ID: PMC9902618]. https://doi.org/10.1038/s41598-023-29337-x.
  • 29.
    Ofori-Asenso R, Brhlikova P, Pollock AM. Prescribing indicators at primary health care centers within the WHO African region: A systematic analysis (1995-2015). BMC Public Health. 2016;16:724. [PubMed ID: 27545670]. [PubMed Central ID: PMC4993007]. https://doi.org/10.1186/s12889-016-3428-8.
  • 30.
    Yang P, Chen Y, Jiang S, Shen P, Lu X, Xiao Y. Association between the rate of fluoroquinolones-resistant gram-negative bacteria and antibiotic consumption from China based on 145 tertiary hospitals data in 2014. BMC Infect Dis. 2020;20(1):269. [PubMed ID: 32264851]. [PubMed Central ID: PMC7137221]. https://doi.org/10.1186/s12879-020-04981-0.
  • 31.
    Solano-Gálvez SG, Valencia-Segrove MF, Prado MJO, Boucieguez ABL, Álvarez-Hernández DA, Vázquez-López R. Mechanisms of resistance to quinolones. Antimicrobial Resistance-A One Health Perspective. 2020.
  • 32.
    Saadat S, Solhjoo K, Norouz-nejadfard MJ, Kazemi A, Rouhi R, Mardaneh J. The frequency of Staphylococcus aureus among Shiraz hospital personnel and determination of their antibiotic sensitivity pattern. Iran South Med J. 2014;17(5).

Similar Articles

2
Aug
2022
Trends in Med Sci

Characterization of Virulence Genes and Antibiotic Resistance of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible Staphylococcus aureus (MSSA) Isolates in Intensive Care Unit (ICU) and Non-ICU Wards

Javad Moazen,
Fatemeh Riyahi Zaniani,
Behzad Hallaj Asghar

Moazen J, Riyahi Zaniani F, Hallaj Asghar B. Characterization of Virulence Genes and Antibiotic Resistance of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible Staphylococcus aureus (MSSA) Isolates in Intensive Care Unit (ICU) and Non-ICU Wards. J Adv Immunopharmacol. 2022;2(2):e129037. doi: https://doi.org/10.5812/tms-129037

1
Jan
2017

Molecular Characterization and Resistance Profile of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Patients in Intensive Care Unit, Tehran-Iran

Ramin Rashidi Nezhad,
Seyed Mansour Meybodi,
Razieh Rezaee,
Mehdi Goudarzi,
Maryam Fazeli

Rashidi Nezhad R, Meybodi SM, Rezaee R, Goudarzi M, Fazeli M. Molecular Characterization and Resistance Profile of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Patients in Intensive Care Unit, Tehran-Iran. Jundishapur J Microbiol. 2017;10(3):e41666. doi: https://doi.org/10.5812/jjm.41666

6
Sep
2016

Distribution of Adhesion and Toxin Genes in Staphylococcus aureus Strains Recovered From Hospitalized Patients Admitted to the ICU

Fereshteh Eftekhar,
Razieh Rezaee,
Mehdi Azad,
Hadi Azimi,
Hossein Goudarzi,
Mehdi Goudarzi

Eftekhar F, Rezaee R, Azad M, Azimi H, Goudarzi H, et al. Distribution of Adhesion and Toxin Genes in Staphylococcus aureus Strains Recovered From Hospitalized Patients Admitted to the ICU. Arch Pediatr Infect Dis. 2017;5(1):e39349. doi: https://doi.org/10.5812/pedinfect.39349

20
Nov
2017

Distribution of Genes Encoding Toxin, Adhesion, and Antibacterial Resistance Among Various SCCmec Types of Methicillin-Resistant Staphylococcus aureus Isolated From Intensive Care Unit, Tehran, Iran

Parnaz Abiri,
Abbas Akhavan Sepahi,
Hossein Goudarzi,
Mehdi Goudarzi

Abiri P, Akhavan Sepahi A, Goudarzi H, Goudarzi M. Distribution of Genes Encoding Toxin, Adhesion, and Antibacterial Resistance Among Various SCCmec Types of Methicillin-Resistant Staphylococcus aureus Isolated From Intensive Care Unit, Tehran, Iran. Jundishapur J Microbiol. 2017;10(12):e14477. doi: https://doi.org/10.5812/jjm.14477

24
Apr
2018
Molecular Investigation of Methicillin-Resistant <i>Staphylococcus aureus</i> Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and <i>agr</i> Locus Type Analysis

Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis

Sara Nasirian,
Sara Saadatmand,
Hossein Goudarzi,
Mehdi Goudarzi,
Hadi Azimi

Nasirian S, Saadatmand S, Goudarzi H, Goudarzi M, Azimi H. Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis. Arch Clin Infect Dis. 2018;13(2):e14495. doi: https://doi.org/10.5812/archcid.14495


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles