J Adv Immunopharmacol

Image Credit:J Adv Immunopharmacol

In Vitro Immunomodulatory Effects of Sugar-Free Sugarcane Molasses and Bifidobacterium animalis subsp. lactis on IFN-γ and TGF-β Secretion in Ulcerative Colitis Patients

Author(s):
Fatemeh Khalaf ShamsabadiFatemeh Khalaf Shamsabadi1, Mohsen MirzaeeMohsen Mirzaee1, Narges BaharifarNarges Baharifar2, Abolfazl SheikhAbolfazl Sheikh3, Sara SheikhiSara Sheikhi4, Nima AghamohammadiNima Aghamohammadi5, Forough Chamaie NejadForough Chamaie Nejad2, Narges NouraniNarges Nourani5, Vahid BaharifarVahid Baharifar2, Seyed Nouraddin MousavinasabSeyed Nouraddin MousavinasabSeyed Nouraddin Mousavinasab ORCID6, Abdolkarim SheikhiAbdolkarim SheikhiAbdolkarim Sheikhi ORCID2,*
1Department of Microbiology, Borujerd Branch, Islamic Azad University, Borujerd, Iran
2Department of Immunology, School of Medicine, Dezful University of Medical Sciences, Dezful, Iran
3Islamic Azad University of Dezful, Dezful, Iran
4School of Nursing and Midwifery, Iran University of Medical Sciences, Tehran, Iran
5Department of Internal Medicine, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
6Department of Biostatistics, School of Health Sciences, Mazandaran University of Medical Sciences, Sari, Iran

Journal of Advanced Immunopharmacology:Vol. 4, issue 1; e142990
Published online:Jan 14, 2024
Article type:Research Article
Received:Nov 20, 2023
Accepted:Nov 20, 2023
How to Cite:Khalaf Shamsabadi F, Mirzaee M, Baharifar N, Sheikh A, Sheikhi S, et al. In Vitro Immunomodulatory Effects of Sugar-Free Sugarcane Molasses and Bifidobacterium animalis subsp. lactis on IFN-γ and TGF-β Secretion in Ulcerative Colitis Patients. J Adv Immunopharmacol. 2024;4(1):e142990. doi: https://doi.org/10.5812/jai-142990

Abstract

Background:

Ulcerative colitis (UC) is an inflammatory bowel disease that leads to gastrointestinal ulcers. An overactive immune response against the intestinal microbiota has been suggested as one of the pathogenic factors. Some evidence indicates the immunomodulatory effects of Bifidobacterium lactis. sugarcane molasses, rich in vitamins and nutrients, can be used to compensate for the related nutrient deficiencies.

Objectives:

This study aims to evaluate the effects of sugar-free sugarcane (SFS)-molasses on the immune system of UC patients.

Methods:

Bifidobacterium lactis was cultivated in MRS broth and killed by UV de-sugarization of sugarcane molasses. It was prepared using the Steffen method. Peripheral blood mononuclear cells (PBMCs) of 12 UC patients were separated by Ficoll-Hypaque centrifugation. Peripheral blood mononuclear cells, SFS-molasses, and B. lactis were co-cultured. After 18h, the expression level of the FOXP3 gene was assessed by RT-qPCR (real-time PCR). The interferon gamma (IFN-γ) and transforming growth factor beta (TGF-β) were measured in the supernatant of PBMCs by ELISA.

Results:

Transforming growth factor beta in the SFS-molasses group was significantly increased compared to the controls (P = 0.032). The TGF-β in SFS-molasses + bacteria and the bacteria-alone groups increased compared to the control group (P = 0.039 and P = 0.049, respectively). The level of IFN-γ in the SFS-molasses group was significantly decreased compared to the controls (P = 0.004). Interferon gamma increased in the SFS-molasses + B. lactis group compared to the controls, but this was not significant. Expression of FOXP3 wasn’t affected after SFS-molasses treatment.

Conclusions:

These data showed that SFS molasses increases the levels of anti-inflammatory cytokine TGF-β and decreases the pro-inflammatory cytokine IFN-γ levels. These results may encourage researchers to continue studying the possible application of molasses as a nutritious food for patients with UC.

1. Background

Ulcerative colitis (UC) is an inflammatory bowel disease (IBD) that affects the intestines, especially the large intestine, including the colon and rectum. The etiology and pathogenesis of UC is mostly unknown (1). The disease begins with inflammation of the rectum and may reach the mucosa of the large intestine to varying degrees. Although the etiology of the disease is unclear, accumulating evidence suggests the involvement of several genetic and environmental factors, many of which have not yet been studied (2). It is hypothesized that UC is the result of the breakdown of tolerance to intestinal environmental antigens such as resident intestinal bacteria and changes in the barrier properties of the mucosal and epithelial layers. These changes allow luminal antigens to penetrate the intestinal mucosa and cause excessive production of pro-inflammatory cytokines and trafficking of leukocytes into the intestinal mucosa. This can eventually lead to out-of-controlled intestinal inflammation (3). Clinical signs of UC include bleeding and diarrhea, and in severe cases, systemic inflammatory reactions may also occur. In addition, more than 10% of UC patients develop non-intestinal symptoms, including joint involvement (enteropathic arthritis) and hepatobiliary problems, alongside cases of eye and skin lesions (4, 5).
Probiotics are increasingly being used to treat patients with UC. Probiotics are living nonpathogenic bacteria from which the intestinal and immune system can benefit. Some studies have shown that taking probiotics regularly and adequately at all ages is beneficial to health and prevents the persistence, replication, or pathogenicity of intestinal pathogens (6). Probiotics can improve local and systemic immunity, promote the secretion of anti-inflammatory factors, and increase intestinal mucosa barrier function. Probiotics can effectively maintain recovery in UC patients, indicating that optimization of intestinal microbiota is a key factor in the treatment of UC patients (7). Studies have also shown that different probiotics have different effects on the immune system. For instance, in our previous study, it was reported that Bifidobacterium lactis stimulated the secretion of anti-inflammatory cytokines more than Lactobacillus acidophilus. Still, it also induced the secretion of pro-inflammatory cytokines (8). In another study, it was reported that B. lactis stimulated the secretion of some anti-inflammatory cytokines but still increased the secretion of pro-inflammatory cytokines (9).
Molasses is a concentrated, dark, and viscous extract and a by-product in the process of preparing sugar from sugar beet or sugarcane. The quality of molasses depends on the ripening of the sugar beet, the amount of sugar extracted, and the extraction method. Despite the loss of most sucrose, molasses extract is rich in B vitamins and minerals, including iron, calcium, magnesium, potassium, manganese, and various other nutrients that can be needed due to the urgent need of patients with IBDs such as UC (10). Studies have shown that the use of molasses as a flavoring in food on the market not only increases sales but also reduces the harmful effects of artificial flavors (11).
It seems that IBDs can be caused by the insufficient suppression of immune responses by regulatory T cells (12). The forkhead box P3 (FOXP3) gene plays an important role in the development and function of regulatory T lymphocytes (CD4+ CD25+) (13). The FOXP3 gene provides instructions for producing the FOXP3 protein. The FOXP3 protein binds to specific regions of DNA and helps control the activity of genes that are involved in the regulation of the immune system (14).
There is extremely limited information on the effects of molasses on the immune system of patients with UC. In 2019, Shakurnia et al. investigated how the immune system of UC patients responds to molasses in vitro (11). Their results showed that sugarcane molasses added to B. lactis augments the secretion of TGF-β, the anti-inflammatory cytokine, by peripheral blood mononuclear cells (PBMCs) but does not decrease the level of TNF-α, the pro-inflammatory cytokine. Based on studies (15), the 30 - 40% sugar in the sugarcane molasses may be a trigger for inflammation.

2. Objectives

This study aimed to determine the effects of sugar-free molasses and B. lactis on the IFN-γ, TGF-β, and FOXP3 gene expression in the PBMCs of patients with UC.

3. Methods

3.1. Patients

Twelve patients with UC in the stable phase of the disease were enrolled in the Ganjavian Hospital, Dezful, Iran. These patients were diagnosed by a specialist based on colonoscopy and pathological indications. Of note, the patients were not in the acute phase of the disease and had not taken immunomodulatory drugs or corticosteroids for 4 weeks prior to colonoscopy. Moreover, this study was approved by the ethics committee of Dezful University of Medical Sciences, and all methods were performed in accordance with the relevant instructions and regulations.

3.2. Isolation of Peripheral Blood Mononuclear Cells

A volume of 10 mL of intravenous ethylenediaminetetraacetic acid (EDTA)--treated blood was collected from the patients. PBMCs were isolated using Ficoll (Baharafshan Co. Tehran) hypaque density gradient centrifugation. Whole blood was diluted with phosphate-buffered saline (PBS) solution (1:2 v/v). Then, the diluted blood was loaded on 3 mL of sterile Ficoll solution into the centrifuge tube, and then by centrifugation at 1000 g for 20 minutes, the PBMCs were separated. In the next step, the mononuclear cells were cultured in RPMI 1640 (10 mL), supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin (100 IU/mL) (Gibco, USA) at 37°C and 5% CO2.

3.3. Preparation of Bifidobacterium lactis

MRS broth (Merck, Darmstadt, Germany) culture media were prepared according to the manufacturer's instructions. Subsequently, it was divided into screw cap tubes and sterilized by autoclaving. The lyophilized B. lactis (DSM15954, Pishgaman Co. Tehran) was cultured in MRS broth under anaerobic conditions using the gas-pack method at 37°C for 48 hours. The tube containing the bacteria and medium was centrifuged at 3000 × g for 15 minutes. The supernatant was discarded, and the remaining pellet at the bottom of the tube was washed 3 times with PBS solution. Then, the bacterial concentration was determined by colony-forming unit (CFU) counts. Of note, in 1 mL of PBS solution in an optical density (OD) of 598 nm, when the absorption is 0.98, there are 1 × 109 CFU/mL bacteria, and thus the bacteria suspension was diluted by RPMI 1640 to reach the final concentration (16). Then, the tube containing the bacteria was exposed to ultraviolet (UV) light for 24 hours. The microbial suspension was then cultured on an MRS agar medium. After 48 hours under anaerobic conditions, no bacterial colonies were observed in the culture medium. This was an indication that UV had killed the bacterium. The microbial suspension was aliquoted in 2 mL microtubes and then stored in a freezer at -70°C.

3.4. Preparation of Sugar-Free Molasses

Sugarcane molasses was prepared from Caruncane Co. (Dezful, Iran). A volume of 10 mL of molasses was diluted with PBS solution (1:10, v/v), and then the sugar content of the molasses was depleted using the Steffen method (17). Of note, after the de-sugarization, the final sugar-free sugarcane (SFS) molasses had 0.1% sucrose. To standardize the method and its reproducibility, the dry weight of SFS molasses was determined. Three empty tubes were weighed separately by a sensitive digital scale. Next, 1 mL of SFS molasses was added to each tube. After 24 hours of incubating the tubes at 50°C, the SFS-molasses extract was completely dried, and then the three tubes were weighed again. Ultimately, the average dry weight of the molasses extract per mL was calculated. The final dry weight of SFS molasses was 300 μg/mL.

3.5. 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Assay

The effect of different concentrations of SFS-molasses on mononuclear cells was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The mononuclear cells were cultured in different concentrations of SFS molasses for 18 hours. The cells (2 × 105 cells/well) were also incubated in the absence of SFS molasses for 18 hours as a control. After that, 100 μL of MTT solution (0.5 mg/mL of culture media) was added, and the cells were incubated for 4 hours. Finally, 100 μL DMSO was added to each well, and OD was measured at 570 nm using a microplate reader (Awareness Technologies Stat Fax 2100, USA). The cell viability percentage was then measured using the formula:
% Cell viability = Absorbance of treated cells/Absorbance of control cells × 100

3.6. Co-culture of Mononuclear Cells with SFS-Molasses and Bifidobacterium lactis

The UC patients’ PBMCs (4 × 105 cells per well) were co-cultured with cell: Bacteria ratio 1: 50 and 300 μg/mL SFS-molasses in the final volume of 1.6 mL CM10 medium for 18 hours. Then, the six-well microplates were centrifuged at 800 × g for 5 minutes. Next, the supernatant of the co-cultures was aspirated and stored at -70°C until the cytokines were measured using the enzyme-linked immunosorbent assay (ELISA) method.

3.7. Measurement by ELISA

The tests were performed as indicated before and according to the instructions of the diagnostic kits. Zellbio ELISA kits (ZellBio GmbH, Germany) were used to measure IFN-γ and TGF-β (18).

3.8. Assessment of mRNA Expression by Real-time PCR

The RNA was extracted from PBMCs using TRIZOL reagent (ambion, life technologies) according to the manufacturer’s instructions. The concentration and quality were determined by spectrophotometry using a NanoDrop device (NanoDrop 2000c, Boston, New York, USA, thermo scientific). The mRNA expression level of target genes of treated and untreated (control) PBMCs was detected using one-step Syber PrimeScript RT-PCR (real-time PCR) (Takara, Japan) according to the manufacturer’s instructions. Briefly, RNA reverse transcription to cDNA using reverse transcriptase Prime script RTase and PCR amplification using Takara Ex Taq HS was done in one tube. Polymerase chain reaction amplification products were monitored in real-time with Syber Green I on light cycler 96 (Roche, Germany) qPCR thermal cycler. The target gene, FOXP3 primer: The forward TCTTCCTTGAACCCCATGCC and the reverse AAATGTGGCCTGTCCTGGAG TC along with the housekeeping gene, β-actin, the forward primer 5'-GAGCATCCCCCAAAG-3' and the reverse primer 5'-GGGACTTCCTGTAACAACGCA-3' were used. The results for mRNA expression of the FoxP3 gene were analyzed by performing the comparative ΔCt method. The mean ΔCt for the FoxP3 gene was obtained by normalization of the threshold cycle (Ct) value to β-actin control. Smaller ΔCt values indicate more expression of FoxP3. In detail, the qPCR thermal cycling program was set as follows: An initial denaturation step at 95°C for 15 minutes, a denaturation step at 95°C for 25 seconds, an annealing step at 58, 59, and 60°C (the 60°C was chosen) for 30 seconds, and an extension step at 72°C for 30 seconds followed by a final extension step at 72°C for 5 minutes. Finally, the quality of the DNA fragments was assessed on 1.5% agarose gel.

3.9. Gel Electrophoresis of the qPCR Products

To evaluate the quality of the PCR products, they were electrophoresed on 1.5% agarose gel (Figure 1).
The qPCR products of the <i>FOXP3</i> gene (133 bp), which were produced at 58, 59, and 60ºC electrophoresed on 1.5% agarose gel.
Figure 1.

The qPCR products of the FOXP3 gene (133 bp), which were produced at 58, 59, and 60ºC electrophoresed on 1.5% agarose gel.

3.10. Statistical Analysis

In this study, the significant differences between IFN-γ and TGF-β of non-treated and treated PBMCs with SFS-molasses were analyzed with Student’s t-test and ANOVA, and statistical significance was considered as P < 0.05. Statistical analyses were carried out using SPSS 19 (SPSS Inc., Chicago, IL, USA).

4. Results

4.1. The Effect of Sugar-Free Sugarcane-Molasses and Bifidobacterium lactis + SFS-Molasses on the Secretion of Interferon Gamma and Transforming Growth Factor Beta by Peripheral Blood Mononuclear Cells

MTT assay showed that the percentage of viable PBMCs after co-culture with SFS-molasses (13.5 μg/mL) was not changed compared to the control group (not shown). Therefore, it was concluded that SFS molasses did not have any toxic effects on the PBMCs. As shown in Table 1 and Figure 2, the secretion of the anti-inflammatory cytokine TGF-β in the SFS-molasses group was significantly increased compared to the control group (P = 0.032). The secretion of TGF-β in SFS-molasses + bacteria and the bacteria alone groups increased compared to the control group (P = 0.039 and P = 0.049, respectively).
Table 1.Evaluation of the Effect of SFS-Molasses, Bifidobacterium lactis, and B. lactis + Sugar-Free Sugarcane -Molasses on the Interferon Gamma and Transforming Growth Factor Beta Secretion by the Peripheral Blood Mononuclear Cells of Ulcerative Colitis Patients Assessed by ELISA a
Bacteria: Cell RatioSFS-Molasses μg/mLTGF-β (pg/mL)IFN-γ (pg/mL)
SFS-molasses-300 μg/mL932.85 ± 386.7023.72 ± 8.09
SFS-molasses+ B. lactis50:1300 μg/mL815.15 ± 373.13181.36 ± 61.41
B. lactis50:1-751.12 ± 95.10245.01 ± 50.01
Control--690.37 ± 306.74119.05 ± 13.49

Abbreviations: SD, standard deviation; B. lactis, Bifidobacterium lactis.

a Data are presented as mean ± SD.

The effect of SFS-molasses (300 µg/mL), <i>Bifidobacterium lactis</i>, and <i>B. lactis</i> + SFS-molasses on the secretion of TGF-β by PBMCs at the bacteria-to-cell ratio of 50:1 after 18 hours of incubation. *: Significant.
Figure 2.

The effect of SFS-molasses (300 µg/mL), Bifidobacterium lactis, and B. lactis + SFS-molasses on the secretion of TGF-β by PBMCs at the bacteria-to-cell ratio of 50:1 after 18 hours of incubation. *: Significant.

In addition, the secretion of IFN-γ in the SFS-molasses group was significantly reduced compared to the controls (P = 0.004). IFN-γ secretion increased in the SFS-molasses + B. lactis group compared to the control group, but it was not significant (Figure 3).
The effect of SFS-molasses (300 µg/mL), <i>Bifidobacterium lactis</i>, and <i>B. lactis</i> + SFS-molasses on the secretion of IFN-γ by PBMC at the bacteria-to-cell ratio of 50:1 after 18 hours of incubation. *: Significant.
Figure 3.

The effect of SFS-molasses (300 µg/mL), Bifidobacterium lactis, and B. lactis + SFS-molasses on the secretion of IFN-γ by PBMC at the bacteria-to-cell ratio of 50:1 after 18 hours of incubation. *: Significant.

4.2. The Effect of Sugar-Free Sugarcane-Molasses and Bifidobacterium lactis + SFS-Molasses on the Expression of the FOXP3 Gene

The results represented in Table 2 and Figure 4 show that there was no significant relationship between the expression of the FOXP3 gene in the SFS-molasses group compared to the control group (P = 0.269). Also, the results indicated that there was no significant relationship between the expression of the FOXP3 gene in the SFS-molasses + B. lactis group compared to the control group (P = 0.302).
Table 2.The Effect of Different Treatments on the Expression Profile of the FOXP3 Gene a
VariablesGroup
ControlSFS-MolassesSFS-Molasses + Bifidobacterium lactis
Ct (β-Actin)22.003 ± 2.83120.241 ± 5.10622.769 ± 6.254
Ct (FOXP3)30.153 ± 4.45430.346 ± 5.07832.739 ± 4.538
ΔCt8.150 ± 2.860010.105 ± 4.9519.970 ± 4.047

Abbreviation: Ct, threshold cycle.

a Data are presented as mean ± SD.

The expression level of the <i>FOXP3</i> gene in the control, SFS-molasses (300 µg/mL), and SFS-molasses + <i>Bifidobacterium lactis</i> groups of the PBMCs of UC patients. <i>B. lactis</i>, <i>Bifidobacterium</i>
Figure 4.

The expression level of the FOXP3 gene in the control, SFS-molasses (300 µg/mL), and SFS-molasses + Bifidobacterium lactis groups of the PBMCs of UC patients. B. lactis, Bifidobacterium

5. Discussion

Ulcerative colitis is a recurrent and inflammatory disorder of the gastrointestinal tract. Between 20% and 85% prevalence of malnutrition has been reported in patients with UC (19).
Although the immunopathogenesis of UC remains unclear, current evidence indicates that altered T cell response to intestinal environmental antigens disrupts the balance of the mucosal immune system and causes inflammation in the intestine, which leads to chronic diarrhea and, finally, malnutrition. Nutrient (e.g., vitamin and mineral) deficiencies in patients with UC occur via several mechanisms (e.g., insufficient intake, impaired absorption via inflamed or functionally impaired epithelia). They may complicate and prolong the course of the disease (20, 21).
Sugarcane molasses, the final effluent of sugar refinement, is a concentrated and viscous substance full of vitamins, minerals, and antioxidants that could be a good supplement for nutritional deficits. Still, its effect on the immune system of UC patients is almost unknown (22-24).
The Shakurnia et al. study showed that sugarcane molasses augments both the anti-inflammatory and pro-inflammatory cytokines by PBMCs of UC patients (11). Other evidence indicates that the inflammatory responses of mononuclear cells to sugarcane molasses may be due to the high sugar concentration in molasses (11, 15, 25). The Shakurnia et al. study showed that sugarcane molasses caused a significant increase in TGF-β compared to the control group. On the other hand, not only did the combination of molasses and B. lactis increase TGF-β levels, but it also increased the secretion of the proinflammatory cytokine TNF-α. The amount of sugar in sugarcane molasses can vary between 30% to 40%, depending on its type. The main sugar is sucrose, but a small amount of glucose and fructose can also be present. Therefore, in the present study, we isolated the sugar in vitro using the Steffen method to reach 0.1% sugar in de-sugarized SFS-molasses. For the first time, its effect on the immune response of the PBMCs in patients with UC was investigated.
This study showed that SFS-molasses alone and the combination of SFS-molasses + B. lactis significantly increased the secretion of TGF-β in comparison with the control group. However, in the SFS-molasses group, the increase in the secretion of TGF-β was greater than that of the combination of SFS-molasses + B. lactis. In addition, SFS-molasses reduced IFN-γ secretion by PBMCs in comparison with the control group.
Transforming growth factor beta is a multifunctional cytokine whose main function is to regulate inflammatory processes, especially in the intestine. Therefore, up-regulation of TGF-β secretion by PBMCs after treatment with SFS molasses could be directly related to the anti-inflammatory effects of SFS molasses (26).
In the present study, the combination of B. lactis and SFS-molasses significantly increased TGF-β levels.
Regarding the pro-inflammatory effects, although B. lactis caused a significant increase in the level of IFN-γ, the combination of B. lactis and SFS molasses did not increase the secretion of IFN-γ significantly. Interferon gamma is one of the important cytokines whose secretion is closely related to the balance of T lymphocyte response (27). Our previous study (8) that compared the stimulatory effects of L. acidophilus and B. lactis on the PBMCs of patients with UC demonstrated that B. lactis had a better regulatory effect (although it had both pro-inflammatory and anti-inflammatory properties). The current study demonstrated that the pro-inflammatory effects of B. lactis were modified by adding SFS molasses (Figure 3).
Although this study confirmed the effects of SFS molasses on modulating immune responses, the FOXP3 gene was expected to be upregulated. Still, its expression did not show any increase compared to the control group. This can be due to several reasons. First, it is possible that the small number of patients enrolled in the study was insufficient to make a statistically significant difference. Moreover, factors other than FOXP3 may also be involved in regulatory T-cell activity. It is also possible that the method of separating sugar from molasses (Stephen's method) in the laboratory interfered with the expression of the FOXP3 gene. Unfortunately, we could not measure the effect of B. lactis alone on the expression of the FOXP3 gene in this study.
In the present study, due to the small sample size and the insufficient number of mononuclear cells isolated from the patient’s blood, it was not possible to investigate the dose- and time-dependent effect of SFS-molasses, the SFS-molasses + B. lactis, and the bacteria alone on the TGF-β and IFN-γ levels. Therefore, future studies with larger blood sample volumes are warranted to investigate this.
Despite the mentioned limitations, this study showed that SFS molasses increases the anti-inflammatory cytokine TGF-β and decreases the pro-inflammatory cytokine IFN-γ. When SFS-molasses and B. lactis were added together to the mononuclear cells, the SFS-molasses reduced the inflammatory effect of the bacteria. Therefore, based on these results, further investigation is warranted to determine if molasses can be a beneficial nutrient for ulcerative colitis patients.

Acknowledgments

Footnotes

References

  • 1.
    Gajendran M, Loganathan P, Jimenez G, Catinella AP, Ng N, Umapathy C, et al. A comprehensive review and update on ulcerative colitis(). Dis Mon. 2019;65(12):100851. [PubMed ID: 30837080]. https://doi.org/10.1016/j.disamonth.2019.02.004.
  • 2.
    Corridoni D, Antanaviciute A, Gupta T, Fawkner-Corbett D, Aulicino A, Jagielowicz M, et al. Single-cell atlas of colonic CD8(+) T cells in ulcerative colitis. Nat Med. 2020;26(9):1480-90. [PubMed ID: 32747828]. https://doi.org/10.1038/s41591-020-1003-4.
  • 3.
    Imam T, Park S, Kaplan MH, Olson MR. Effector T helper cell subsets in inflammatory bowel diseases. Front Immunol. 2018;9:1212. [PubMed ID: 29910812]. [PubMed Central ID: PMC5992276]. https://doi.org/10.3389/fimmu.2018.01212.
  • 4.
    Fumery M, Singh S, Dulai PS, Gower-Rousseau C, Peyrin-Biroulet L, Sandborn WJ. Natural history of adult ulcerative colitis in population-based cohorts: A systematic review. Clin Gastroenterol Hepatol. 2018;16(3):343-356 e3. [PubMed ID: 28625817]. [PubMed Central ID: PMC6658168]. https://doi.org/10.1016/j.cgh.2017.06.016.
  • 5.
    Tripathi K, Feuerstein JD. New developments in ulcerative colitis: Latest evidence on management, treatment, and maintenance. Drugs Context. 2019;8:212572. [PubMed ID: 31065290]. [PubMed Central ID: PMC6490072]. https://doi.org/10.7573/dic.212572.
  • 6.
    Cui HH, Chen CL, Wang JD, Yang YJ, Cun Y, Wu JB, et al. Effects of probiotic on intestinal mucosa of patients with ulcerative colitis. World J Gastroenterol. 2004;10(10):1521-5. [PubMed ID: 15133865]. [PubMed Central ID: PMC4656296]. https://doi.org/10.3748/wjg.v10.i10.1521.
  • 7.
    Leccese G, Bibi A, Mazza S, Facciotti F, Caprioli F, Landini P, et al. Probiotic lactobacillus and bifidobacterium strains counteract adherent-invasive Escherichia coli (AIEC) virulence and hamper IL-23/Th17 axis in ulcerative colitis, but not in crohn's disease. Cells. 2020;9(8). [PubMed ID: 32752244]. [PubMed Central ID: PMC7464949]. https://doi.org/10.3390/cells9081824.
  • 8.
    Sheikhi A, Shakerian M, Giti H, Baghaeifar M, Jafarzadeh A, Ghaed V, et al. Probiotic yogurt culture bifidobacterium animalis Subsp. Lactis BB-12 and lactobacillus acidophilus LA-5 modulate the cytokine secretion by peripheral blood mononuclear cells from patients with ulcerative colitis. Drug Res (Stuttg). 2016;66(6):300-5. [PubMed ID: 26909690]. https://doi.org/10.1055/s-0035-1569414.
  • 9.
    Bozkurt HS, Kara B. A new treatment for ulcerative colitis: Intracolonic bifidobacterium and xyloglucan application. Eur J Inflamm. 2020;18. https://doi.org/10.1177/2058739220942626.
  • 10.
    Panda H. The complete book on sugarcane processing and by-products of molasses (with analysis of sugar, syrup and molasses): How is sugar made from sugarcane?, how sugar cane is made, how sugar is made, how to make sugar from sugar cane, how to make sugar from sugarcane, how to manufacture sugar from sugarcane, how to start a successful sugarcane processing business, how to start a sugar manufacturing business, how to start a sugar production business, how to start a sugarcane processing?, how to start and make profit from sugar-cane, how to start process of making sugar from sugarcane. Asia Pacific Business Press Inc; 2011.
  • 11.
    Shakurnia A, Sheikhi A, Mirzapour M, Baharifar V, Baharifar N, Aghamohammadi N, et al. Sugarcane molasses enhances TGF-beta secretion and FOXP3 gene expression by Bifidobacterium Animalis Subsp. Lactis stimulated PBMCs of Ulcerative Colitis patients. Complement Ther Med. 2019;47:102210. [PubMed ID: 31780030]. https://doi.org/10.1016/j.ctim.2019.102210.
  • 12.
    Sakaguchi S, Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T. Regulatory T cells: How do they suppress immune responses? Int Immunol. 2009;21(10):1105-11. [PubMed ID: 19737784]. https://doi.org/10.1093/intimm/dxp095.
  • 13.
    Hori S, Sakaguchi S. Foxp3: a critical regulator of the development and function of regulatory T cells. Microbes Infect. 2004;6(8):745-51. [PubMed ID: 15207821]. https://doi.org/10.1016/j.micinf.2004.02.020.
  • 14.
    Xia SL, Ying SJ, Lin QR, Wang XQ, Hong WJ, Lin ZJ, et al. Association of ulcerative colitis with FOXP3 gene polymorphisms and its colonic expression in chinese patients. Gastroenterol Res Pract. 2019;2019:4052168. [PubMed ID: 30918515]. [PubMed Central ID: PMC6409000]. https://doi.org/10.1155/2019/4052168.
  • 15.
    Kang GG, Trevaskis NL, Murphy AJ, Febbraio MA. Diet-induced gut dysbiosis and inflammation: Key drivers of obesity-driven NASH. iScience. 2023;26(1):105905. [PubMed ID: 36691622]. [PubMed Central ID: PMC9860397]. https://doi.org/10.1016/j.isci.2022.105905.
  • 16.
    Oliveira LF, Salvador SL, Silva PH, Furlaneto FA, Figueiredo L, Casarin R, et al. Benefits of Bifidobacterium animalis subsp. lactis probiotic in experimental periodontitis. J Periodontol. 2017;88(2):197-208. [PubMed ID: 27660886]. https://doi.org/10.1902/jop.2016.160217.
  • 17.
    Asadollahi S, Khodaparast MHH. Optimization of molasses desugarization process using steffen method in sugar beet factories. Int J Nutr Food Eng. 2013;7:1063-9.
  • 18.
    Sheikhi A, Nazarian M, Khadem-Al-Melleh A, Nasab NM, Esmaeilzadeh A, Yahaghi N, et al. In-vitro effects of Mycobacterium bovis BCG-lysate and its derived heat shock proteins on cytokines secretion by blood mononuclear cells of rheumatoid arthritis patients in comparison with healthy controls. Int Immunopharmacol. 2008;8(6):887-92. [PubMed ID: 18442794]. https://doi.org/10.1016/j.intimp.2008.01.034.
  • 19.
    Massironi S, Viganò C, Palermo A, Pirola L, Mulinacci G, Allocca M, et al. Inflammation and malnutrition in inflammatory bowel disease. Lancet Gastroenterol Hepatol. 2023;8(6):579-90. https://doi.org/10.1016/s2468-1253(23)00011-0.
  • 20.
    Ghishan FK, Kiela PR. Vitamins and minerals in inflammatory bowel disease. Gastroenterol Clin North Am. 2017;46(4):797-808. [PubMed ID: 29173522]. [PubMed Central ID: PMC6342481]. https://doi.org/10.1016/j.gtc.2017.08.011.
  • 21.
    Han PD, Burke A, Baldassano RN, Rombeau JL, Lichtenstein GR. Nutrition and inflammatory bowel disease. Gastroenterol Clin North Am. 1999;28(2):423-43. ix. [PubMed ID: 10372275]. https://doi.org/10.1016/s0889-8553(05)70063-7.
  • 22.
    Asikin Y, Takahashi M, Mizu M, Takara K, Oku H, Wada K. DNA damage protection against free radicals of two antioxidant neolignan glucosides from sugarcane molasses. J Sci Food Agric. 2016;96(4):1209-15. [PubMed ID: 25865605]. https://doi.org/10.1002/jsfa.7208.
  • 23.
    Jain R, Venkatasubramanian P. Sugarcane molasses - a potential dietary supplement in the management of iron deficiency anemia. J Diet Suppl. 2017;14(5):589-98. [PubMed ID: 28125303]. https://doi.org/10.1080/19390211.2016.1269145.
  • 24.
    Magalhaes AJ, de Carvalho JC, de Carvalho Neto DP, Soccol CR. Are sugarcane molasses competitive substrates for bio-based platform chemicals? J Agric Food Chem. 2020;68(14):4073-4. [PubMed ID: 32208654]. https://doi.org/10.1021/acs.jafc.0c01519.
  • 25.
    Ahsan M, Koutroumpakis F, Rivers CR, Wilson AS, Johnston E, Hashash JG, et al. High sugar-sweetened beverage consumption is associated with increased health care utilization in patients with inflammatory bowel disease: A multiyear, prospective analysis. J Acad Nutr Diet. 2022;122(8):1488-1498 e1. [PubMed ID: 34999242]. https://doi.org/10.1016/j.jand.2022.01.001.
  • 26.
    Li J, Ma Y, Li X, Wang Y, Huo Z, Lin Y, et al. Fermented Astragalus and its metabolites regulate inflammatory status and gut microbiota to repair intestinal barrier damage in dextran sulfate sodium-induced ulcerative colitis. Front Nutr. 2022;9:1035912. [PubMed ID: 36451737]. [PubMed Central ID: PMC9702530]. https://doi.org/10.3389/fnut.2022.1035912.
  • 27.
    Yang F, Wang D, Li Y, Sang L, Zhu J, Wang J, et al. Th1/Th2 balance and Th17/Treg-mediated immunity in relation to murine resistance to dextran sulfate-induced colitis. J Immunol Res. 2017;2017:7047201. [PubMed ID: 28584821]. [PubMed Central ID: PMC5444015]. https://doi.org/10.1155/2017/7047201.

Similar Articles

31
Oct
2013

Probiotic yogurt Affects Pro- and Anti-inflammatory Factors in Patients with Inflammatory Bowel Disease

Mahdi Shadnoush,
Rahebeh Shaker Hosseini,
Yadollah Mehrabi,
Ali Delpisheh,
Elham Alipoor,
Zeinab Faghfoori
,et al.

Shadnoush M, Shaker Hosseini R, Mehrabi Y, Delpisheh A, Alipoor E, et al. Probiotic yogurt Affects Pro- and Anti-inflammatory Factors in Patients with Inflammatory Bowel Disease. Iran J Pharm Res. 2013;12(4):e125761. doi: https://doi.org/10.22037/ijpr.2013.1351

6
Jun
2026

Replacing White Sugar with Brown Sugar in the Diet of Patients with Type 2 Diabetes Reduces HbA1c and Inflammatory Cytokines

Mehdi Sheikhi,
Majid Mirzapour,
Mehdi Matinrad,
Ali Rahimikhah,
Narges Baharifar,
Forough Chamaie Nejad
,et al.

Sheikhi M, Mirzapour M, Matinrad M, Rahimikhah A, Baharifar N, et al. Replacing White Sugar with Brown Sugar in the Diet of Patients with Type 2 Diabetes Reduces HbA1c and Inflammatory Cytokines. J Adv Immunopharmacol. 2025;5(2):e172106. doi: https://doi.org/10.69107/jai-172106

26
Jul
2018

Anti-Inflammatory Effect of Ocimum Basilicum Linn. Seeds Hydroalcoholic Extract and Mucilage on Acetic Acid-Induced Colitis in Rats

Fahimeh Saeidi,
Sayed-Ebrahim Sajjadi,
Mohsen Minaiyan

Saeidi F, Sajjadi S, Minaiyan M. Anti-Inflammatory Effect of Ocimum Basilicum Linn. Seeds Hydroalcoholic Extract and Mucilage on Acetic Acid-Induced Colitis in Rats. J Rep Pharm Sci. 2018;7(3):e147498. doi:

4
Feb
2017

Effect of the Aquatic Extract of Stevia on the Serum Level of Interleukin-6 in Streptozotocin-Nicotinamide Induced Diabetic Rats

Elahe Bayat,
Sanaz Dastgheib,
Somaye Egdar,
Pooneh Mokarram

Bayat E, Dastgheib S, Egdar S, Mokarram P. Effect of the Aquatic Extract of Stevia on the Serum Level of Interleukin-6 in Streptozotocin-Nicotinamide Induced Diabetic Rats. Shiraz E-Med J. 2017;18(2):e45015. doi: https://doi.org/10.17795/semj45015

15
Aug
2003

An investigation upon the effectiveness of LVA-7220 as an immunomodulator on chronic ulcerative colities in rats

Ali khodadadi,
Abbas MirSharifi,
MohammadBagher Eslami,
AliReza Razavi,
Khadije Hekmat

khodadadi A, MirSharifi A, Eslami M, Razavi A, Hekmat K. An investigation upon the effectiveness of LVA-7220 as an immunomodulator on chronic ulcerative colities in rats. koomesh. 2003;4(3):e151983. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles