J Compr Ped

Image Credit:J Compr Ped

Analysis of Association Between the Effects of Methylphenidate and DRD4 Gene Polymorphisms in Patients with Attention Deficit Hyperactivity Disorder

Author(s):
Shahrokh  AmiriShahrokh AmiriShahrokh  Amiri ORCID1, Sara FarhangSara Farhang1, 2, Mahmoud  Shekari KhanianiMahmoud Shekari Khaniani3, Sima  Mansouri DerakhshanSima Mansouri Derakhshan3, Aziz ZadfattahAziz Zadfattah1, Zahra  Mohammadi BinaZahra Mohammadi Bina1, Fatemeh  GhazipourFatemeh Ghazipour1, Narges SardariNarges Sardari1, Habibeh  BarzegarHabibeh BarzegarHabibeh  Barzegar ORCID1, Leila Mehdizadeh FanidLeila Mehdizadeh FanidLeila Mehdizadeh Fanid ORCID4,*
1Research Center of Psychiatry and Behavioral Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
2Rob Giel Research Center, University Medical Center Groningen, University Center of Psychiatry, Groningen, The Netherlands
3Tabriz University of Medical Science, Tabriz, Iran
4Division of Cognitive Neuroscience, Department of Psychology, Faculty of Education and Psychology, University of Tabriz, Tabriz, Iran

Journal of Comprehensive Pediatrics:Vol. 12, issue 4; e109377
Published online:Dec 04, 2021
Article type:Research Article
Received:Oct 27, 2020
Accepted:Oct 19, 2021
How to Cite:Amiri S, Farhang S, Shekari Khaniani M, Mansouri Derakhshan S, Zadfattah A, et al. Analysis of Association Between the Effects of Methylphenidate and DRD4 Gene Polymorphisms in Patients with Attention Deficit Hyperactivity Disorder. J Compr Ped. 2021;12(4):e109377. doi: https://doi.org/10.5812/compreped.109377

Abstract

Background:

Drug treatment is one of the most important treatments for attention deficit hyperactivity disorder (ADHD). The DRD4 gene is a transporter and receptor coding gene of dopamine and is one of the most important genes under investigation in the disorder and etiology of ADHD. In this study, the association between rs3758653 C/T and VNTR exon 3 repetition polymorphisms of the DRD4 gene and the effects of methylphenidate were investigated in patients with ADHD disorder consuming methylphenidate.

Methods:

The descriptive-analytical study was performed on 122 patients (5 - 18 years old) with ADHD who were treated with methylphenidate. DNA was extracted using salting out method. Subsequently, the rs3758653 polymorphism in the 5'UTR region of DRD4 gene was genotyped by PCR-RFLP method, and the VNTR fragment in exon III of DRD4 gene was investigated by electrophoresis gel on acrylamide gel method. After eight weeks from the start of drug treatment with methylphenidate, the intensity of symptoms was evaluated using the Conners scale. Finally, all data from questionnaires and information that were resulted from laboratory findings were analyzed using ANOVA and repeated measure analysis.

Results:

Of the 122 patients under study, 15 patients (12.3%) were responded to the drug treatment, and 107 patients (87.7%) were not responded. The significant differences were not revealed in genotype, and allele frequencies of between rs3758653 (C/T) and exon III 3'VNTR repeats polymorphisms of the DRD4 gene and responder and non-responder of ADHD groups to the drug treatment.

Conclusions:

The results showed that the reduction of ADHD symptoms with drug treatment is not related to DRD4 sub-types in patients with ADHD.

1. Background

Attention deficit hyperactivity disorder (ADHD) is one of the most common psychiatric problems in school age children (1). ADHD is a complex and heterogeneous disorder with unknown etiology (2, 3). In other words, ADHD is considered a multifactorial disorder, and its contributing factors include psychological, environmental, and genetic factors (4). Many studies suggest that an important factor of the pathogenesis of hyperactivity disorder may be a genetic factor. Also, data obtained from families and twins indicate that ADHD has genetic background, and 80% of genetic factors are involved in the phenotype of the disease (5).
Drug treatment is one of the most important treatments for ADHD. Drugs used as primary treatment for ADHD affect the dopaminergic system, so transporter and dopamine receptor coding genes are the most important genes under study in this disorder (6). The psycho-stimulant methylphenidate is the most frequently used medication to treat ADHD. Several studies have investigated the benefits of methylphenidate, showing possible favorable effects on ADHD symptoms. Therefore, the genes related to this system have been really considered in different studies (7).
Dopamine receptor D4 (DRD4) is one of the places of interest for investigating and studying the etiology of ADHD. The gene is located on chromosome 11p15.5 (8). The most widely studied gene in the dopaminergic pathway is the dopamine receptor D4, which is encoded by the DRD4 gene; among the most explored genetic variables are the variable number tandem repeats (VNTR), located in exon III of this gene. However, studies that evaluated single nucleotide polymorphisms (SNPs) are scarce. In addition to this SNP, one SNP is located in the promoter region (rs3758653).
DRD4 gene that is expressed in several brain areas has also been investigated in relation to ADHD (9). Linkage mapping shows the locus of the gene on chromosome 11p15.5 (10). This gene has several polymorphisms in its nucleotide sequence. The 48-base pair variable number tandem repeats (VNTR) in exon III of DRD4 polymorphism is the most studied polymorphism in association with ADHD. Biological molecular studies show that this region couples with G-protein, modulating cAMP production (Van Tol & Guan, 1992). VNTRs are repeat sequences with varying lengths and can have 2 - 11 repeats, but their common variants are 7, 4, 2 (11). Recent studies have shown that the 7-repeat variant has a weaker response to dopamine than other variants (11). Therefore, there is a positive relationship between the 7-repeat allele and ADHD disorder, but some studies do not show a relationship between them.
The cause of this inconsistency in the results is not well established yet. It has not been determined whether the differences in reported results have been due to differences in sampling groups, genetics, and heterogeneity, or weaknesses in the interpretation of the statistical tests, or indeed represent a real difference between different populations.

2. Objectives

Because of the contradictory results, the current study was performed to examine the potential role of DRD4 gene polymorphisms in ADHD patients using methylphenidate for the treatment.

3. Methods

The descriptive-analytical study was performed on ADHD patients, aged 5 - 18 years, in Tabriz, Iran during 2016, who were referred to child and adolescent psychiatry clinic in this city for receiving psychiatric services and needed drug treatment.
The sampling was accomplished based on convenience method with regards to the inclusion and exclusion criteria. Patients with ADHD were included in the study based on criteria specified in the DSM-IV-TR, by getting interviewed by a child and adolescent psychiatrist, and semi-structured interview form of PL-SADS-K in the age range of 5 to 18 years after parental consent. In addition, a semi-structured K-SADS diagnostic questionnaire designed according to R-III-DSM and IV-DSM criteria were completed by a psychiatrist through interviews with parents and participants. Finally, patients with a history of head trauma, major psychiatric simultaneity disorder, epilepsy, serious medical illness, and mental retardation were excluded. Eventually, a group of children (𝑛 = 122) with ADHD disorder was selected.
The reliability of the Persian version of this test with the retest method studied by Ghanizadeh et al. was reported 0.81 and 0.69 inter-rater (12). Also, in this study, the ADHD rating scale questionnaire and parental form were used to differentiate ADHD children from the clinical control group, attention deficit symptoms of hyperactivity and impulsivity symptoms, and to differentiate different types of ADHD. The validity and reliability of the questionnaire were reported above 0.75 (13).
After completing the questionnaires by the parents and the patients, 4 mL of peripheral blood were obtained from each child, and DNA extraction was performed using salting out method and subsequently used as a template for determination of DRD4 gene genotypes. Genotyping rs3758653 polymorphism in the 5'UTR region of DRD4 gene was investigated by using PCR-RFLP method. PCR products were digested with Ecor I restrictive enzyme (Table 1).
Table 1.Primers Sequences of rs3758653 Polymorphism and VDTR Exon 3 of DRD4 Gene
Primer Sequencing (5’→3’)Product Size
rs3758653264bp
FAGAGTGGTGCCCCCTTTTAG
RCAAGACCGTGAGCTAGGTAGG
Exon III VNTROne repeat: 600 bp; two repeat: 700 bp; four repeat: 800 bp; five repeat: 850 bp; six repeat: 900 bp
FCGTACTGTGCGGCCTCAACGA
RGACACAGCGCCTGCGTGATGT
The polymorphism of VNTR fragment in exon III of DRD4 gene was investigated by electrophoresis gel on acrylamide gel method. In this method, the genotype of each individual is obtained by comparing the size of the DNA marker, which is loaded on the gel with the sample. The size of the bands will also change as the number of repeats from person to person.
All of the ADHD subjects were administered methylphenidate (Ritalin®) for eight weeks. The dosages were enhanced up to a sufficient dose to accomplish the therapeutic effect, established by the parents’ reports of symptom improvement and side effects. Subsequently, these dosage levels were maintained for eight weeks. Eight weeks after the start of drug treatment with methylphenidate (Ritalin®), the intensity of symptoms was evaluated using the Conners scale for the second time. Response to the treatment was defined as at the least 50% decrease in Conners score (14). Finally, all data from questionnaires and information that were resulted from laboratory findings were analyzed using ANOVA and repeated measure analysis.

4. Results

The study was implemented on 122 patients with ADHD disorder (Table 2). The ADHD rating scale questionnaire was evaluated before starting the study, and its mean score in patients was obtained 28.5 ± 11.96. The mean intensity of symptoms was calculated as 44.98 ± 16.99 in investigating patients with Conners questionnaire.
Table 2.Demographic Characteristics of Patients with ADHD a
VariablesValues
Gender
Male118 (15.7)
Female22 (84.3)
Age9.05 ± 2.88
Weight31.6 ± 12.9
Conner’s rating scale44.98 ± 16.9
Psychiatric comorbidity12 (8.6)
Major depressive disorder1 (0.7)
Obsessive compulsive disorder1 (0.7)
Tic disorder2 (1.4)
Anxiety disorder3 (2.1)
Oppositional defiant disorder5 (3.6)

aValues are expressed as No. (%) or mean ± SD.

In rs3758653 polymorphism, three genotypes of TT (normal), TC (heterozygote), and CC (mutant) can be identified in different individuals. Genotypes of TT were homozygous dominant, while CC were homozygous recessive. The frequency of CC homozygous recessive in ADHD patients was 16 children (13.11%). Also, the frequency of the most common form of the exon III VNTR polymorphism (2705 bp repetition) was observed in 93 children (76.22%) (Tables 3 and 4).
Table 3.Allele and Genotype Frequencies of rs3758653 Polymorphism of DRD4 Gene Among Responder ADHD Patients in Comparison to Non-responder ADHD Patients to Methylphenidate Treatment a
Genotype/Allele (rs3758653)Responder (n = 15)Non-responder (n = 107)OR (95%CI)P-Value
CC2 (1.6)14 (14)0.646 (0.064 – 4.553)0.634
CT9 (7.4)51 (41.8)1 (reference)
TT4 (3.3)42 (34.4)0.109 (0.576 – 0.602)0.377
C13 (4.33)79 (36.91)1.307 (0.293 – 5.672)0.689
T17 (5.66)135 (63.08)1 (reference)

aValues are expressed as No. (%).

Table 4.Allele Frequencies of Exon III VNTR of DRD4 Gene Among Responder ADHD Patients in Comparison to Non-responder ADHD Patients to Methylphenidate Treatment a
Genotype/Allele (Exon III VNTR)Responder (n = 15)Non-responder (n = 107)OR (95%CI)P-Value
1R2 (1.7)8 (6.6)2.104 (0.211 – 19.923)0.418
2R10 (8.3)83 (67.8)1 (reference)
4R2 (1.7)7 (5.8)2.394 (0.235 – 18.865)0.344
5R0 (0)1 (0.8)0.00 (0.00 – 340.157)0.754
6R0 (0)2 (1.7)0.00 (0.00 – 52.089)0.649
Hetero 1,2R0 (0)2 (1.7)0.00 (0.00 – 52.089)0.649
Hetero 1,3R1 (0.8)1 (1.6)4.084 (0.064 – 95.845)0.285
Hetero 2,4R0 (0)3 (1.6)0.00 (0.00 – 57.0804)0.658

aValues are expressed as No. (%).

No significant relationship was observed between alleles and genotype frequencies of rs3758653 polymorphism and exon III VNTR with responding to drug therapy among responder and non-responder ADHD groups.
Among 122 ADHD children, 107 (87.7%) patients did not respond appropriately to drug treatment (non-responder group), and 15 (12.3%) patients were responded appropriately (responder). Among the non-responder group, 51 (41.8%) patients showed CT genotype of rs3758653 polymorphism, and 83 (67.8%) patients showed two repeat alleles of exon III VNTR (Figures 1 and 2).
Genotype frequencies for <i>DRD4</i><i>rs3758653</i> polymorphism in children with ADHD regarding response to treatment with methylphenidate.
Figure 1.

Genotype frequencies for DRD4rs3758653 polymorphism in children with ADHD regarding response to treatment with methylphenidate.

Allele frequencies for exon III VNTR of <i>DRD4</i> gene in children with ADHD regarding response to treatment with methylphenidate.
Figure 2.

Allele frequencies for exon III VNTR of DRD4 gene in children with ADHD regarding response to treatment with methylphenidate.

5. Discussion

Early treatment of ADHD can prevent many of its complications. Because of reasons which have not been determined yet, the response to treatment is not the same in patients with ADHD. In this regard, D4 receptors regulate a number of signaling events, including adenylate cyclase inhibition, stimulation of arachidonic acid release, and modification of potassium channels. The DRD4 gene contains four exons and encodes a 387-amino acid protein. The gene is highly expressed in pyramidal, frontal cortex, and retinal neurons, but the intensity of its expression is low in basal ganglia, hippocampus, and thalamus. The relationship between the types of genetic variants in DRD4 sequences has been investigated along with a variety of neurological diseases, and its relationship with ADHD disease has been confirmed in some studies but rejected in some others (13). Also, some studies have investigated the effect of different polymorphisms of the gene and its response to the drug treatment that has been differently implemented in different populations (15).
According to the results of the present study and compared to ADHD groups (responder and non-responder), no significant relationship was observed between genotype and allele frequencies of exon III VNTR and rs3758653 polymorphisms with responding to drug treatment in ADHD groups.
Also, in the non-responder group, 107 patients did not respond appropriately to drug treatment which among these, 51 (41.8%) patients showed CT genotype of rs3758653 polymorphism, and 83 (67.8%) patients showed 2R repeat allele of exon III VNTR. The total results of this study showed that the reduction of ADHD symptoms with drug treatment is not related to DRD4 sub-types in patients with ADHD.
In agreement with the results of our study, a study performed in the Korean population did not show a relationship between polymorphism of DRD4 gene and the response to treatment with methylphenidate (14). Also, Brookes et al. reported that the DRD4 gene in ADHD patients in Taiwan is not related to the incidence or intensity of this disease, and the incidence of this allele is approximately the same in patients with ADHD and control group (16).
Qian et al. performed two studies in China and did not observe a significant association between four and six repeats of VNTR alleles and the incidence of ADHD (17, 18). These findings were confirmed by Leung et al. (19), who investigated the repeat II VNTR alleles in patients with ADHD. Carrasco et al., in 2006, in a Chilean population, also reported a negative relationship between 7-repeats and ADHD (20). However, contradictory findings have been reported in many studies. Tabatabaei et al. revealed two to six repeats in control alleles in all individuals under study (control and infected) at a time interval. In this study, the dominant allele was 4R, 5R, and 6R, among which 4R was the most frequent repeat (76.2% of ADHD patients and 53.8% of the control group) (P = 0.004) (21). Moreover, DRD4 gene polymorphisms is a risk factor for children with attention deficit. Also, Bidwell observed that 4Rrepeats in the DRD4 gene could be significantly related to ADHD (22). In the other study, Cheuk and Wong showed that the 4R allele was the most abundant repeat in their population with 48% abundance, and a significant relationship with ADHD was observed (7).
According to the studies above, although 4R repeat was a clear marker for ADHD, studies in other populations, especially European and American white populations, including the study of Nikolaidis and Gray, and the study of Leung et al., showed that 7R had a significant relationship with ADHD compared to other repeats (15, 19). In all of the above-mentioned studies that were investigated the associations, studies were performed in the form of case-control and intuitively, but the present study was a cohort study, and only the incidence of the above alleles was expressed descriptively in the present study. Therefore, we could not investigate the relationship in this study.
Treatment with methylphenidate had healing effects with increasing synaptic dopamine levels and tried to make up for the receptor’s slow response. In the current study, it was observed that the presence of DRD4 sub-types alleles in either homozygote or heterozygote forms could not change the rate of reduction in patients' symptoms, and the intensity of symptoms did not relate with this sub-type.
Jovanovic et al. suggested that there are no significant differences in presenting drugs or pharmacological cellular functions between the types of long and short repeats (23). Hamarman revealed that ADHD patients with seven repeats (7R) require higher doses of the drug for drug treatment (24). Also, McGough showed that there is a significant relationship between the gene and the dose of drug needed to control the disease (25).
Therefore, the DRD4 promoter with P = 0.008 and DRD4 exon III VNTR with P = 0.006 were associated with the intensity of symptoms after drug treatment approval. Surveying the above studies show that the relationship between gene and drug treatment in patients with ADHD is relative, and it is not observed in some studies. Subsequently, many causes are likely to be involved in the response of treatment in the patients, which is called meddler causes and leads to inconsistencies in the results of this study.

5.1. Conclusions

The results of this study show that the reduction of ADHD symptoms with drug treatment is not related to DRD4 sub-types in patients with ADHD.

Footnotes

References

  • 1.
    Franke B, Vasquez AA, Johansson S, Hoogman M, Romanos J, Boreatti-Hummer A, et al. Multicenter analysis of the SLC6A3/DAT1 VNTR haplotype in persistent ADHD suggests differential involvement of the gene in childhood and persistent ADHD. Neuropsychopharmacology. 2010;35(3):656-64. [PubMed ID: 19890261]. [PubMed Central ID: PMC3055604]. https://doi.org/10.1038/npp.2009.170.
  • 2.
    Sevinc E, Erdal ME, Sengul C, Cakaloz B, Ergundu TG, Herken H. Association of Adult Attention Deficit Hyperactivity Disorder With Dopamine Transporter Gene, Dopamine D3 Receptor, and Dopamine D4 Receptor Gene Polymorphisms. J Clin Psychopharmacol. 2016;20(3):254-61. https://doi.org/10.1080/10177833.2010.11790660.
  • 3.
    Genro JP, Roman T, Rohde LA, Hutz MH. The Brazilian contribution to Attention-Deficit/Hyperactivity Disorder molecular genetics in children and adolescents. Genet Mol Biol. 2012;35(4 (suppl)):932-8. [PubMed ID: 23411749]. [PubMed Central ID: PMC3571428]. https://doi.org/10.1590/s1415-47572012000600007.
  • 4.
    Agudelo JA, Galvez JM, Fonseca DJ, Mateus HE, Talero-Gutierrez C, Velez-Van-Meerbeke A. Evidence of an association between 10/10 genotype of DAT1 and endophenotypes of attention deficit/hyperactivity disorder. Neurologia. 2015;30(3):137-43. [PubMed ID: 24461309]. https://doi.org/10.1016/j.nrl.2013.12.005.
  • 5.
    Moharrari F, Barabadian S. Is dopamine transporter gene effective on therapeutic response of methylphenidate in ADHD patients? Rev Clin Med. 2015;2(2):65-71.
  • 6.
    Li D, Sham PC, Owen MJ, He L. Meta-analysis shows significant association between dopamine system genes and attention deficit hyperactivity disorder (ADHD). Hum Mol Genet. 2006;15(14):2276-84. [PubMed ID: 16774975]. https://doi.org/10.1093/hmg/ddl152.
  • 7.
    Cheuk DK, Wong V. Meta-analysis of Association Between a Catechol-O-Methyltransferase Gene Polymorphism and Attention Deficit Hyperactivity Disorder. Behav Genet. 2006;36(5):651-9.
  • 8.
    Nikolas MA, Momany AM. DRD4 Variants Moderate the Impact of Parental Characteristics on Child Attention-Deficit Hyperactivity Disorder: Exploratory Evidence from a Multiplex Family Design. J Abnorm Child Psychol. 2017;45(3):429-42. [PubMed ID: 28138806]. [PubMed Central ID: PMC5648541]. https://doi.org/10.1007/s10802-017-0264-y.
  • 9.
    Faraone SV, Perlis RH, Doyle AE, Smoller JW, Goralnick JJ, Holmgren MA, et al. Molecular genetics of attention-deficit/hyperactivity disorder. Biol Psychiatry. 2005;57(11):1313-23. [PubMed ID: 15950004]. https://doi.org/10.1016/j.biopsych.2004.11.024.
  • 10.
    Thapar A, O'Donovan M, Owen MJ. The genetics of attention deficit hyperactivity disorder. Hum Mol Genet. 2005;14(Spec No. 2):R275-82. [PubMed ID: 16244326]. https://doi.org/10.1093/hmg/ddi263.
  • 11.
    Van Tol HH, Wu CM, Guan HC, Ohara K, Bunzow JR, Civelli O, et al. Multiple dopamine D4 receptor variants in the human population. Nature. 1992;358(6382):149-52. [PubMed ID: 1319557]. https://doi.org/10.1038/358149a0.
  • 12.
    Ghanizadeh A, Mohammadi MR, Yazdanshenas A. Psychometric properties of the Farsi translation of the Kiddie Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version. BMC Psychiatry. 2006;6:10. [PubMed ID: 16539703]. [PubMed Central ID: PMC1484478]. https://doi.org/10.1186/1471-244X-6-10.
  • 13.
    DuPaul GJ, Power TJ, Anastopoulos AD, Reid R. ADHD rating scale-TV. New York: Guilford. 1998.
  • 14.
    Cheon KA, Kim BN, Cho SC. Association of 4-repeat allele of the dopamine D4 receptor gene exon III polymorphism and response to methylphenidate treatment in Korean ADHD children. Neuropsychopharmacology. 2007;32(6):1377-83. [PubMed ID: 17077808]. https://doi.org/10.1038/sj.npp.1301244.
  • 15.
    Nikolaidis A, Gray JR. ADHD and the DRD4 exon III 7-repeat polymorphism: an international meta-analysis. Soc Cogn Affect Neurosci. 2010;5(2-3):188-93. [PubMed ID: 20019071]. [PubMed Central ID: PMC2894686]. https://doi.org/10.1093/scan/nsp049.
  • 16.
    Brookes KJ, Xu X, Chen CK, Huang YS, Wu YY, Asherson P. No evidence for the association of DRD4 with ADHD in a Taiwanese population within-family study. BMC Med Genet. 2005;6:31. [PubMed ID: 16143039]. [PubMed Central ID: PMC1236928]. https://doi.org/10.1186/1471-2350-6-31.
  • 17.
    Qian Q, Wang Y, Zhou R, Yang L, Faraone SV. Family-based and case-control association studies of DRD4 and DAT1 polymorphisms in Chinese attention deficit hyperactivity disorder patients suggest long repeats contribute to genetic risk for the disorder. Am J Med Genet B Neuropsychiatr Genet. 2004;128B(1):84-9. [PubMed ID: 15211638]. https://doi.org/10.1002/ajmg.b.30079.
  • 18.
    Qian Q, Wang Y, Li J, Yang L, Wang B, Zhou R. Association studies of dopamine D4 receptor gene and dopamine transporter gene polymorphisms in Han Chinese patients with attention deficit hyperactivity disorder. Peking Univ Health sci. 2003;35(4):412-8.
  • 19.
    Leung PW, Lee CC, Hung SF, Ho TP, Tang CP, Kwong SL, et al. Dopamine receptor D4 (DRD4) gene in Han Chinese children with attention-deficit/hyperactivity disorder (ADHD): increased prevalence of the 2-repeat allele. Am J Med Genet B Neuropsychiatr Genet. 2005;133B(1):54-6. [PubMed ID: 15578612]. https://doi.org/10.1002/ajmg.b.30129.
  • 20.
    Carrasco X, Rothhammer P, Moraga M, Henriquez H, Chakraborty R, Aboitiz F, et al. Genotypic interaction between DRD4 and DAT1 loci is a high risk factor for attention-deficit/hyperactivity disorder in Chilean families. Am J Med Genet B Neuropsychiatr Genet. 2006;141B(1):51-4. [PubMed ID: 16342279]. https://doi.org/10.1002/ajmg.b.30259.
  • 21.
    Tabatabaei SM, Amiri S, Faghfouri S, Noorazar SG, AbdollahiFakhim S, Fakhari A. DRD4 Gene Polymorphisms as a Risk Factor for Children with Attention Deficit Hyperactivity Disorder in Iranian Population. Int Sch Res Notices. 2017;2017:2494537. [PubMed ID: 28630890]. [PubMed Central ID: PMC5463114]. https://doi.org/10.1155/2017/2494537.
  • 22.
    Bidwell LC, Willcutt EG, McQueen MB, DeFries JC, Olson RK, Smith SD, et al. A family based association study of DRD4, DAT1, and 5HTT and continuous traits of attention-deficit hyperactivity disorder. Behav Genet. 2011;41(1):165-74. [PubMed ID: 21207241]. [PubMed Central ID: PMC3674022]. https://doi.org/10.1007/s10519-010-9437-y.
  • 23.
    Jovanovic V, Guan HC, Van Tol HH. Comparative pharmacological and functional analysis of the human dopamine D4.2 and D4.10 receptor variants. Pharmacogenetics. 2009;9(5):561-8. [PubMed ID: 10591536].
  • 24.
    Hamarman S, Fossella J, Ulger C, Brimacombe M, Dermody J. Dopamine receptor 4 (DRD4) 7-repeat allele predicts methylphenidate dose response in children with attention deficit hyperactivity disorder: a pharmacogenetic study. J Child Adolesc Psychopharmacol. 2004;14(4):564-74. [PubMed ID: 15662148]. https://doi.org/10.1089/cap.2004.14.564.
  • 25.
    McGough JJ, McCracken JT, Loo SK, Manganiello M, Leung MC, Tietjens JR, et al. A candidate gene analysis of methylphenidate response in attention-deficit/hyperactivity disorder. J Am Acad Child Adolesc Psychiatry. 2009;48(12):1155-64. [PubMed ID: 19858760]. [PubMed Central ID: PMC2888980]. https://doi.org/10.1097/CHI.0b013e3181bc72e3.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles