A Functional Polymorphism in Promoter of the CXCL10 Gene (-135 G/A) Associated With Pulmonary Tuberculosis

Author(s):
Mohsen TaheriMohsen TaheriMohsen Taheri ORCID1, 2,*, Hamid Reza KouhpayehHamid Reza Kouhpayeh3, Toraj HosseinalizadehToraj Hosseinalizadeh3, Mohammad NaderiMohammad Naderi3, Gholamreza BahariGholamreza Bahari4, Mohammad HashemiMohammad Hashemi4
1Genetics of Non-communicable Diseases Research Center, Zahedan University of Medical Sciences, Zahedan, IR Iran
2Department of Genetics, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran
3Research Center for Infectious Diseases and Tropical Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran
4Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran

Archives of Clinical Infectious Diseases:Vol. 8, issue 4; e15542
Published online:Oct 15, 2013
Article type:Research Article
Received:Jul 21, 2013
Accepted:Sep 06, 2013
How to Cite:Taheri M, Kouhpayeh HR, Hosseinalizadeh T, Naderi M, Bahari G, et al. A Functional Polymorphism in Promoter of the CXCL10 Gene (-135 G/A) Associated With Pulmonary Tuberculosis. Arch Clin Infect Dis. 2013;8(4):e15542. doi: https://doi.org/10.5812/archcid.15542

Abstract

Background:

Genetic variation influences susceptibility/resistance to tuberculosis. CXCL10 is involved in T-cell migration and stimulation of natural killer cells in Mycobacterium tuberculosis infection.

Objectives:

We aimed to investigate the genetic polymorphisms in promoter of the CXCL10 gene in patients with pulmonary tuberculosis (PTB) and healthy controls, to clarify whether polymorphisms in the CXCL10 gene is associated with tuberculosis.

Patients and Methods:

This study was performed on 150 patients with PTB as well as 150 healthy subjects. Polymorphism of CXCL10 (-135 G/A) was determined using amplification refractory mutational system-polymerase chain reaction (ARMS-PCR).

Results:

There were significant differences in genotype and allele frequencies of the CXCL10 gene -135 G/A polymorphism between the groups. GA and AA genotypes were protective against tuberculosis in comparison with GG genotype (OR = 0.19, 95% CI = 0.10-0.36, P < 0.001; and OR = 0.12, 95% CI = 0.04-0.43, P < 0.001, respectively). Furthermore, A allele decreased the risk of PTB in comparison with G allele (OR = 0.55, 95% CI = 0.39-0.77, P < 0.001).

Conclusions:

Significant association was found between the CXCL10 -135 G/A promoter variant and host resistance to PTB in a sample of Iranian population.

1. Background

Tuberculosis (TB) is a human disease which is still a major cause of morbidity and mortality throughout the world, especially in Asia and Africa, and has remained a public health problem (1). It is the second leading cause of death in the world after HIV, according to the World Health Organization (WHO) estimates, in 2010 there were 8.8 million new cases of TB and 1.5 million deaths (2). While the incidence rate of TB in Iran is 28 per 100 000, its prevalence in Zahedan (Center of Sistan and Baluchistan province) has been higher than other regions of the country (3). More than one-third of the world’s population is infected with Mycobacterium tuberculosis, of which only 10% develop clinical disease; the remaining individuals are able to restrict and eliminate the infection by generating an appropriate immune response (4). Increasing evidence indicates that host genetic factors are important risk factors for development of TB and contribute to variations in the host response against M. tuberculosis (4, 5). Multiple genes may be involved in the development of susceptibility or immunity to TB. A variety of cytokines takes part in protective host response in human TB and also serves to localize the bacteria.
The CXCL10 gene localizes on chromosome 4 at band q21 (6). CXCL10 (IP10) is a small chemokine secreted by several cell types in response to interferon-γ (IFN-γ). These cell types include monocytes, endothelial cells and fibroblasts. It is a 10-kDa protein and is functionally categorized as an inflammatory chemokine. CXCL10 exerts its biological effects by binding to CXCR3 and regulates immune responses by activation of leukocytes such as T cells, eosinophils, monocytes, and natural killer (NK) cells. Several roles, such as chemoattraction of monocytes/macrophages, T cells, NK cells, and dendritic cells, promotion of T cell adhesion to endothelial cells, antitumor activity, and angiogenesis have been attributed to CXCL10. The role of CXCL10 has been discovered in various infectious diseases. It has been proposed that impaired CXCL10 production leads to susceptibility to infection (6).
Several genes contributing to TB susceptibility have been identified (1, 7). In our previous study, we found that single nucleotide polymorphism (SNP) in the IFN-γ gene was associated with susceptibility to TB (5). There is little information regarding the possible association between CXCL10 polymorphism and TB (8).

2. Objectives

The present study aimed to evaluate the association between CXCL-10 (-135 G/A) variant and pulmonary TB (PTB) in a sample of an Iranian population.

3. Patients and Methods

From September 2010 to June 2012, 150 patients with PTB, referred to the Research Center for Infectious Diseases and Tropical Medicine, Bou-Ali Hospital, Zahedan, Iran, and 150 population-based healthy subjects with no clinical symptoms or family histories of TB belonging to same ethnicity as patients were enrolled in this case control study.
Diagnosis of TB was based on clinical symptoms, radiological evidence, sputum acid fast bacillus (AFB) smear positivity, culture, and response to antituberculosis chemotherapy, as described previously (9). The local Ethics Committee of Zahedan University of Medical Sciences approved the study; all the individuals included in the study were informed about the study and written consents were obtained from them.
Two milliliters of venous blood was drawn from each subject. Blood samples were collected in EDTA-coated vials and stored at -20°C until DNA extraction. Genomic DNA was extracted using salting out method, as described previously (10).
CXCL10 genomic sequence (NC-000004.11) was obtained from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). The polymorphism was searched and primers for amplification refractory mutational system-polymerase chain reaction (ARMS-PCR) were designed (F: TTCCTTACCTTGAATGCCACTT, R (G Allele): GGAGGCTACAATAAATAATACCTTCG, R (A Allele): GGAGGCTACAATAAATAATACCTTCA). The product size was 295 base pair (bp). PCR was performed using a commercially available PCR premix (AccuPower PCR Pre-Mix, BIONEER, Daejeon, South Korea) according to the manufacturer’s recommended protocol. For the reaction mixture, 1 μL of the template DNA (~ 100 ng/μL), 1 μL of each primer (10 μM), and 15 μL DNase-free water were added to a 0.2-mL PCR tube containing AccuPower PCR Pre-Mix. The PCR cycling condition for detection of -135 G/A polymorphism of CXCL10 was as follows: five minutes at 95°C, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 62°C, and 17 seconds at 72°C, with a final extension of five minutes at 72°C. The PCR products were visualized and analyzed by electrophoresis in 2% agarose gel. A 100-bp DNA ladder marker was used as the molecular size standards (Figure 1). We regenotyped approximately 10% of the samples to verify the initial results, which confirmed the previous results by 100%.
Lane M, DNA marker; lane 1, GA; lane 2, AA; lane 3, GG.
Figure 1.

Lane M, DNA marker; lane 1, GA; lane 2, AA; lane 3, GG.

3.1. Statistical Analysis

Statistical analysis of the data was performed using the SPSS 18.0 software. Demographics and biochemical parameters between the groups were analyzed by independent sample t-test for continuous data, and χ2 test was used to compare allele and genotype distribution in patients with TB and healthy controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated with logistic regression analyses.

4. Results

This study included 150 patients with PTB (55 males and 95 females) and 150 healthy controls (62 males and 88 females) belonging to same ethnicities. The mean age of patients with PTB and controls was 49.97 ± 20.98 and 44.87 ± 15.47, respectively. Table 1 summarizes the genotype and allele frequencies of the examined polymorphism in promoter region of the CXCL10 gene. There were significant differences in the genotype and allele frequencies of the CXCL10 gene -135 G/A polymorphism between the groups (χ2 = 27.36, P < 0.0001). As shown in Table 1, GA and AA genotypes were protective against TB (OR = 0.19, 95% CI = 0.10-0.36, P < 0.001 for GA vs. GG; OR = 0.12, 95% CI = 0.04-0.43, P = 0.001 for AA vs. GG; and OR = 0.18, 95% CI = 0.10-0.35, P < 0.001 for AG + AA vs. GG, respectively). Furthermore, A allele decreased the risk of TB (OR = 0.55, 95% CI = 0.39-0.77, P < 0.001) in comparison with G allele. We calculated the Hardy-Weinberg equilibrium (HWE) in cases and controls. We found that neither cases nor controls were in HWE (P < 0.05).
Table 1. Genotype and Allele Distributions of CXCL10 Polymorphisms in Patients With Pulmonary Tuberculosis and Controls a,b
PolymorphismPTBNormalOR (95% CI) cP Value
Genotype
GG54 (36)16 (10)1.00-
GA91 (61)124 (83)0.19 (0.10-0.36)< 0.001
AA5 (3)10 (7)0.12 (0.04-0.43)< 0.001
GA + AA96 (64)134 (90)0.18 (0.10-0.35)< 0.001
Alleles
G199 (66.3)156 (52)1.00-
A101 (33.7)144 (48)0.55 (0.39-0.77)< 0.001

aAbbreviations: CI, confidence interval; OR, odds ratio; PTB, pulmonary tuberculosis.

bData are presented as No. (%).

cAdjusted for sex and age.

5. Discussion

Our findings revealed the protective role of CXCL10 -135 G/A polymorphism against PTB in our population. The frequencies of -135AG and AA genotypes as well as -135 A allele were significantly higher in normal subjects than ones with PTB. In agreement with our study, Tang et al. (8) showed that the minor allele of -135 G/A was a protective allele for TB in a Chinese population, but -1447 A/G and -872 G/A did not show any association with TB. They found that 14-bp adjacent to this SNP was a binding site for the nuclear factor (NF) κB. They postulated that this SNP (-135 G/A) may also affect the transactivation effect of NF-κB on the CXCL10 expression. Deng et al. (11) in a study on Han Chinese hepatitis B virus (HBV) carriers identified that the -201 G/A polymorphism in CXCL10 was associated with susceptibility to disease progression in male HBV carriers. They observed that the disease-susceptible genotypes, -201 GA and -201 AA, had higher CXCL10 transcription levels in IFN-g-stimulated peripheral blood mononuclear cells, compared with the -201 GG genotype. They revealed that the -201 GA polymorphism alters the binding affinity of the nuclear protein and regulates the CXCL10 expression. In a study on patients with invasive aspergillosis after allogeneic stem cell transplantation, Mezger et al. (12) found that three SNPs in CXCL10 (rs1554013, rs3921, and rs425767415) were associated with the occurrence of invasive aspergillosis. Nakata et al. (13) in a cohort study on 652 patients who underwent unrelated human leukocyte antigen (HLA)-matched bone marrow transplantation for hematologic malignancies, examined the impact of an SNP (rs3921) in the CXCL10 gene on the transplant outcomes. They showed that the recipient CG or GG genotype was associated with a significantly better five-year overall survival rate as well as lower transplant-related mortality rate than the recipient CC genotype. The recipient CG or GG genotype also predicted a reduced incidence of death due to organ failure. They declared that CXCL10 genotyping could be useful in prognoses and creating therapeutic strategies for improving the final outcomes of patients who undergo allogeneic marrow transplantation.
Function of the immune system against TB is homing, recruitment, migration and activation of leucocytes to sites of inflammation, besides restriction of M. tuberculosis to the site of infection by “granuloma formation”, which is regulated by TNFα and chemokines such as CCL2, CCL3, CCL5, CXCL8, CXCL9 and CXCL10 (14). CXCL10 is a chemokine, detected within tuberculous granuloma. CXCL10 attracts activated T cells and monocytes to the inflammatory area, promotes T helper (Th)-1 responses, and has antimicrobial functions (15). In addition to its chemotactic properties for immune cells, including monocytes/macrophages, CXCL10 is also involved in stimulation of NK cells and migration of T cells, following M. tuberculosis infection (16). Ruhwald et al. (17) found that IP-10 is expressed in very high amounts in patients with active TB, but not in unexposed controls. Liu et al. (6) demonstrated that alterations in CXCL10 expression levels were associated with inflammatory diseases including infectious diseases, immune dysfunction, and tumor development. Strong evidence has supported a critical role for genetic factors in susceptibility and resistance to TB, involving multiple genes of the innate immune system (16). Polymorphisms in cytokine genes are known to influence cytokine levels and may be associated with outcomes of infections (18). Indeed, polymorphism in -135 G/A CXCL10 can have a protective role against PTB. It is supposed that this polymorphism can influence the expression of the gene (8, 11).
One limitation of our study was the relatively-small sample sizes. There was no clear explanation for deviation from HWE in our population. It might be due to genetic drift as well as consanguineous marriages, which are still very common in Sistan and Baluchestan province. The -135 G/A regulatory polymorphism in the CXCL10 gene promoter could be a part of the genetic variation underlying the individuals' protections against TB in a sample of the Iranian population, which remains to be fully cleared.

Acknowledgments

Footnotes

References

  • 1.
    Bahari G, Hashemi M, Taheri M, Naderi M, Eskandari-Nasab E, Atabaki M. Association of IRGM Polymorphisms and Susceptibility to Pulmonary Tuberculosis in Zahedan, Southeast Iran. ScientificWorldJournal. 2012;2012:950801. [PubMed ID: 23049477]. https://doi.org/10.1100/2012/950801.
  • 2.
    Millet JP, Moreno A, Fina L, Del Bano L, Orcau A, de Olalla PG, et al. Factors that influence current tuberculosis epidemiology. Eur Spine J. 2012. [PubMed ID: 22565801]. https://doi.org/10.1007/s00586-012-2334-8.
  • 3.
    Metanat M, Sharifi-Mood B, Shahreki S, Dawoudi SH. Prevalence of multidrug-resistant and extensively drug-resistant tuberculosis in patients with pulmonary tuberculosis in zahedan, southeastern iran. Iran Red Crescent Med J. 2012;14(1):53-5. [PubMed ID: 22737557].
  • 4.
    Verma VK, Taneja V, Jaiswal A, Sharma S, Behera D, Sreenivas V, et al. Prevalence, distribution and functional significance of the -237C to T polymorphism in the IL-12Rbeta2 promoter in Indian tuberculosis patients. PLoS One. 2012;7(4). ee34355. [PubMed ID: 22509293]. https://doi.org/10.1371/journal.pone.0034355.
  • 5.
    Hashemi M, Sharifi-Mood B, Nezamdoost M, Moazeni-Roodi A, Naderi M, Kouhpayeh H, et al. Functional Polymorphism of Interferon-gamma (IFN-gamma) Gene +874T/A Polymorphism is Associated with Pulmonary Tuberculosis in Zahedan, Southeast Iran. Prague Med Rep. 2011;112(1):38-43. [PubMed ID: 21470497].
  • 6.
    Liu M, Guo S, Hibbert JM, Jain V, Singh N, Wilson NO, et al. CXCL10/IP-10 in infectious diseases pathogenesis and potential therapeutic implications. Cytokine Growth Factor Rev. 2011;22(3):121-30. [PubMed ID: 21802343]. https://doi.org/10.1016/j.cytogfr.2011.06.001.
  • 7.
    Zheng R, Zhou Y, Qin L, Jin R, Wang J, Lu J, et al. Relationship between polymorphism of DC-SIGN (CD209) gene and the susceptibility to pulmonary tuberculosis in an eastern Chinese population. Hum Immunol. 2011;72(2):183-6. [PubMed ID: 21081145]. https://doi.org/10.1016/j.humimm.2010.11.004.
  • 8.
    Tang NL, Fan HP, Chang KC, Ching JK, Kong KP, Yew WW, et al. Genetic association between a chemokine gene CXCL-10 (IP-10, interferon gamma inducible protein 10) and susceptibility to tuberculosis. Clin Chim Acta. 2009;406(1-2):98-102. [PubMed ID: 19523460]. https://doi.org/10.1016/j.cca.2009.06.006.
  • 9.
    Kouhpayeh HR, Hashemi M, Hashemi SA, Moazeni-Roodi A, Naderi M, Sharifi-Mood B, et al. R620W functional polymorphism of protein tyrosine phosphatase non-receptor type 22 is not associated with pulmonary tuberculosis in Zahedan, southeast Iran. Genet Mol Res. 2012;11(2):1075-81. [PubMed ID: 22614276]. https://doi.org/10.4238/2012.April.27.6.
  • 10.
    Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, Bardestani GR, Kordi-Tamandani DM, et al. Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran. Genet Mol Res. 2010;9(1):333-9. [PubMed ID: 20198589]. https://doi.org/10.4238/vol9-1gmr728.
  • 11.
    Deng G, Zhou G, Zhang R, Zhai Y, Zhao W, Yan Z, et al. Regulatory polymorphisms in the promoter of CXCL10 gene and disease progression in male hepatitis B virus carriers. Gastroenterology. 2008;134(3):716-26. [PubMed ID: 18325387]. https://doi.org/10.1053/j.gastro.2007.12.044.
  • 12.
    Mezger M, Steffens M, Beyer M, Manger C, Eberle J, Toliat MR, et al. Polymorphisms in the chemokine (C-X-C motif) ligand 10 are associated with invasive aspergillosis after allogeneic stem-cell transplantation and influence CXCL10 expression in monocyte-derived dendritic cells. Blood. 2008;111(2):534-6. [PubMed ID: 17957030]. https://doi.org/10.1182/blood-2007-05-090928.
  • 13.
    Nakata K, Takami A, Espinoza JL, Matsuo K, Morishima Y, Onizuka M, et al. The recipient CXCL10 + 1642C>G variation predicts survival outcomes after HLA fully matched unrelated bone marrow transplantation. Clin Immunol. 2013;146(2):104-11. [PubMed ID: 23291247]. https://doi.org/10.1016/j.clim.2012.11.009.
  • 14.
    Hasan Z, Rao N, Salahuddin N, Islam M, Ashraf M, Rottenberg ME, et al. M. tuberculosis sonicate induced IFNgamma, CXCL10 and IL10 can differentiate severity in tuberculosis. Scand J Immunol. 2011. [PubMed ID: 21958213]. https://doi.org/10.1111/j.1365-3083.2011.02642.x.
  • 15.
    Waters WR, Thacker TC, Nonnecke BJ, Palmer MV, Schiller I, Oesch B, et al. Evaluation of gamma interferon (IFN-gamma)-induced protein 10 responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses. Clin Vaccine Immunol. 2012;19(3):346-51. [PubMed ID: 22237891]. https://doi.org/10.1128/CVI.05657-11.
  • 16.
    Azad AK, Sadee W, Schlesinger LS. Innate immune gene polymorphisms in tuberculosis. Infect Immun. 2012;80(10):3343-59. [PubMed ID: 22825450]. https://doi.org/10.1128/IAI.00443-12.
  • 17.
    Ruhwald M, Aabye MG, Ravn P. IP-10 release assays in the diagnosis of tuberculosis infection: current status and future directions. Expert Rev Mol Diagn. 2012;12(2):175-87. [PubMed ID: 22369377]. https://doi.org/10.1586/erm.11.97.
  • 18.
    Selvaraj P, Alagarasu K, Harishankar M, Vidyarani M, Nisha Rajeswari D, Narayanan PR. Cytokine gene polymorphisms and cytokine levels in pulmonary tuberculosis. Cytokine. 2008;43(1):26-33. [PubMed ID: 18522869]. https://doi.org/10.1016/j.cyto.2008.04.011.

Similar Articles

20
Jul
2013

Comparison of Genetic Polymorphisms of TNF-α and IL-10 Genes Between Tuberculosis Patients and Healthy Blood Donors

Maliheh Metanat,
Mehrnaz Narooie Nejad,
Masoud Salehi,
Javad Moazen,
Esmail Sanei-moghaddam,
Narges Arbabi

Metanat M, Narooie Nejad M, Salehi M, Moazen J, Sanei-moghaddam E, et al. Comparison of Genetic Polymorphisms of TNF-α and IL-10 Genes Between Tuberculosis Patients and Healthy Blood Donors. Arch Clin Infect Dis. 2013;8(3):e18270. doi: https://doi.org/10.5812/archcid.18270

9
Oct
2016

Association Between IL12A rs568408, IL12B rs3212227 and IL-12 Receptor rs383483 Polymorphisms and Risk of Pulmonary Tuberculosis

Mohsen Taheri,
Mohammad Naderi,
Mohammad Hashemi,
Marzieh Abiri,
Maryam Sarabandi

Taheri M, Naderi M, Hashemi M, Abiri M, Sarabandi M. Association Between IL12A rs568408, IL12B rs3212227 and IL-12 Receptor rs383483 Polymorphisms and Risk of Pulmonary Tuberculosis. Arch Clin Infect Dis. 2017;12(1):e39318. doi: https://doi.org/10.5812/archcid.39318

6
May
2014

Genetic Variation in Akt1 and Risk of Tuberculosis Among Iranian Population

Mohsen Taheri,
Kajal Yousefi,
Mohammad Naderi,
Mohammad Hashemi

Taheri M, Yousefi K, Naderi M, Hashemi M. Genetic Variation in Akt1 and Risk of Tuberculosis Among Iranian Population. Health Scope. 2014;3(2):e16243. doi: https://doi.org/10.17795/jhealthscope-16243

23
Jul
2025
Hepat Mon

Effect of Promoter Region Polymorphisms in the IP-10 Gene on HBsAg Loss in Chronic Hepatitis B Patients

Melek Tutku Kaçar Şahin,
Muhammed Burak Bereketoğlu,
Hamide Dogan,
Meryem Kose,
Ferit Kuscu,
Behice Kurtaran
,et al.

Tutku Kaçar Şahin M, Burak Bereketoğlu M, Dogan H, Kose M, Kuscu F, et al. Effect of Promoter Region Polymorphisms in the IP-10 Gene on HBsAg Loss in Chronic Hepatitis B Patients. Hepat Mon. 2025;25(1):e160428. doi: https://doi.org/10.5812/hepatmon-160428

25
Mar
2018
Arg677Trp and Arg753Gln Polymorphisms in <i>TLR2</i> Genes Detected in Patients With Tuberculosis in Golestan Province, Iran

Arg677Trp and Arg753Gln Polymorphisms in TLR2 Genes Detected in Patients With Tuberculosis in Golestan Province, Iran

Homa Davoodi,
Ezzat Allah. Ghaemi,
Ailar Jamali,
Javid S. Naeeme,
Fateme Shakeri

Davoodi H, Allah. Ghaemi E, Jamali A, Naeeme JS, Shakeri F. Arg677Trp and Arg753Gln Polymorphisms in TLR2 Genes Detected in Patients With Tuberculosis in Golestan Province, Iran. Jundishapur J Microbiol. 2018;11(4):e13933. doi: https://doi.org/10.5812/jjm.13933


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles