Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Fusobacterium nucleatum-Mediated Alteration in Expression of VEGF and CCL3 Genes and KRAS Mutation in Colorectal Cancer Patients

Author(s):
Hataw Jalal TaherHataw Jalal TaherHataw Jalal Taher ORCID1,*, Fouad KamelFouad KamelFouad Kamel ORCID2
1Department of Medical Laboratory Technology, Erbil Health and Medical Technical College, Erbil Polytechnic University, Erbil, Iraq
2Department of Medical Laboratory Technology, Medical Technical Institute, Erbil Polytechnic University, Erbil, Iraq

Jundishapur Journal of Microbiology:Vol. 16, issue 6; e136914
Published online:Jul 31, 2023
Article type:Research Article
Received:Apr 26, 2023
Accepted:Jul 07, 2023
How to Cite:Taher HJ, Kamel F. Fusobacterium nucleatum-Mediated Alteration in Expression of VEGF and CCL3 Genes and KRAS Mutation in Colorectal Cancer Patients. Jundishapur J Microbiol. 2023;16(6):e136914. doi: https://doi.org/10.5812/jjm-136914

Abstract

Background:

Colorectal cancer (CRC) is the third most common cancer worldwide, and its development is influenced by genetic and environmental factors, including the gut microbiota. Recent studies have reported an association between Fusobacterium nucleatum abundance and CRC.

Objectives:

This study aimed to investigate the abundance of F. nucleatum in CRC and polyp patients and its association with the expression of chemokine ligand -3(CCL3), vascular endothelial growth factor (VEGF), and nuclear factor-kappa B (NF-KB11) genes and the presence of deoxyribonucleic acid (DNA) mutations and polymorphisms in the Kirsten rat sarcoma viral oncogene homolog (KRAS) gene.

Methods:

A total of 80 biopsy samples were collected from CRC, polyp, and colitis patients. Moreover, F. nucleatum abundance was measured by quantitative polymerase chain reaction (qPCR). The expression of CCL3, VEGF, and NF-KB11 genes was measured by reverse transcription polymerase chain reaction (RT-PCR). Additionally, KRAS gene mutations and polymorphisms were detected by the Mutation Surveyor software (V5.1.2).

Results:

The results showed that F. nucleatum abundance was significantly higher in CRC and polyp patients than in colitis patients (P < 0.05). The expression of CCL3 and VEGF genes was also significantly higher in F. nucleatum-positive samples (P < 0.05). However, NF-KB11 gene expression was non-significant. Fusobacterium nucleatum-positive biopsy samples had a higher frequency of KRAS gene mutations and polymorphisms than F. nucleatum-negative CRC patients (odds ratio = 3). Most of the mutations observed in the positive samples were (6144A>AT,31E>E) at exon 2 of the KRAS gene.

Conclusions:

The study findings suggest that F. nucleatum might play a role in CRC and polyp development and contribute to KRAS gene mutations. Therefore, targeting F. nucleatum in the gut microbiota could be a potential therapeutic strategy for preventing CRC and polyp development.

1. Background

Colorectal cancer (CRC) is a major cause of cancer-related mortalities worldwide, with a high incidence and mortality rate (1). Several factors have been identified to contribute to the development and progression of CRC, including genetic mutations, lifestyle factors, and the gut microbiome (2, 3). In recent years, there has been growing interest in the role of Fusobacterium nucleatum in various human diseases. Fusobacterium nucleatum is a gram-negative anaerobic bacterium commonly found in the oral cavity and gastrointestinal tract. It is known for its ability to form biofilms and adhere to epithelial cells, facilitating its colonization and persistence in the gut environment (4). In particular, recent studies have shown that the abundance of F. nucleatum is increased in CRC patients compared to healthy controls (5, 6). Fusobacterium nucleatum has been suggested to promote tumorigenesis by interacting with host cells and promoting inflammation, inhibiting immune responses, and inducing deoxyribonucleic acid (DNA) damage (7, 8).
Previous studies have also reported that F. nucleatum is associated with the development of precancerous lesions, such as polyps (9, 10). However, the expression of specific genes in F. nucleatum-positive samples and the association between F. nucleatum and DNA mutations in the KRAS gene, which are frequently found in CRC and associated with a poor prognosis (11), have not been fully explored. Emerging evidence has highlighted the significance of specific genes, such as CCL3 and VEGF, in CRC. Chemokine ligand-3, also known as chemokine (C-C motif) ligand 3, is a pro-inflammatory chemokine involved in immune cell recruitment and activation (12). It has been implicated in tumor progression, angiogenesis, and metastasis in various cancers, including CRC (13). The dysregulation of CCL3 expression in CRC has been associated with poor prognosis and advanced stages of the disease (14). Understanding the role of CCL3 in CRC is essential for unraveling the complex interplay between inflammation, immune responses, and tumor development.
Vascular endothelial growth factor (VEGF) is a key regulator of angiogenesis, the formation of new blood vessels (15). In CRC, VEGF has been implicated in tumor vascularization and the promotion of tumor growth and metastasis (16). Increased VEGF expression has been correlated with poor prognosis and resistance to certain therapies in CRC patients (17). Therefore, investigating the role of VEGF in CRC is crucial for identifying potential therapeutic targets and developing effective treatment strategies. Despite the growing understanding of the involvement of CCL3 and VEGF in CRC, the specific impact of F. nucleatum abundance on the expression of these genes still needs to be explored. By investigating the association between F. nucleatum and the expression of CCL3 and VEGF in CRC patients, this study aimed to shed light on the potential molecular mechanisms underlying the tumorigenic properties of F. nucleatum in CRC and provide insights into new therapeutic approaches.

2. Objectives

This study aimed to investigate the abundance of F. nucleatum in CRC, polyp, and colitis patients and analyze the expression of CCL3, VEGF, and NF-KB11 genes in F. nucleatum-positive samples. This study also aimed to compare the prevalence of DNA mutations and polymorphism in the KRAS gene between F. nucleatum-positive and -negative CRC patients. To achieve these aims, biopsy samples were collected from 100 patients diagnosed with CRC, polyps, or colitis and analyzed using quantitative polymerase chain reaction (qPCR), gene expression analysis, and DNA sequencing.

3. Methods

3.1. Study Design

This was a retrospective case-control study conducted between June 2021 and March 2022. The study was approved by the Ethics Committee of Erbil Health and Medical Technical College, Erbil, Iraq, and informed consent was obtained from all participants.

3.2. Study Participants

The study included a total of 100 patients who underwent colonoscopy and surgical operation during the study period. The participants were divided into 3 groups based on their diagnosis, namely the CRC group (n = 38), the precancerous group (n = 19) with polyps, and the colitis group (n = 18) with 1 control group (n = 25). The inclusion criteria for the study were patients aged 18 years and older who underwent colonoscopy and surgical operation for clinical reasons. All the studied participants were selected according to the colonoscopy results during the first diagnosis before starting chemotherapy or radiotherapy.

3.3. Sample Collection

During colonoscopy or surgical operation, biopsy samples were collected from the colon mucosa of all participants using standard biopsy tools. The biopsy samples were immediately placed in sterile tubes containing phosphate-buffered saline (PBS) and stored at -80°C until further analysis.

3.4. DNA Extraction

Genomic DNA was extracted from the biopsy samples using a test kit for DNA extraction (Favorgen Biotech Crop., Taiwan) according to the manufacturer’s protocol. Briefly, the samples were initially prepared and subjected to cell lysis using a provided lysis buffer. Protein removal was performed to eliminate protein contaminants using Proteinase K, and DNA purification was achieved through column-based methods. Washing steps were carried out to remove residual impurities, followed by the elution of the purified DNA using an elution buffer. Deoxyribonucleic acid purity and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

3.5. Determination of the Abundance of Fusobacterium nucleatum

Real-time PCR was performed to determine the abundance of F. nucleatum in the biopsy samples. The 16S rRNA gene was used as a target gene for F. nucleatum, and a standard curve from standard F. nucleatum bacteria was prepared. Moreover, the log copies for the known samples were measured using the following formula:
Number of copies = (DNA concentration in ng/µL) × (6.02 × 1023) / (length of DNA template in bp (3000000 bp) × 660
The primers used for PCR amplification were as follows:
F. nucleatum (F: 5'-AGA GTT TGA TCC TGG CTC AG-3', R: 5'-GTC ATC GTG CAC ACA GAA TTG CTG-3')
The abundance of F. nucleatum was calculated based on the cycle threshold (Ct) values of the standard and samples. Then, the log number copies were calculated using Excel software. The PCR protocol for F. nucleatum was performed with an initial 5 minutes at 94°C; then, 30 cycles repeated; each cycle consisted of a denaturation process at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute, with 10 minutes at 72°C as a final extension.

3.6. Gene Expression Analysis

The relative expression levels of CCL3, VEGF, and NF-KB11 genes were analyzed using qPCR. Total ribonucleic acid (RNA) was extracted from the biopsy samples using a special kit (Invitrogen, USA) according to the manufacturer’s protocol. Complementary DNA (cDNA) synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Real-time PCR was performed using the PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, USA) on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The primers used for PCR amplification are shown in Table 1. The relative expression for the studied genes was calculated using the delta-delta Ct method.
Table 1.Forward and Reverse Sequences of Studied Primers
Primer Name Forward SequenceReverse Sequence
β-actinTCGAGCAATCTCAACTCGGTGAAGGTAGTTTCGTTGGATG
VEGF-AAGGGCAGAATCATCACGAAGTAGGGTCTCGATTGGATGGCA
NF-κB1CACAAGGCAGCAAATAGACGAGTGGGGCATTTTGTTGAGAGTT
CCL3TGTTGCCAAACAGCCACACCAGAGCAAACAATCACAAACACAC

3.7. KRAS Mutation Analysis

The KRAS mutation analysis was performed using specific primers (F: 5'-TAGTCACATTTTCATTATTTTTAT-3', R: 5'- AGATTTACCTCTATTGTTGGAT-3') in exon 2 of the KRAS gene, which contains the most common mutations associated with the presence or absence of F. nucleatum. The PCR products were sequenced using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA).

3.8. Statistical Analysis

Statistical analysis was performed using GraphPad Prism software (version 9). The abundance of F. nucleatum and gene expression levels were compared between the groups using the one-way analysis of variance (ANOVA) test followed by Tukey’s post-hoc test. The odds ratio (OR) for KRAS mutations in F. nucleatum-positive samples was calculated. Two-way ANOVA was applied to compare F. nucleatum-positive and -negative samples based on patient gender, and the Sidak test was used as a multiple comparison test. P-values less than 0.05 were considered statistically significant. Mutation Surveyor software (V5.1.2) manufactured by SoftGenetics (Pennsylvania, USA was applied for KRAS mutation analysis. The Glutamic Acid Decarboxylase (GAD) and mutation reports were exported as the final results for the mutations.

4. Results

The abundance of F. nucleatum was determined using qPCR. The results showed that the mean ± standard error (SE) of F. nucleatum abundance was 5.228 ± 0.057 and 5.291 ± 0.058 log copies/ng DNA in patients with CRC and precancerous polyps, respectively, which was significantly higher than in colitis patients (4.874 ± 0.182 log copies/ng DNA) (P < 0.05). However, the abundance of F. nucleatum was non-significant in both precancerous polyp and CRC patients (Figure 1). Regarding the normal cases, only one case was positive for F. nucleatum, which was not included in the figure and analysis due to a lack of replications.
The abundance of <i>Fusobacterium nucleatum</i> in colorectal cancer (CRC), polyp, and colitis groups. Both the CRC and polyp groups showed a significantly higher abundance of <i>Fusobacterium nucleatum</i> (P &lt; 0.05) than the colitis group. The data are expressed as mean and standard error (SE). * indicates the significant level at P &lt; 0.05, and the one-way ANOVA test was applied with Tukey’s post-hoc test for comparisons.
Figure 1.

The abundance of Fusobacterium nucleatum in colorectal cancer (CRC), polyp, and colitis groups. Both the CRC and polyp groups showed a significantly higher abundance of Fusobacterium nucleatum (P < 0.05) than the colitis group. The data are expressed as mean and standard error (SE). * indicates the significant level at P < 0.05, and the one-way ANOVA test was applied with Tukey’s post-hoc test for comparisons.

The results for the relative expression of CCL3, VEGF, and NF-KB1 genes in F. nucleatum-positive and F. nucleatum-negative samples in CRC patients using quantitative reverse transcription polymerase chain reaction (RT-qPCR) showed that the relative expression of CCL3 and VEGF genes was significantly higher in F. nucleatum-positive samples than in F. nucleatum-negative samples (P < 0.05). However, the expression of NF-KB1 was not significantly different between F. nucleatum-positive and F. nucleatum-negative samples (Figure 2). Gender-based data showed that CCL3 expression was significantly increased in positive patients in both males and females. However, no significant change was observed in VEGF relative expression among F. nucleatum-negative and -positive samples in both male and female samples, which might be due to a reduction in the sample size of the groups after gender-based categorization (Figure 3).
Relative expression of (A) <i>VEGF</i>, (B) <i>CCL3</i>, and (C) <i>NF-KB11</i> in <i>Fusobacterium nucleatum</i>-positive and -negative patients. The expression of both <i>VEGF</i> and <i>CCL3</i> genes was higher (P &lt; 0.05) in <i>F. nucleatum</i>-positive samples than in <i>F. nucleatum</i>-negative samples. The data are expressed as mean and standard error (SE). * indicates the significant level at P &lt; 0.05, and an unpaired Student’s t-test was applied for comparisons.
Figure 2.

Relative expression of (A) VEGF, (B) CCL3, and (C) NF-KB11 in Fusobacterium nucleatum-positive and -negative patients. The expression of both VEGF and CCL3 genes was higher (P < 0.05) in F. nucleatum-positive samples than in F. nucleatum-negative samples. The data are expressed as mean and standard error (SE). * indicates the significant level at P < 0.05, and an unpaired Student’s t-test was applied for comparisons.

Relative expression of (A) <i>VEGF</i> and (B) <i>CCL3</i> in <i>Fusobacterium nucleatum</i>-positive and -negative patients categorized according to gender (male and female). The expression of the <i>CCL3</i> gene was higher (P &lt; 0.05) in <i>F. nucleatum</i>-positive samples than in <i>F. nucleatum</i>-negative samples in both females and males. However, <i>VEGF</i> showed no significant differences between positive and negative infected patients in both males and females. The data are expressed as mean and standard error (SE). * indicates the significant level at P &lt; 0.05, and the two-way ANOVA test was applied for comparisons with the Sidak test as post-hoc for multiple comparisons.
Figure 3.

Relative expression of (A) VEGF and (B) CCL3 in Fusobacterium nucleatum-positive and -negative patients categorized according to gender (male and female). The expression of the CCL3 gene was higher (P < 0.05) in F. nucleatum-positive samples than in F. nucleatum-negative samples in both females and males. However, VEGF showed no significant differences between positive and negative infected patients in both males and females. The data are expressed as mean and standard error (SE). * indicates the significant level at P < 0.05, and the two-way ANOVA test was applied for comparisons with the Sidak test as post-hoc for multiple comparisons.

The results of the association between F. nucleatum and KRAS gene mutations were assessed using Mutation Surveyor analysis in biopsy samples. The PCR products for KRAS primer were prepared and checked via an agarose gel (Figure 4). The results revealed a significantly higher frequency of KRAS gene mutations and polymorphism (OR = 3, P < 0.05) in F. nucleatum-positive biopsy samples than in F. nucleatum-negative CRC patients (Table 2). Most of the mutations observed in the positive samples were (6144A>AT,31E>E) at exon 2 of the KRAS gene (Figure 5).
Gel image of polymerase chain reaction (PCR) products for <i>KRAS</i> mutations in <i>Fusobacterium nucleatum</i>-positive samples. The bands were obtained at 160 bp. The first lane (L) is the DNA ladder with 100 bp, and the other lanes are the studied samples.
Figure 4.

Gel image of polymerase chain reaction (PCR) products for KRAS mutations in Fusobacterium nucleatum-positive samples. The bands were obtained at 160 bp. The first lane (L) is the DNA ladder with 100 bp, and the other lanes are the studied samples.

Glutamic acid decarboxylase (GAD) report of Mutation Surveyor Software (V 5.1.2) for <i>KRAS</i> mutations in <i>Fusobacterium nucleatum</i>-positive samples. The results showed a significantly higher frequency of <i>KRAS</i> gene mutations and polymorphism (OR = 3, P &lt; 0.05) in <i>F. nucleatum</i>-positive biopsy samples than in <i>F. nucleatum</i>-negative colorectal cancer patients.
Figure 5.

Glutamic acid decarboxylase (GAD) report of Mutation Surveyor Software (V 5.1.2) for KRAS mutations in Fusobacterium nucleatum-positive samples. The results showed a significantly higher frequency of KRAS gene mutations and polymorphism (OR = 3, P < 0.05) in F. nucleatum-positive biopsy samples than in F. nucleatum-negative colorectal cancer patients.

Table 2.Frequency and Odds Ratio of KRAS Mutations in Fusobacterium nucleatum-Positive and -Negative Colorectal Cancer Samples
F. nucleatum PositiveF. nucleatum Negative
No. of samples with mutation64
No. of samples without mutation816
Odd ratio (OR)3

5. Discussion

The current study examined the abundance of F. nucleatum in CRC, precancerous polyp, and colitis patients and investigated its association with gene expression and DNA mutations. The results showed a significant increase in the abundance of F. nucleatum in both CRC and polyp patients, compared to colitis patients. This finding is consistent with the findings of previous studies that reported a positive correlation between F. nucleatum and CRC (5, 18, 19). One possible mechanism for this association is that F. nucleatum can adhere to the colorectal epithelium and induce chronic inflammation, leading to tumorigenesis (20). Furthermore, the present study demonstrated that F. nucleatum-positive biopsy samples had more DNA mutations and polymorphisms in the KRAS gene than F. nucleatum-negative CRC patients. This result suggests that F. nucleatum might promote CRC progression by increasing genetic instability and promoting the acquisition of oncogenic mutations. Previous studies have suggested that F. nucleatum can stimulate DNA damage and genomic instability in host cells by inducing chronic inflammation and inhibiting DNA repair mechanisms (20-22).
In addition, in this study, an increase in the expression of CCL3 and VEGF genes was observed in F. nucleatum-positive samples than in F. nucleatum-negative samples. Both of these genes have been implicated in cancer progression and angiogenesis (23-25). Also known as macrophage inflammatory protein-1 alpha, CCL3 is a chemokine that recruits immune cells to the site of inflammation and contributes to the progression of various cancers (26, 27). The VEGF gene is a key regulator of angiogenesis and has been shown to be upregulated in CRC (28). One possible mechanism for the increase in CCL3 and VEGF expression in F. nucleatum-positive samples is that F. nucleatum can activate pro-inflammatory signaling pathways, such as nuclear factor kappa light chain enhancer of activated B cells (NF-κB) and signal transducer and activator of transcription 3 (STAT3), leading to the upregulation of these genes (18, 29). Overall, the present study’s results provide further evidence of the association between F. nucleatum and CRC and suggest that F. nucleatum might promote tumorigenesis by inducing chronic inflammation, promoting genetic instability, and modulating gene expression. These findings might have important implications for the development of novel diagnostic and therapeutic strategies for CRC.
The present study has several limitations that should be acknowledged. Firstly, the sample size of the study was relatively small, and larger studies are needed to confirm the obtained findings. Secondly, the present study was cross-sectional; therefore, it is impossible to establish causality between F. nucleatum and the development of CRC and polyps. Thirdly, this study did not investigate the functional role of F. nucleatum in CRC and polyps, and further studies are needed to explore the underlying mechanisms.

5.1. Conclusions

In conclusion, the current study provides evidence of the association between F. nucleatum and the development and progression of CRC and polyps. The findings of the increased abundance of F. nucleatum, increased expression of CCL3 and VEGF, and increased DNA mutations and polymorphisms in the KRAS gene in F. nucleatum-positive samples suggest that F. nucleatum might play a role in the development and progression of CRC and polyps. Further studies are needed to explore the underlying mechanisms and potential therapeutic strategies targeting F. nucleatum in CRC and polyps.

Footnotes

References

  • 1.
    Rawla P, Sunkara T, Barsouk A. Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors. Prz Gastroenterol. 2019;14(2):89-103. [PubMed ID: 31616522]. [PubMed Central ID: PMC6791134]. https://doi.org/10.5114/pg.2018.81072.
  • 2.
    Zackular JP, Rogers MA, Ruffin M, Schloss PD. The human gut microbiome as a screening tool for colorectal cancer. Cancer Prev Res (Phila). 2014;7(11):1112-21. [PubMed ID: 25104642]. [PubMed Central ID: PMC4221363]. https://doi.org/10.1158/1940-6207.CAPR-14-0129.
  • 3.
    Gagniere J, Raisch J, Veziant J, Barnich N, Bonnet R, Buc E, et al. Gut microbiota imbalance and colorectal cancer. World J Gastroenterol. 2016;22(2):501-18. [PubMed ID: 26811603]. [PubMed Central ID: PMC4716055]. https://doi.org/10.3748/wjg.v22.i2.501.
  • 4.
    Fan Z, Tang P, Li C, Yang Q, Xu Y, Su C, et al. Fusobacterium nucleatum and its associated systemic diseases: epidemiologic studies and possible mechanisms. J Oral Microbiol. 2023;15(1):2145729. [PubMed ID: 36407281]. [PubMed Central ID: PMC9673791]. https://doi.org/10.1080/20002297.2022.2145729.
  • 5.
    Mima K, Sukawa Y, Nishihara R, Qian ZR, Yamauchi M, Inamura K, et al. Fusobacterium nucleatum and T cells in colorectal carcinoma. JAMA Oncol. 2015;1(5):653-61. [PubMed ID: 26181352]. [PubMed Central ID: PMC4537376]. https://doi.org/10.1001/jamaoncol.2015.1377.
  • 6.
    Yang JH, Bhargava P, McCloskey D, Mao N, Palsson BO, Collins JJ. Antibiotic-induced changes to the host metabolic environment inhibit drug efficacy and alter immune function. Cell Host Microbe. 2017;22(6):757-765 e3. [PubMed ID: 29199098]. [PubMed Central ID: PMC5730482]. https://doi.org/10.1016/j.chom.2017.10.020.
  • 7.
    Rubinstein MR, Wang X, Liu W, Hao Y, Cai G, Han YW. Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/beta-catenin signaling via its FadA adhesin. Cell Host Microbe. 2013;14(2):195-206. [PubMed ID: 23954158]. [PubMed Central ID: PMC3770529]. https://doi.org/10.1016/j.chom.2013.07.012.
  • 8.
    Gur C, Ibrahim Y, Isaacson B, Yamin R, Abed J, Gamliel M, et al. Binding of the Fap2 protein of Fusobacterium nucleatum to human inhibitory receptor TIGIT protects tumors from immune cell attack. Immunity. 2015;42(2):344-55. [PubMed ID: 25680274]. [PubMed Central ID: PMC4361732]. https://doi.org/10.1016/j.immuni.2015.01.010.
  • 9.
    Castellarin M, Warren RL, Freeman JD, Dreolini L, Krzywinski M, Strauss J, et al. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res. 2012;22(2):299-306. [PubMed ID: 22009989]. [PubMed Central ID: PMC3266037]. https://doi.org/10.1101/gr.126516.111.
  • 10.
    McCoy AN, Araujo-Perez F, Azcarate-Peril A, Yeh JJ, Sandler RS, Keku TO. Fusobacterium is associated with colorectal adenomas. PLoS One. 2013;8(1). e53653. [PubMed ID: 23335968]. [PubMed Central ID: PMC3546075]. https://doi.org/10.1371/journal.pone.0053653.
  • 11.
    Barault L, Veyrie N, Jooste V, Lecorre D, Chapusot C, Ferraz JM, et al. Mutations in the RAS-MAPK, PI(3)K (phosphatidylinositol-3-OH kinase) signaling network correlate with poor survival in a population-based series of colon cancers. Int J Cancer. 2008;122(10):2255-9. [PubMed ID: 18224685]. https://doi.org/10.1002/ijc.23388.
  • 12.
    Turner MD, Nedjai B, Hurst T, Pennington DJ. Cytokines and chemokines: At the crossroads of cell signalling and inflammatory disease. Biochim Biophys Acta. 2014;1843(11):2563-82. [PubMed ID: 24892271]. https://doi.org/10.1016/j.bbamcr.2014.05.014.
  • 13.
    De la Fuente Lopez M, Landskron G, Parada D, Dubois-Camacho K, Simian D, Martinez M, et al. The relationship between chemokines CCL2, CCL3, and CCL4 with the tumor microenvironment and tumor-associated macrophage markers in colorectal cancer. Tumour Biol. 2018;40(11):1010428318810060. [PubMed ID: 30419802]. https://doi.org/10.1177/1010428318810059.
  • 14.
    Jia SN, Han YB, Yang R, Yang ZC. Chemokines in colon cancer progression. Semin Cancer Biol. 2022;86(Pt 3):400-7. [PubMed ID: 35183412]. https://doi.org/10.1016/j.semcancer.2022.02.007.
  • 15.
    Hicklin DJ, Ellis LM. Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. J Clin Oncol. 2005;23(5):1011-27. [PubMed ID: 15585754]. https://doi.org/10.1200/JCO.2005.06.081.
  • 16.
    George ML, Tutton MG, Janssen F, Arnaout A, Abulafi AM, Eccles SA, et al. VEGF-A, VEGF-C, and VEGF-D in colorectal cancer progression. Neoplasia. 2001;3(5):420-7. [PubMed ID: 11687953]. [PubMed Central ID: PMC1506210]. https://doi.org/10.1038/sj.neo.7900186.
  • 17.
    Hohla F, Winder T, Greil R, Rick FG, Block NL, Schally AV. Targeted therapy in advanced metastatic colorectal cancer: current concepts and perspectives. World J Gastroenterol. 2014;20(20):6102-12. [PubMed ID: 24876732]. [PubMed Central ID: PMC4033449]. https://doi.org/10.3748/wjg.v20.i20.6102.
  • 18.
    Kostic AD, Gevers D, Pedamallu CS, Michaud M, Duke F, Earl AM, et al. Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome Res. 2012;22(2):292-8. [PubMed ID: 22009990]. [PubMed Central ID: PMC3266036]. https://doi.org/10.1101/gr.126573.111.
  • 19.
    Borozan I, Zaidi SH, Harrison TA, Phipps AI, Zheng J, Lee S, et al. Molecular and pathology features of colorectal tumors and patient outcomes are associated with Fusobacterium nucleatum and Its Subspecies animalis. Cancer Epidemiol Biomarkers Prev. 2022;31(1):210-20. [PubMed ID: 34737207]. [PubMed Central ID: PMC8755593]. https://doi.org/10.1158/1055-9965.EPI-21-0463.
  • 20.
    Han YW, Wang X. Mobile microbiome: oral bacteria in extra-oral infections and inflammation. J Dent Res. 2013;92(6):485-91. [PubMed ID: 23625375]. [PubMed Central ID: PMC3654760]. https://doi.org/10.1177/0022034513487559.
  • 21.
    Sun CH, Li BB, Wang B, Zhao J, Zhang XY, Li TT, et al. The role of Fusobacterium nucleatum in colorectal cancer: from carcinogenesis to clinical management. Chronic Dis Transl Med. 2019;5(3):178-87. [PubMed ID: 31891129]. [PubMed Central ID: PMC6926109]. https://doi.org/10.1016/j.cdtm.2019.09.001.
  • 22.
    Abed J, Maalouf N, Manson AL, Earl AM, Parhi L, Emgard JEM, et al. Colon cancer-associated Fusobacterium nucleatum may originate from the oral cavity and reach colon tumors via the circulatory system. Front Cell Infect Microbiol. 2020;10:400. [PubMed ID: 32850497]. [PubMed Central ID: PMC7426652]. https://doi.org/10.3389/fcimb.2020.00400.
  • 23.
    Chen X, Li P, Liu M, Zheng H, He Y, Chen MX, et al. Gut dysbiosis induces the development of pre-eclampsia through bacterial translocation. Gut. 2020;69(3):513-22. [PubMed ID: 31900289]. https://doi.org/10.1136/gutjnl-2019-319101.
  • 24.
    Chen Y, Chen Y, Zhang J, Cao P, Su W, Deng Y, et al. Fusobacterium nucleatum promotes metastasis in colorectal cancer by activating autophagy signaling via the upregulation of CARD3 expression. Theranostics. 2020;10(1):323-39. [PubMed ID: 31903123]. [PubMed Central ID: PMC6929621]. https://doi.org/10.7150/thno.38870.
  • 25.
    Malkova AM, Sharoyko VV, Zhukova NV, Gubal AR, Orlova RV. Laboratory biomarkers of an effective antitumor immune response. Clinical significance. Cancer Treat Res Commun. 2021;29:100489. [PubMed ID: 34837797]. https://doi.org/10.1016/j.ctarc.2021.100489.
  • 26.
    Arora S, Khan S, Zaki A, Tabassum G, Mohsin M, Bhutto HN, et al. Integration of chemokine signaling with non-coding RNAs in tumor microenvironment and heterogeneity in different cancers. Semin Cancer Biol. 2022;86(Pt 2):720-36. [PubMed ID: 35257861]. https://doi.org/10.1016/j.semcancer.2022.03.002.
  • 27.
    Kim K, Castro EJT, Shim H, Advincula JVG, Kim YW. Differences regarding the molecular features and gut microbiota between right and left colon cancer. Ann Coloproctol. 2018;34(6):280-5. [PubMed ID: 30630301]. [PubMed Central ID: PMC6347335]. https://doi.org/10.3393/ac.2018.12.17.
  • 28.
    Zhu D, Yang Z, Miao X, Yang W, Jiang M, Chen Y. Association of serum vascular endothelial growth factor (VEGF) with colorectal cancer: A systemic review and meta-analysis. J Cancer Sci Clin Ther. 2020;4(1):15-31. https://doi.org/10.26502/jcsct.5079046.
  • 29.
    Hashemi Goradel N, Heidarzadeh S, Jahangiri S, Farhood B, Mortezaee K, Khanlarkhani N, et al. Fusobacterium nucleatum and colorectal cancer: A mechanistic overview. J Cell Physiol. 2019;234(3):2337-44. [PubMed ID: 30191984]. https://doi.org/10.1002/jcp.27250.

Similar Articles

20
Apr
2024
Jundishapur J Microbiol

Associations Between Fusobacterium nucleatum and msh2, mlh1, and msh6 Gene Expression in Colorectal Cancer

Reza Torkashvand,
Bahareh Hajikhani,
Reza Hosseini Doust,
Hossein Dabiri,
Masoud Dadashi

Torkashvand R, Hajikhani B, Hosseini Doust R, Dabiri H, Dadashi M. Associations Between Fusobacterium nucleatum and msh2, mlh1, and msh6 Gene Expression in Colorectal Cancer. Jundishapur J Microbiol. 2024;17(2):e144247. doi: https://doi.org/10.5812/jjm-144247

13
Jul
2021
Jundishapur J Microbiol

Liver Abscess Caused by Fusobacterium nucleatum: A Case Report

Wenhao Wu,
Wenjia Fan,
Zhewen Zhou,
Shouhao Wang,
Chengan Xu,
Tianchen Hui
,et al.

Wu W, Fan W, Zhou Z, Wang S, Xu C, et al. Liver Abscess Caused by Fusobacterium nucleatum: A Case Report. Jundishapur J Microbiol. 2021;14(4):e116591. doi: https://doi.org/10.5812/jjm.116591

17
Jul
2022
Arch Clin Infect Dis

Evaluation of Enterococcus faecalis, Lactobacillus acidophilus, and Lactobacillus plantarum in Biopsy Samples of Colorectal Cancer and Polyp Patients Compared to Healthy People

Masoud Dadashi,
Abolfazl Sahebi,
Reza Arjmand-Teymouri,
Mehdi Mirzaii,
Mehdi Mousavian,
Somayeh Yaslianifard

Dadashi M, Sahebi A, Arjmand-Teymouri R, Mirzaii M, Mousavian M, et al. Evaluation of Enterococcus faecalis, Lactobacillus acidophilus, and Lactobacillus plantarum in Biopsy Samples of Colorectal Cancer and Polyp Patients Compared to Healthy People. Arch Clin Infect Dis. 2022;17(1):e116165. doi: https://doi.org/10.5812/archcid-116165

29
May
2024
Jundishapur J Microbiol

The Frequency of Verrucomicrobia in the Intestinal Mucus of Patients with Cancer and Polyps Compared to Healthy Individuals

Afsaneh Hajimohammad,
Esmail Fattahi,
Abdollah Ardebili,
Hami Kaboosi,
Ezzat Allah Ghaemi

Hajimohammad A, Fattahi E, Ardebili A, Kaboosi H, Ghaemi EA. The Frequency of Verrucomicrobia in the Intestinal Mucus of Patients with Cancer and Polyps Compared to Healthy Individuals. Jundishapur J Microbiol. 2024;17(5):e146159. doi: https://doi.org/10.5812/jjm-146159

5
Jul
2021
Jentashapir J Cell Mol Bio

Molecular Analysis of rs2910164 Polymorphism and its Association with TNF-α Gene Expression in Colorectal Cancer

Ahmad Hamta,
Niloofar Tolooi

Hamta A, Tolooi N. Molecular Analysis of rs2910164 Polymorphism and its Association with TNF-α Gene Expression in Colorectal Cancer. Jentashapir J Cell Mol Biol. 2021;12(2):e115179. doi: https://doi.org/10.5812/jjcmb.115179


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC