Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Phenotypic and Molecular Detection of Carbapenemase-Producing Klebsiella pneumoniae Isolated from Patients Admitted to Teaching Hospitals in Shiraz, Iran

Author(s):
Nasser SamadiNasser SamadiNasser Samadi ORCID1, Mehdi KalaniMehdi KalaniMehdi Kalani ORCID2, Taher AzimiTaher AzimiTaher Azimi ORCID1, Hasan HosainzadeganHasan HosainzadeganHasan Hosainzadegan ORCID3, Nahal HadiNahal HadiNahal Hadi ORCID1, 4,*
1Department of Bacteriology and Virology, Faculty of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
2Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
3Department of Basic Sciences, Faculty of Medicine, Maragheh University of Medical Sciences, Maragheh, Iran
4Bio-informatics and Computational Biology Center of Research, Shiraz University of Medical Sciences, Shiraz, Iran

Jundishapur Journal of Microbiology:Vol. 16, issue 12; e142449
Published online:Feb 06, 2024
Article type:Research Article
Received:Nov 11, 2023
Accepted:Dec 27, 2023
How to Cite:Samadi N, Kalani M, Azimi T, Hosainzadegan H, Hadi N. Phenotypic and Molecular Detection of Carbapenemase-Producing Klebsiella pneumoniae Isolated from Patients Admitted to Teaching Hospitals in Shiraz, Iran. Jundishapur J Microbiol. 2023;16(12):e142449. doi: https://doi.org/10.5812/jjm-142449

Abstract

Background:

Carbapenem-resistant Klebsiella pneumoniae (Cr-KPN) poses a significant global public health challenge.

Objectives:

This study aimed to investigate the prevalence and expression levels of carbapenemase-encoding genes in Cr-KPN isolated from patients admitted to teaching hospitals in Shiraz, Iran.

Methods:

A total of 671 distinct clinical samples were collected from two teaching hospitals in Shiraz. Initial identification and final confirmation of K. pneumoniae isolates were carried out using conventional biochemical tests and PCR assays, respectively. The detection of carbapenemase-producing K. pneumoniae, both phenotypically and genotypically, was performed through modified carbapenem inactivation methods (mCIM) and multiplex PCR assays. Real-time PCR was utilized to assess the expression levels of carbapenemase-encoding genes.

Results:

The overall frequency of K. pneumoniae strains was 14.9% (n = 100/671). mCIM indicated that 26% of K. pneumoniae isolates exhibited carbapenemase production. Furthermore, 24% and 17% of K. pneumoniae isolates demonstrated resistance to imipenem and meropenem, respectively. The blaIMI/IMP gene was detected in 91% of the isolates. Among imipenem-resistant isolates, 62.5% tested positive for the blaOXA-48 gene. Additionally, 29.4%, 76.5%, and 11.8% of meropenem-resistant isolates were positive for the blaKPC, blaOXA-48, and blaNDM genes, respectively. Real-time PCR analysis revealed increased expression levels of blaKPC (1.66-fold), blaOXA-48 (7.30-fold), blaNDM (4.22-fold), and blaIMI/NMC (2.39-fold) genes in resistant isolates when exposed to imipenem.

Conclusions:

These findings underscore the significance of establishing active surveillance networks to monitor and track the dissemination of carbapenemase-producing K. pneumoniae, which presents a global public health threat.

1. Background

Klebsiella is a Gram-negative bacterium that is ubiquitous in various environments and belongs to the Enterobacteriaceae family (1). It is more likely to cause acquired infections in hospitalized patients and immunosuppressed individuals (2). Among the Klebsiella genus, K. pneumoniae is the most frequently identified species and is responsible for the majority of nosocomial infections (3). Klebsiella pneumoniae accounts for over 70% of human Klebsiella infections, leading to conditions such as pneumonia, bacteremia, sepsis, meningitis, and diarrhea (4). Additionally, K. pneumoniae is the second most common cause of urinary tract infections (UTIs) after Escherichia coli (5).
Beta-lactam antibiotics are the most commonly used antibacterial agents for treating infectious diseases. Approximately 65% of injectable antibiotics in the United States fall into this category (6). These antibiotics hinder the biosynthesis of peptidoglycan by inactivating penicillin-binding proteins (PBPs) (7). Among beta-lactams, carbapenems are highly utilized in hospitals due to their potent broad-spectrum antibacterial activity and minimal side effects (8). The global concern lies in the emergence and prevalence of carbapenem resistance (9).
Carbapenems are typically reserved as a last resort for treating severe infections caused by multidrug-resistant gram-negative bacilli (MDR-GNB). Resistance to carbapenems in Gram-negative bacteria primarily arises from the production of carbapenemase enzymes (10). These enzymes are categorized into three distinct groups, A, B, and D, based on Ambler's classification (11, 12). Currently, the most significant serine carbapenemase enzymes in class A are the K. pneumoniae carbapenemase (KPC) enzymes (13). Diagnostic methods for detecting KPC enzymes include both phenotypic and molecular approaches (7). In 2017, the Clinical & Laboratory Standards Institute (CLSI) recommended the use of the modified carbapenem inactivation method (mCIM), which boasts a sensitivity and specificity of over 99% for detecting carbapenemases among Enterobacteriaceae. mCIM has gained popularity in microbiological laboratories due to its simplicity, high sensitivity, specificity, widespread applicability, and cost-effectiveness (14).

2. Objectives

In our current research, our aim was to investigate the prevalence and expression levels of carbapenemase-encoding genes in carbapenem-resistant K. pneumoniae (Cr-KPN) strains isolated from patients admitted to teaching hospitals in Shiraz, Iran. Recognizing the significance of Cr-KPN in nosocomial and community-acquired infections, we assessed carbapenemase production and resistance using mCIM and minimum inhibitory concentration (MIC) tests, respectively. Additionally, we utilized multiplex-PCR and real-time PCR assays to determine the frequency and expression levels of carbapenemase-encoding genes.

3. Methods

3.1. Study Design and Identification of Bacteria

This study was a cross-sectional investigation conducted on all patients who had been hospitalized in the internal wards and intensive care units (ICUs) of two teaching hospitals, specifically Faghihi and Namazi hospitals, located in Shiraz, Iran. Sample collection took place over a six-month period, spanning from September 2021 to February 2021. All clinical samples referred from hospital wards to clinical laboratories were included in this study. Samples collected from patients who had taken antibiotics in the last week were considered, while samples taken from urine bags were excluded from the study.
To initially identify K. pneumoniae, a series of conventional biochemical tests were conducted. These tests included Gram staining, the oxidase test, assessment of H2S and urease production, evaluation of motility, lactose fermentation, IMViC tests (Indole test, Methyl Red test, Voges Proskauer test, and Citrate utilization test), as well as nitrate reduction (15). Genomic DNA from the isolates was extracted using a DNA extraction kit (Tissue Genomic DNA Extraction Mini Kit, FAVORGEN/Taiwan). To confirm the final identification of the K. pneumoniae isolates, a polymerase chain reaction (PCR) assay targeting the specific rcsA gene was employed (16). The primer sequence used is provided in Table 1.
Table 1.Primers Used in the Multiplex PCR Assay for the Detection of Carbapenemase-Encoding Genes
Target GenesPrimer Sequences (5′ → 3′)Product Size, bpAnnealing Temperature, °CReference
KPC8858This study
FGGTCACCCATCTCGGAAA
RGCGGCGTTATCACTGTATTG
OXA47358This study
FAGAATAAGCAGCAAGGAT
RCCGAATAATATAGTCACCATT
VIM14558This study
FGATTGCCGATGGTGTTTGG
RGAGAAGTGCCGCTGTGTT
IMP13157This study
FTTGACACTCCATTTACTG
RATTAAGCCACTCTATTCC
IMI38957This study
FGTAGAATAGCCATCTTGTT
RATTAGTAGCACCATTGTC
GIM23158This study
FGTCAATTCCTACATACACATCAGA
RCCTAAGCCTTCCCACTCA
NDM5358This study
FGCCGACACTGAGCACTAC
RGGGAACGCCGCACCAAAC
IMI-qPCR19857This study
FTGAACGATTTCCATTATGTAGT
RTATTGTAAAGCGGCAGCA
OXA-qPCR8157This study
FTGCGTGTATTAGCCTTATCG
RTTTCTTGCCATTCCTTTGC
16SrRNA8057This study
FGGGCTCAACCTGGGAACTG
RTCACCGCTACACCTGGAAT
rcsA13357This study
FGCTGTTTGTTATCTTTATGTC
RAATCACCTGCTTATTATGC

3.2. Antimicrobial Susceptibility Test

The determination of the MIC followed the broth microdilution method as outlined in the CLSI guideline (CLSI 2020) for both imipenem and meropenem (17). In brief, the MIC test was conducted using a range of doses from 64 to 0.125 µg/mL in U-shaped 96-well microplates, and quality control was maintained using E. coli ATCC 25922 (18).

3.3. Phenotypical Screening of Carbapenemase Production

The phenotypic identification of carbapenemase-producing K. pneumoniae was carried out through the mCIM assay, following the CLSI guidelines. To summarize, a 1 µL loopful of bacteria from an overnight blood agar plate was mixed in a tube containing 2 mL of TSB medium and vortexed for 10 - 15 seconds. Subsequently, a 10 µg meropenem disk (Liofilchem, Italy) was added to each tube using sterile forceps. The tubes were then incubated at 35°C in ambient air for 4 hours. After this incubation period, the disks were removed from the tubes, and excess liquid was expelled from the disk before placing them on MHA plates that had previously been inoculated with meropenem-susceptible E. coli ATCC® 25922 as an indicator strain. All plates were incubated at 35°C overnight. Results were interpreted as follows: Carbapenemase positive (only mCIM positive) if the zone diameter was 6 - 15 mm and carbapenemase negative (mCIM negative) if the zone size was ≥ 19 mm. Klebsiella pneumoniae ATCC BAA-1705 and K. pneumoniae ATCC BAA-1706 served as the positive and negative controls, respectively.

3.4. Detection of Carbapenemase-Encoding Genes

Genomic DNA extraction was carried out using a DNA extraction kit (Tissue Genomic DNA Extraction Mini Kit, FAVORGEN/Taiwan). The presence of carbapenemase-encoding genes, which include blaKPC, blaOXA-48, blaVIM, blaNDM, blaGIM, blaIMP, and blaIMI/NMC, was assessed through a multiplex PCR assay. The primer sequences utilized for detecting these carbapenemase-encoding genes can be found in Table 1. Amplification was conducted in a 25 μL reaction mixture comprising 12 μL of master mix (Amplicon, Pishgham, Iran), 1 μL of forward primer (10 pmol), 1 μL of reverse primer (10 pmol), 3 μL of template DNA, and 8 μL of sterile distilled water. The multiplex PCR reaction was carried out under the following conditions: Initial denaturation (one cycle at 95°C for 10 minutes), denaturation (94°C for 45 seconds), annealing (57 to 58°C for 45 seconds), extension (72°C for 60 seconds), and final extension (72°C for 7 minutes). Denaturation, annealing, and extension steps were repeated for 35 cycles. Positive PCR products were sent for sequencing, and the results were analyzed using Chromas software version 2.6.6 (http://www.technelysium.com.au) and the NCBI Nucleotide BLAST program available on the National Center for Biotechnology Information website (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

3.5. RNA Extraction and cDNA Synthesis

Total RNA was extracted from mCIM-positive isolates as well as carbapenem-resistant and intermediate isolates (imipenem and meropenem) using an RNA extraction kit (Total RNA Extraction Kit, Parstous Biotechnology Co./Mashhad/Iran). In brief, RNA was extracted based on the results obtained from mCIM and MIC testing from overnight cultures grown in a TSB medium containing sub-MIC concentrations of imipenem (1 µg/mL). RNA concentrations were measured using a Nanodrop device (Geneva Nano), and RNA concentrations were normalized using Diethyl pyrocarbonate water (DEPC water). Subsequently, cDNA synthesis was performed using a cDNA synthesis kit (Easy cDNA Synthesis Kit, Parstous Biotechnology Co., Mashhad/Iran).

3.6. Expression of Carbapenemase-Encoding Genes

The Real-time PCR method was employed to assess the expression levels of carbapenemase-encoding genes using specific primers (Table 1). These primers were designed using Allele ID 7.5 software and their specificity was confirmed through Primer Blast and Nucleotide Blast on the NCBI website. The study investigated how K. pneumoniae responded to environmental stress induced by sub-MIC levels of imipenem. Carbapenem-resistant isolates were divided into two groups: Group 1, which was exposed to 1 µg/mL of imipenem, and group 2, which was not induced by imipenem. Real-time PCR was conducted on a QuanStudioTM 3 system machine (Thermo Fisher, USA), and duplicate PCR reactions were carried out using RealQ Plus 2x Master Mix Green (Ampliqon, Denmark). The PCR conditions consisted of an initial activation step at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 20 seconds, annealing at the respective temperature for each gene for 25 seconds, and extension at 72°C for 30 seconds. Melt curve analysis was performed after 40 cycles to examine the Real-time PCR products. Data analysis was conducted using comparative Ct (∆∆Ct) values (19, 20).

3.7. Statistical Analysis

The results from MIC, mCIM, and ∆∆CT values were recorded in an SPSS file (Version 18.0, IBM SPSS Statistics for Windows, Armonk, NY, USA). Statistical analysis was carried out using the Chi-Square test, and P-values less than 0.05 were considered statistically significant (21).

4. Results

4.1. Patient Characteristics and Distribution of Samples

One hundred K. pneumoniae strains were isolated from a total of 671 different clinical samples collected from included patients, resulting in an overall frequency of K. pneumoniae strains of 14.9%. Among these strains, 58% were isolated from male samples, while 42% were from female samples. Regarding age groups, the highest prevalence of K. pneumoniae was observed in patients over 60 years old (n = 49/100; 49%), followed by those under 15 years old (n = 21/100; 21%), patients aged 31 to 60 years old (n = 13/100; 13%), and individuals aged 16-30 (n = 4/100; 4%).
The distribution of K. pneumoniae in various clinical samples was as follows: Urine (n = 44), blood (n = 19), sputum (n = 13), endotracheal tube (n = 12), abdominal fluid (n = 3), catheter (n = 3), abscess (n = 1), pulmonary (n = 1), axillary culture (n = 1), throat (n = 1), nasal discharge (n = 1), and wound (n = 1). Moreover, the characteristics and frequency of clinical specimens among different hospital wards are shown in Table 2. The highest number of urine samples (43.2%; n = 19/44) and endotracheal tube samples (58.4%; n = 7/12) were collected from the internal ward.
Table 2.The Frequency of Clinical Samples Among Different Hospital Wards a
SpecimensHospital Wards
InternalICUInfectiousNeurologyHematology and oncologyChildrenSurgery
Urine (n = 44)19 (43.2)5 (11.4)13 (29.5)1 (2.3)1 (2.3)1 (2.3)4 (9)
Blood (n = 19)4 (21)5 (26.3)6 (31.6)0 (0.0)2 (10.5)1 (5.3)1 (5.3)
Sputum (n = 13)4 (30.7)5 (38.5)2 (15.4)0 (0.0)0 (0.0)0 (0.0)2 (15.4)
Endotracheal tube (n = 127 (58.4)3 (25)1 (8.3)0 (0.0)0 (0.0)0 (0.0)1 (8.3)
Abscess (n = 1)1 (100)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Pulmonary (n = 1)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (100)
Central venous catheters (n = 3)0 (0.0)2 (66.7)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (33.3)
Axillary culture (n = 1)0 (0.0)1 (100)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Abdominal fluid (n = 3)0 (0.0)1 (33.33)1 (33.33)0 (0.0)0 (0.0)0 (0.0)1 (33.33)
Throat (n = 1)0 (0.0)1 (100)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Nasal discharge (n = 1)0 (0.0)1 (100)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Wound (n = 1)1 (100)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Total (n = 100)36 (36)24 (24)23 (23)1 (1)3 (3)2 (2)11 (11)

a Values are expressed as No. (%).

4.2. Meropenem and Imipenem MIC Results

Regarding meropenem and imipenem MIC results, 24% of K. pneumoniae isolates were resistant to imipenem, while 17% were resistant to meropenem (P = 0.319). Furthermore, results from the mCIM assay indicated that 26% of bacteria were positive for carbapenemase production, 6% were intermediate, and 68% were negative (P = 0.0001). Table 3 shows that there was no statistically significant relationship between mCIM results and hospital wards. Additionally, no statistically significant relationship was found between mCIM results and the type of samples (Table 3).
Table 3.The Relationship Between mCIM Results, Hospital Wards, and the Source of Specimens a
VariablesmCIM ResultsP-Value
Positive Negative Intermediate
Hospital Wards0.176
Internal (n = 36)12 (33.3)24 (66.7)0 (0)
ICU (n = 24)4 (16.7)17 (70.8)3 (12.5)
Infectious (n = 23)7 (30.4)14 (60.9)2 (8.7)
Children (n = 2)2 (100)0 (0)0 (0)
Surgery (n = 11)0 (0)10 (90.9)1 (9.1)
Neurology (n = 1)0 (0)1 (100)0 (0)
Hematology and oncology (n = 3)1 (33.3)2 (66.7)0 (0)
Total26 (26)68 (68)6 (6)
Specimen type0.382
Urine (n = 44)13 (29.5)31 (70.5)0 (0)
Blood (n = 19)6 (31.6)11 (57.9)2 (10.5)
Sputum (n = 13)1 (7.7)11 (84.6)1 (7.7)
Endotracheal tube (n = 12)3 (25)6 (50)3 (25)
Abscess (n = 1)0 (0)1 (100)0 (0)
Pulmonary (n = 1)0 (0)1 (100)0 (0)
CV catheters (n = 3)1 (33.3)2 (66.7)0 (0)
Axillary culture (n = 1)0 (0)1 (100)0 (0)
Abdominal fluid (n = 3)0 (0)3 (100)0 (0)
Throat (n = 1)0 (0)1 (100)0 (0)
Nasal discharge (n = 1)1 (100)0 (0)0 (0)
Wound (n = 1)1 (100)0 (0)0 (0)
Total (n = 100)26 (26)68 (68)6 (6)

a Values are expressed as No. (%).

4.3. Frequency of Carbapenemase-Encoding Genes

The presence of carbapenemase-encoding genes in K. pneumonia isolates was investigated, and the results showed that blaIMI/NMC, blaOXA-48, blaKPC, and blaNDM genes were detected in 91 (91%), 19 (19%), 11 (11%), and 2 (2%) of the isolates, respectively. However, blaVIM, blaGIM, and blaIMP genes were not found among the isolates. The distribution of these carbapenemase-encoding genes in different hospital wards is presented in Table 4. Among these genes, blaKPC had the highest frequency among K. pneumoniae isolates recovered from internal and ICU wards, accounting for 16.7% (n = 6/36) and 16.7% (n = 4/24), respectively. Additionally, 25% (n = 6/24) of K. pneumoniae isolated from the ICU ward were positive for the blaOXA-48 gene, while the blaNDM gene (5.6%; n = 2/36) was detected exclusively in the internal ward. Overall, there was no statistically significant relationship between the frequency of carbapenemase-encoding genes and hospital wards (P > 0.05).
Table 4.The Prevalence and Relationship Between Carbapenemase-Encoding Genes and Hospital Wards a
Hospital WardsKPCOXA-48NDMIMI
Positive NegativeP-ValuePositive NegativeP-ValuePositive NegativeP-ValuePositive NegativeP-Value
Internal (n = 36)6 (16.7)30 (83.3)0. 4708 (22.2)28 (77.8)0.4682 (5.6)34 (94.4)0.72732 (88.9)4 (11.1)0. 941
ICU (n = 24)4 (16.7)20 (83.3)6 (25)18 (75)0 (0)24 (100)21 (87.5)3 (12.5)
Infectious (n = 23)0 (0)23 (100)4 (17.4)19 (82.6)0 (0)23 (100)22 (95.7)1 (4.3)
Children (n = 2)0 (0)2 (100)1 (50)1 (50)0 (0)2 (100)2 (100)0 (0)
Surgery (n = 11)1 (9.1)10 (90.9)0 (0)11 (100)0 (0)11 (100)10 (90.9)1 (9.1)
Neurology (n = 1)0 (0)1 (100)0 (0)1 (100)0 (0)1 (100)1 (100)0 (0)
Hematology and oncology (n = 3)0 (0)3 (100)0 (0)3 (100)0 (0)3 (100)3 (100)0 (0)
Total11 (11)89 (89)19 (19)81 (81)2 (2)98 (98)91 (91)9 (9)

a Values are expressed as No. (%).

Furthermore, 66.7% (n = 2/3) of K. pneumonia isolates obtained from CV catheter samples tested positive for both the blaKPC and blaOXA-48 genes. Additionally, 15.8% (n = 3/19) and 9.1% (n = 4/44) of K. pneumoniae isolated from blood and urine samples, respectively, were positive for the blaKPC gene. Conversely, 94.7% (n = 18/19) of K. pneumonia isolates from blood samples were positive for the blaIMI/NMC gene. There was no statistically significant relationship between the frequency of carbapenemase-encoding genes and the source of samples (P > 0.05). The analysis also revealed a statistically significant relationship between MIC results and the frequency of certain carbapenemase-encoding genes. As shown in Table 5, 62.5% (n = 15/24) and 8.3% (n = 2/24) of imipenem-resistant isolates were positive for the blaOXA-48 (P = 0.0001) and blaNDM (P = 0.040) genes, respectively. Conversely, 29.4% (n = 5/17), 76.5% (n = 13/17), and 11.8% (n = 2/17) of meropenem-resistant isolates were positive for blaKPC (p = 0.028), blaOXA-48 (P = 0.0001), and blaNDM (P = 0.007) genes, respectively.
Table 5.The Relationship Between the Frequency of Carbapenemase-Encoding Genes and MIC Results a
Susceptibility Profile (N)KPCP-ValueOXA-48P-ValueNDMP-ValueIMIP-Value
AntibioticsP NP NP NP N
Imipenem0.1990.00010.0400.320
R (24)5 (20.8)19 (79.2)15 (62.5)9 (37.5)2 (8.33)22 (91.67)23 (95.8)1 (4.2)
S (67)5 (7.5)62 (92.5)1 (1.5)66 (98.5)0 (0)67 (100)59 (88)8 (12)
I (9)1 (11.1)8 (88.9)3 (33.33)6 (66.7)0 (0)9 (100)9 (100)0 (0)
Meropenem0.0280.0010.0070.355
R (17)5 (29.4)12 (70.6)13 (76.5)14 (23.5)2 (11.8)15 (88.2)17 (100)0 (0)
S (72)5 (7)67 (93)1 (1.4)71 (98.6)0 (0)72 (100)64 (88.9)8 (11.1)
I (11)1 (9)10 (91)5 (45.5)6 (54.5)0 (0)11 (100)

Abbreviations: P, positive; N, negative; R, resistant; S, sensitive; I, intermediate.

a Values are expressed as No. (%).

4.4. Expression Levels of Carbapenemase-Encoding Genes

The results obtained from the real-time PCR assay indicated an increase in the expression levels of the blaKPC (1.66-fold), blaOXA-48 (7.30-fold), blaNDM (4.22-fold), and blaIMI/NMC (2.39-fold) genes in resistant isolates when exposed to imipenem. Our study demonstrated the overexpression of these genes when induced by 1 µg/ml of imipenem. It was observed that all bacteria resistant to imipenem in the MIC method expressed at least one of the investigated carbapenemase genes. Furthermore, resistant bacteria exhibited varying expression levels when exposed to sub-MIC values of imipenem, with isolates having higher MIC values generally showing higher expression levels. An increase in gene expression was noted in isolates that were identified as gene carriers by the PCR assay.

5. Discussion

Klebsiella pneumoniae is responsible for a significant proportion of nosocomial infections attributed to Klebsiella spp. Hospital-acquired pneumonia is associated with K. pneumoniae in 3.8% to 13.7% of cases (22). The primary cause of carbapenem resistance in Gram-negative bacteria is the production of carbapenemases (8). Among Gram-negative bacteria, Cr-KPN has emerged as a globally significant nosocomial pathogen (23). The objective of our investigation was to analyze the phenotype and molecular frequency of carbapenemase-encoding genes in Cr-KPN isolates from Shiraz, Iran. Additionally, Cr-KPN isolates underwent a real-time PCR assay to assess the expression levels of carbapenemase-encoding genes. Our analysis revealed a higher rate of resistance to imipenem compared to meropenem, suggesting that meropenem may be a more effective treatment option for Cr-KPN infections. The mCIM test indicated that 32% of isolates exhibited carbapenemase production with a positive or intermediate profile. The detection rates for the blaIMI/IMP, blaOXA-48, blaKPC, and blaNDM genes were 91%, 19%, 11%, and 2%, respectively.
Numerous studies worldwide have investigated the prevalence of carbapenemase-encoding genes in K. pneumoniae isolates. In 2023, Hallal Ferreira Raro et al. found that among K. pneumoniae producing carbapenemase, 40%, 28%, and 20% tested positive for the blaNDM-1, blaKPC, and blaOXA-48 genes, respectively (22). Solanki et al. reported that 71.1% of K. pneumoniae isolates were positive for the blaNDM-1 gene, while 14.3% were positive for blaKPC in a study conducted in the same year. Notably, all isolates tested negative for blaVIM and blaIMP genes (24). In 2022, Awoke et al. discovered that 29.6% of a total of 132 K. pneumoniae isolates were not susceptible to one or more carbapenems. Moreover, 21.2% of the isolates were found to produce carbapenemase, with 92.9% of these carrying the blaNDM gene (25). In a multinational prospective study, it was observed that 30% of 2301 K. pneumoniae samples produced carbapenemase (KPC, NDM, OXA-48-like, or VIM) (26).
Another study by Kilic et al. in 2016 reported that 50% of K. pneumoniae isolates were resistant to carbapenems. Additionally, 82.3%, 33.9%, 9.7%, and 4.8% of the isolates tested positive for the blaOXA-48, blaNDM-1, blaIMP-1, and blaVIM genes, respectively (27). Firoozeh et al. in 2016, similar to our findings, detected the blaKPC gene in 11.6% of K. pneumoniae isolates (28). In 2017, Khorvash et al. conducted a study on K. pneumoniae isolates, reporting a prevalence of 10.3% for blaVIM, 10.3% for blaIMP, and 3.4% for blaOXA genes. Notably, blaKPC and blaNDM genes were not detected (29). Hosseinzadeh et al. in 2018 revealed that among 29 carbapenem-resistant K. pneumoniae, 25 exhibited a high level of resistance to imipenem (MIC ≥ 4), with 10.9% and 0.9% of isolates testing positive for blaNDM-1 and blaOXA-48 genes, respectively (30).
Finally, in 2018, Moghadampour et al. conducted a study indicating that 91.9% of K. pneumoniae isolates were resistant to carbapenems. The frequencies of blaIMP, blaNDM-1, and blaOXA-48 genes were reported as 2.9%, 52.9%, and 70.6%, respectively (31). In 2020, Vivas et al. (32) found that 56.5% of K. pneumoniae isolates harbored at least one carbapenemase gene, with 50.3% carrying blaNDM-1 and 5.4% carrying blaKPC genes. Additionally, 1.2% of K. pneumoniae isolates possessed both blaNDM-1 and blaKPC genes. Their study employed the broth microdilution method to determine the MIC of K. pneumoniae isolates, revealing that isolates carrying blaNDM-1 and blaKPC genes exhibited high resistance to carbapenems.
In 2019, Aires -de-Sousa et al. conducted a study in Portugal (33), identifying blaKPC-3, blaOXA-181, and blaGES-5 as the most prevalent carbapenemase-encoding genes, with frequencies of 78%, 20%, and 17%, respectively. Among 46 carbapenemase-producing isolates, 28% were susceptible to imipenem (MIC < 0.5 mg/L), and 22% showed susceptibility to meropenem (MIC < 1 mg/L). In a 2020 study by Lopes et al. (34), blaKPC-2 (91%) and blaOXA-48 (9%) were identified as the most common carbapenemase-encoding genes. In our present study, real-time PCR analysis demonstrated that exposure to imipenem led to a 1.66-fold increase in the expression level of blaKPC, a 7.30-fold increase in blaOXA-48, a 4.22-fold increase in blaNDM, and a 2.39-fold increase in blaIMI/NMC genes. Notably, the expression levels of blaOXA-48 and blaNDM genes were higher than those of other genes. In a 2019 study by Mohammadi Bandari et al. (35), the expression levels of blaKPC and blaGES increased by 1.04-fold and 12.21-fold, respectively, in the presence of 2 µg/mL of imipenem. Their findings also indicated overexpression of these genes when induced by 2 µg/mL of imipenem, consistent with the results of our study.

5.1. Conclusions

Given the widespread resistance of K. pneumoniae strains to commonly used antibiotics, it is essential to detect isolates that produce carbapenemases to guide antibiotic treatment. The study conducted in the area revealed a worrisome prevalence of carbapenemase-producing K. pneumoniae isolates. These findings emphasize the significance of establishing active surveillance networks capable of monitoring and controlling the dissemination of carbapenemase-producing K. pneumoniae, which poses a global public health risk. Additionally, the data underscores the importance of implementing effective antimicrobial stewardship practices within hospitals.

Acknowledgments

Footnotes

References

  • 1.
    Granov D, Dedeic-Ljubovic A, Salimovic-Besic I. Characterization of carbapenemase-producing Klebsiella pneumoniae in clinical center university of Sarajevo, Bosnia and Herzegovina. Microb Drug Resist. 2020;26(9):1038-45. [PubMed ID: 32208954]. https://doi.org/10.1089/mdr.2019.0188.
  • 2.
    Emeraud C, Birer A, Girlich D, Jousset AB, Creton E, Naas T, et al. Polyclonal dissemination of OXA-232 carbapenemase–producing Klebsiella pneumoniae, France, 2013-2021. Emerg Infect Dis. 2022;28(11):2304-7. [PubMed ID: 36286195]. [PubMed Central ID: PMC9622251]. https://doi.org/10.3201/eid2811.221040.
  • 3.
    Diekema DJ, Hsueh PR, Mendes RE, Pfaller MA, Rolston KV, Sader HS, et al. The microbiology of bloodstream infection: 20-year trends from the SENTRY antimicrobial surveillance program. Antimicrob Agents Chemother. 2019;63(7). [PubMed ID: 31010862]. [PubMed Central ID: PMC6591610]. https://doi.org/10.1128/AAC.00355-19.
  • 4.
    Fazili T, Sharngoe C, Endy T, Kiska D, Javaid W, Polhemus M. Klebsiella pneumoniae liver abscess: An emerging disease. Am J Med Sci. 2016;351(3):297-304. [PubMed ID: 26992260]. https://doi.org/10.1016/j.amjms.2015.12.018.
  • 5.
    Tayebeh F, Amani J, Nazarian S, Moradyar M, Mirhosseini SA. Molecular diagnosis of clinically isolated Klebsiella pneumoniae strains by PCR-ELISA. Journal of Applied Biotechnology Reports. 2016;3(4):501-5.
  • 6.
    Bush K, Bradford PA. beta-Lactams and beta-Lactamase inhibitors: An overview. Cold Spring Harb Perspect Med. 2016;6(8). [PubMed ID: 27329032]. [PubMed Central ID: PMC4968164]. https://doi.org/10.1101/cshperspect.a025247.
  • 7.
    Cui X, Zhang H, Du H. Carbapenemases in Enterobacteriaceae: Detection and antimicrobial therapy. Front Microbiol. 2019;10:1823. [PubMed ID: 31481937]. [PubMed Central ID: PMC6710837]. https://doi.org/10.3389/fmicb.2019.01823.
  • 8.
    Karaiskos I, Galani I, Papoutsaki V, Galani L, Giamarellou H. Carbapenemase producing Klebsiella pneumoniae: implication on future therapeutic strategies. Expert Rev Anti Infect Ther. 2022;20(1):53-69. [PubMed ID: 34033499]. https://doi.org/10.1080/14787210.2021.1935237.
  • 9.
    Meletis G. Carbapenem resistance: overview of the problem and future perspectives. Ther Adv Infect Dis. 2016;3(1):15-21. [PubMed ID: 26862399]. [PubMed Central ID: PMC4735501]. https://doi.org/10.1177/2049936115621709.
  • 10.
    Lee C, Lee JH, Park KS, Kim YB, Jeong BC, Lee SH. Global dissemination of carbapenemase-producing Klebsiella pneumoniae: epidemiology, genetic context, treatment options, and detection methods. Front Microbiol. 2016;7:895. https://doi.org/10.3389/fmicb.2016.00895.
  • 11.
    Zafer MM, Al-Agamy MH, El-Mahallawy HA, Amin MA, Ashour MS. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. Biomed Res Int. 2014;2014:101635. [PubMed ID: 24707471]. [PubMed Central ID: PMC3953503]. https://doi.org/10.1155/2014/101635.
  • 12.
    Bialvaei AZ, Kafil HS, Asgharzadeh M, Yousef Memar M, Yousefi M. Current methods for the identification of carbapenemases. J Chemother. 2016;28(1):1-19. [PubMed ID: 26256147]. https://doi.org/10.1179/1973947815Y.0000000063.
  • 13.
    Yonekawa S, Mizuno T, Nakano R, Nakano A, Suzuki Y, Asada T, et al. Molecular and epidemiological characteristics of carbapenemase-producing Klebsiella pneumoniae clinical isolates in Japan. mSphere. 2020;5(5). [PubMed ID: 33087515]. [PubMed Central ID: PMC7580953]. https://doi.org/10.1128/mSphere.00490-20.
  • 14.
    Kuchibiro T, Komatsu M, Yamasaki K, Nakamura T, Nishio H, Nishi I, et al. Evaluation of the modified carbapenem inactivation method for the detection of carbapenemase-producing Enterobacteriaceae. J Infect Chemother. 2018;24(4):262-6. [PubMed ID: 29248418]. https://doi.org/10.1016/j.jiac.2017.11.010.
  • 15.
    Kazemian H, Heidari H, Ghanavati R, Ghafourian S, Yazdani F, Sadeghifard N, et al. Phenotypic and genotypic characterization of ESBL-, AmpC-, and carbapenemase-producing Klebsiella pneumoniae and Escherichia coli isolates. Med Princ Pract. 2019;28(6):547-51. [PubMed ID: 30995662]. [PubMed Central ID: PMC6944897]. https://doi.org/10.1159/000500311.
  • 16.
    Dong D, Liu W, Li H, Wang Y, Li X, Zou D, et al. Survey and rapid detection of Klebsiella pneumoniae in clinical samples targeting the rcsA gene in Beijing, China. Front Microbiol. 2015;6:519. [PubMed ID: 26052327]. [PubMed Central ID: PMC4440914]. https://doi.org/10.3389/fmicb.2015.00519.
  • 17.
    Humphries R, Bobenchik AM, Hindler JA, Schuetz AN. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100, 31st Edition. J Clin Microbiol. 2021;59(12). e0021321. [PubMed ID: 34550809]. [PubMed Central ID: PMC8601225]. https://doi.org/10.1128/JCM.00213-21.
  • 18.
    Shannon A, Wagner K, Cheeptham N, Stephens G. A pilot survey of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae mediated by K pneumoniae serine carbapenemases in a regional referral hospital in British Columbia. Can J Infect Dis Med Microbiol. 2011;22(2):61-3. [PubMed ID: 22654927]. [PubMed Central ID: PMC3142595]. https://doi.org/10.1155/2011/802329.
  • 19.
    Sharahi JY, Hashemi A, Ardebili A, Davoudabadi S. Molecular characteristics of antibiotic-resistant Escherichia coli and Klebsiella pneumoniae strains isolated from hospitalized patients in Tehran, Iran. Ann Clin Microbiol Antimicrob. 2021;20(1):32. [PubMed ID: 33906654]. [PubMed Central ID: PMC8077724]. https://doi.org/10.1186/s12941-021-00437-8.
  • 20.
    Jousset AB, Rosinski-Chupin I, Takissian J, Glaser P, Bonnin RA, Naas T. Transcriptional landscape of a bla KPC-2 plasmid and response to imipenem exposure in Escherichia coli TOP10. Front Microbiol. 2018;9:2929. [PubMed ID: 30559731]. [PubMed Central ID: PMC6286996]. https://doi.org/10.3389/fmicb.2018.02929.
  • 21.
    Omer FH, Al-Khafaji NSK, Al-Alaq FT, Al-Dahmoshi HOM, Memariani M, Saki M. Synergistic effects of silybin and curcumin on virulence and carbapenemase genes expression in multidrug resistant Klebsiella oxytoca. BMC Res Notes. 2022;15(1):330. [PubMed ID: 36273212]. [PubMed Central ID: PMC9588228]. https://doi.org/10.1186/s13104-022-06172-3.
  • 22.
    Hallal Ferreira Raro O, Nordmann P, Dominguez Pino M, Findlay J, Poirel L. Emergence of carbapenemase-producing hypervirulent Klebsiella pneumoniae in Switzerland. Antimicrob Agents Chemother. 2023;67(3). e0142422. [PubMed ID: 36853006]. [PubMed Central ID: PMC10019205]. https://doi.org/10.1128/aac.01424-22.
  • 23.
    Munoz-Price LS, Poirel L, Bonomo RA, Schwaber MJ, Daikos GL, Cormican M, et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis. 2013;13(9):785-96. [PubMed ID: 23969216]. [PubMed Central ID: PMC4673667]. https://doi.org/10.1016/S1473-3099(13)70190-7.
  • 24.
    Solanki R, Vanjari L, Subramanian S, B A, E N, Lakshmi V. Comparative Evaluation of Multiplex PCR and Routine Laboratory Phenotypic Methods for Detection of Carbapenemases among Gram Negative Bacilli. J Clin Diagn Res. 2014;8(12):DC23-6. [PubMed ID: 25653949]. [PubMed Central ID: PMC4316255]. https://doi.org/10.7860/JCDR/2014/10794.5322.
  • 25.
    Awoke T, Teka B, Aseffa A, Sebre S, Seman A, Yeshitela B, et al. Detection of blaKPC and blaNDM carbapenemase genes among Klebsiella pneumoniae isolates in Addis Ababa, Ethiopia: Dominance of blaNDM. PLoS One. 2022;17(4). e0267657. [PubMed ID: 35476721]. [PubMed Central ID: PMC9045624]. https://doi.org/10.1371/journal.pone.0267657.
  • 26.
    Grundmann H, Glasner C, Albiger B, Aanensen DM, Tomlinson CT, Andrasevic AT, et al. Occurrence of carbapenemase-producing Klebsiella pneumoniae and Escherichia coli in the European survey of carbapenemase-producing Enterobacteriaceae (EuSCAPE): a prospective, multinational study. Lancet Infect Dis. 2017;17(2):153-63. [PubMed ID: 27866944]. https://doi.org/10.1016/S1473-3099(16)30257-2.
  • 27.
    Kilic A, Dogan E, Kaya S, Oren S, Tok D, Ardic N, et al. Rapid identification of Klebsiella pneumoniae by matrix‐assisted laser desorption/ionization‐time of flight mass spectrometry and detection of meropenem resistance by flow cytometric assay. J Clin Lab Anal. 2016;30(6):1191-7. [PubMed ID: 27239799]. [PubMed Central ID: PMC6807021]. https://doi.org/10.1002/jcla.22002.
  • 28.
    Firoozeh F, Aghaseyed-Hosseini M, Zibaei M, Piroozmand A. Detection of blaKPC and blaGES Carbapenemase Genes in Klebsiella pneumoniae Isolated from Hospitalized Patients in Kashan, Iran. Recent Pat Antiinfect Drug Discov. 2016;11(2):183-8. [PubMed ID: 27527726]. https://doi.org/10.2174/1574891X11666160813192556.
  • 29.
    Khorvash F, Yazdani MR, Soudi AA, Shabani S, Tavahen N. Prevalence of acquired carbapenemase genes in Klebsiella pneumoniae by multiplex PCR in Isfahan. Adv Biomed Res. 2017;6:41. [PubMed ID: 28503496]. [PubMed Central ID: PMC5414410]. https://doi.org/10.4103/2277-9175.204594.
  • 30.
    Hosseinzadeh Z, Sedigh Ebrahim-Saraie H, Sarvari J, Mardaneh J, Dehghani B, Rokni-Hosseini SMH, et al. Emerge of bla(NDM-1) and bla(OXA-48-like) harboring carbapenem-resistant Klebsiella pneumoniae isolates from hospitalized patients in southwestern Iran. J Chin Med Assoc. 2018;81(6):536-40. [PubMed ID: 29030025]. https://doi.org/10.1016/j.jcma.2017.08.015.
  • 31.
    Moghadampour M, Salari-Jazi A, Faghri J. High rate of carbapenem-resistant Klebsiella pneumoniae detected from hospital equipments in Iran. Acta Microbiol Immunol Hung. 2018;65(4):529-38. [PubMed ID: 30111161]. https://doi.org/10.1556/030.65.2018.039.
  • 32.
    Vivas R, Dolabella SS, Barbosa AAT, Jain S. Prevalence of Klebsiella pneumoniae carbapenemase - and New Delhi metallo-beta-lactamase-positive K. pneumoniae in Sergipe, Brazil, and combination therapy as a potential treatment option. Rev Soc Bras Med Trop. 2020;53. e20200064. [PubMed ID: 32401864]. [PubMed Central ID: PMC7269519]. https://doi.org/10.1590/0037-8682-0064-2020.
  • 33.
    Aires-de-Sousa M, Ortiz de la Rosa JM, Goncalves ML, Pereira AL, Nordmann P, Poirel L. Epidemiology of carbapenemase-producing Klebsiella pneumoniae in a hospital, Portugal. Emerg Infect Dis. 2019;25(9):1632-8. [PubMed ID: 31441424]. [PubMed Central ID: PMC6711212]. https://doi.org/10.3201/eid2509.190656.
  • 34.
    Lopes E, Saavedra MJ, Costa E, de Lencastre H, Poirel L, Aires-de-Sousa M. Epidemiology of carbapenemase-producing Klebsiella pneumoniae in northern Portugal: Predominance of KPC-2 and OXA-48. J Glob Antimicrob Resist. 2020;22:349-53. [PubMed ID: 32348902]. https://doi.org/10.1016/j.jgar.2020.04.007.
  • 35.
    Mohammadi Bandari N, Zargar M, Keyvani H, Talebi M, Zolfaghari MR. Antibiotic resistance among Klebsiella pneumoniae, molecular detection and expression level of blaKPC and blaGES genes by real-time PCR. Jundishapur Journal of Microbiology. 2019;12(10). https://doi.org/10.5812/jjm.93070.

Similar Articles

26
Dec
2022
Jundishapur J Microbiol

High Prevalence of blaOXA-48 and blaNDM-Producing Carbapenem-Resistant Klebsiella pneumoniae Isolated from Clinical Samples in Shahid Rajaei Hospital in Tehran, Iran

Maryam Mokhtari,
Ali Mojtahedi,
Nejat Mahdieh,
Alireza Jafari,
Mohammad Javad Arya

Mokhtari M, Mojtahedi A, Mahdieh N, Jafari A, Arya MJ. High Prevalence of blaOXA-48 and blaNDM-Producing Carbapenem-Resistant Klebsiella pneumoniae Isolated from Clinical Samples in Shahid Rajaei Hospital in Tehran, Iran. Jundishapur J Microbiol. 2022;15(10):e130804. doi: https://doi.org/10.5812/jjm-130804

10
Nov
2019
Jundishapur Journal of Microbiology

Antibiotic Resistance Among Klebsiella pneumoniae, Molecular Detection and Expression Level of blaKPC and blaGES Genes by Real-Time PCR

Narjes Mohammadi Bandari,
Mohsen Zargar,
Hossein Keyvani,
Malihe Talebi,
Mohammad Reza Zolfaghari

Mohammadi Bandari N, Zargar M, Keyvani H, Talebi M, Zolfaghari MR. Antibiotic Resistance Among Klebsiella pneumoniae, Molecular Detection and Expression Level of blaKPC and blaGES Genes by Real-Time PCR. Jundishapur J Microbiol. 2019;12(10):e93070. doi: https://doi.org/10.5812/jjm.93070

10
May
2021
 Jundishapur J Microbiol

Co-occurrence of Carbapenemase-encoding Genes Among Klebsiella pneumoniae Clinical Isolates: Positive Relationship of bla NDM and bla SIM with Imipenem Resistance

Maryam Galehdar,
Maryam Ghane,
Laleh Babaeekhou

Galehdar M, Ghane M, Babaeekhou L. Co-occurrence of Carbapenemase-encoding Genes Among Klebsiella pneumoniae Clinical Isolates: Positive Relationship of bla NDM and bla SIM with Imipenem Resistance. Jundishapur J Microbiol. 2021;14(2):e112486. doi: https://doi.org/10.5812/jjm.112486

27
Aug
2017

Molecular Characterization of Carbapenem-Resistant Klebsiella pneumoniae Species Isolated From a Tertiary Hospital, Ankara, Turkey

Nevreste Celikbilek,
Ozlem Unaldi,
Fisun Kirca,
Aysegul Gozalan,
Ziya C Acikgoz,
Riza Durmaz

Celikbilek N, Unaldi O, Kirca F, Gozalan A, Acikgoz ZC, et al. Molecular Characterization of Carbapenem-Resistant Klebsiella pneumoniae Species Isolated From a Tertiary Hospital, Ankara, Turkey. Jundishapur J Microbiol. 2017;10(10):e14341. doi: https://doi.org/10.5812/jjm.14341

16
Jul
2025
Jundishapur J Microbiol

Characteristics of Colistin-Resistant and Colistin-Sensitive Isolates of Carbapenem-Resistant Klebsiella pneumoniae Among Hospitalized Patients in Tehran, Iran

Maryam Barkhordari,
Azade Hajihasani,
Masoumeh Rasouli-Nasab,
Fereshteh Shahcheraghi

Barkhordari M, Hajihasani A, Rasouli-Nasab M, Shahcheraghi F. Characteristics of Colistin-Resistant and Colistin-Sensitive Isolates of Carbapenem-Resistant Klebsiella pneumoniae Among Hospitalized Patients in Tehran, Iran. Jundishapur J Microbiol. 2025;18(7):e158620. doi: https://doi.org/10.5812/jjm-158620


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles