Linkage Analysis of Autosomal Dominant Polycystic Kidney Disease in Iranian Families through PKD1 and PKD2 DNA Microsatellite Markers

Author(s):
Fatemeh Hajizadeh TaftiFatemeh Hajizadeh Tafti1, Mohammad Reza DehghaniMohammad Reza Dehghani2, Ehsan Farashahi YazdEhsan Farashahi Yazd3,*, Maryam GolzadehMaryam Golzadeh4, Mohammad Yahya Vahidi MehrjardiMohammad Yahya Vahidi Mehrjardi2, Seyed Mehdi KalantarSeyed Mehdi Kalantar4, 5
1Medical Biotechnology Research Center, Ashkezar Branch, Islamic Azad University, Ashkezar, Yazd, IR Iran
2Yazd Medical Genetics Research Center, Shahid Sadoughi University of Medical Sciences, Yazd, IR Iran
3Stem Cell Biology Research Center, Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, IR Iran
4Recurrent Abortion Research Center, Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, IR Iran
5Department of Genetics, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, IR Iran

Nephro-Urology Monthly:Vol. 9, issue 4; e59996
Published online:Jul 19, 2017
Article type:Research Article
Received:Nov 29, 2016
Accepted:May 21, 2017
How to Cite:Hajizadeh Tafti F, Dehghani MR, Farashahi Yazd E, Golzadeh M, Vahidi Mehrjardi MY, et al. Linkage Analysis of Autosomal Dominant Polycystic Kidney Disease in Iranian Families through PKD1 and PKD2 DNA Microsatellite Markers. Nephro-Urol Mon. 2017;9(4):e59996. doi: https://doi.org/10.5812/numonthly.59996

Abstract

Background:

Autosomal dominant polycystic kidney disease (ADPKD) is a heterogeneous disorder. Two known loci, including PKD1 (16p13.3) and PKD2 (4q21), as well as a third locus that is not clearly identified, cause ADPKD.

Objectives:

The aim of this study was to assess the genetic linkage of 4 linked microsatellite markers of PKD genes (PKD1 and PKD2) to ADPKD for genetic screening of familiar PKD patients in Yazd.

Methods:

This familial case-control study was conducted among 18 families. The linkage analysis was performed using 2 pairs of polymorphic microsatellite markers that are closely linked to the PKD1 gene (16AC2.5 and KG8) and 2 other pairs closely linked to the PKD2 gene (D4S231 and D4S423). These markers were detected through PCR of tandem repeats method and polyacrylamide gel electrophoresis.

Results:

The disease was linked to PKD1 about 77.8%, PKD2 16.7% of the families, and to neither gene in 5.5%, according to LOD scores and allele segregation analysis. It also found relatively high heterozygosity and polymorphism information contents (PIC) values for 3 markers including 16AC2.5 (PIC: 0.798) for PKD1 gene and D4S423 (PIC: 0.807) as well as D4S231 (PIC: 0.741) for PKD2 gene. However, it seems that KG8 marker has no significant linkage to the PKD1 gene (PIC: 0.329) among Yazd PKD patients.

Conclusions:

These results show similarity to another report from Iranian families and according to these similar results, it seems that 16AC2.5 and D4S423 markers would provide an improved framework for genetic screening of ADPKD patients among familiar PKD patients in Yazd.

1. Background

Autosomal dominant polycystic kidney disease (ADPKD) is a genetic nephropathy characterized by the presence of fluid-filled cysts primarily in the kidneys. This disease is one of the most common hereditary disorders in humans. The incidence of ADPKD is about 1 in 500 to 1 in 1000 in western countries, however, there is no updated and comprehensive data regarding the polymorphic linkage markers pattern among the Iranian population. Up to 50% of patients with ADPKD require renal replacement therapy by 60 years (1). The frequency of ADPKD is high as compared to other prominent genetic disorders, approximately 10, 15, and 20 times higher than sickle cell anemia, cystic fibrosis, and Huntington’s disease, respectively. Another form of PKD is autosomal recessive and rare with an incidence of 1 in 20,000 (2).

ADPKD is genetically heterozygous and the mutations occur in the PKD1 gene located on chromosome 16p13.3 in 85% of the patients (3) and in PKD2 gene on chromosome 4q21-23 in 15% of the patients (4). The presence of the third gene related to ADPKD in some patients is unclear and does not show linkage to either the PKD1 or PKD2 genes (3, 4). The mutations of PKD1 and PKD2 genes can produce identical renal and extrarenal manifestations. PKD2 patients develop the above symptoms at a later age with less intensity as compared to PKD1 patients (1).

The PKD1 is a long gene with 46 exons (750 Kbps length), 970 known pathogenic mutations, and there are many homology regions with another part of the genome that make it a hard case for mutation detection. However, PKD2 has a shorter size, which has fewer problems for direct screening for mutation in compare to PKD1. Beyond this, the recently wide progress in sequencing methods has eliminated this problem, however, using a former method like polymorphic microsatellite linkage analysis is acceptable and cheap. The ADPKD screening and predict pre-symptomatic prenatal ADPKD by use of microsatellite markers closely linked to these loci is commonly used in clinical genetics (5-7).

In this regard, we performed this analysis to assess the genetic linkage of 4 microsatellite markers of polycystic kidney disease genes (PKD1 & PKD2) in ADPKD among 18 Iranian affected families living in Yazd.

2. Methods

2.1. Cases and Controls

The samples were collected from 94 individuals of 18 unrelated ADPKD affected Iranian families (from Yazd) in 2016. This familial case-control study had at least 2 affected and 2 - 3 unaffected members from every family, although most of the families were larger. A total of 47 of the introduced patients by Yazd renal diseases charity foundation, who had a confirmed diagnosis considering their special conditions such as age of the patients (29.04 ± 23.76 years), family history, clinical symptoms, related therapies, and number of cysts in the kidney, were entered into our study (Table 1). The genetic pedigrees were drawn based on a completed questionnaire of each patient. The Ethics Committee of Yazd Reproductive Science Center approved the study protocol and the signed consent after ensure understanding were obtained from all participants (ethic code: IR.SSU.RSI.REC.1395.34).

Table 1.Demographic and Clinical Data
CharacteristicsNo. (%)
Gender
Women19 (40.5)
Men28 (59.5)
Family History
Positive45 (95.8)
Negative2 (4.2)
Death
Positive39 (83)
Negative8 (17.1)
Clinical symptom
Cyst in both kidneys43 (91.5)
Kidney stone18 (38.3)
Blood pressure26 (55.3)
Renal pain29 (61.7)
Blood in the urine14 (29.8)
Treatment
Drug treatment20 (42.5)
Dialysis10 (21.3)

2.2. Microsatellites Genotyping

Genomic DNA was extracted from peripheral blood leukocytes using the phenol-chloroform method. The quality and quantity of the extracted DNA were checked by NanoDrop spectrophotometer (ND-1000) and gel electrophoresis.

Four microsatellite markers on NCBI map viewer and uniSTS data on chromosome 4q and 16p were selected and separated from each other by ∼10 cM (KG8, 16AC2.5, D4S423 and D4S231) that the type of these markers is (AC)n repeated (5-8). Using the Ensemble genome database, we checked the correct sequence and distance of the STR marker and disease loci. Two microsatellite markers (16AC2.5 and KG8) are localized within 350kb of the PKD1 gene (5, 9-11). D4S423 and D4S231 (specific markers) were used to assess linkage to PKD2 (5, 12, 13).

The primers used for PCR were: KG8 (IF: CTCCCAGGGTGGAGGAAGGTG, IR: GCAG GCACAGCCAGCTCCGAG) (109 - 126 N), 16AC2.5 (IF: AAGGCTGGCAGAGGAG GTG, IR: CAGTTGTGTTTCCTAATCGGCG) (109 - 142 N), D4S423 (IF: TTGAGTAGTTCC TGAAGC AGC, IR: CAAAGTCCTCCATCTTGAGTG (103 - 121 N), D4S231 (IF: ACTATTCAGT GCTAGGAGTTCCC, and IR: GCATCAACTTGGGGAGATCC) (144 - 157 N). Briefly, the target sequence was amplified in 20 μL reaction cocktail containing Mix Red-Mgcl2 (1.5 mM, Amplicon), an equal amount of forward and reverse primer (0. 5 pmol/μL) and genomic DNA (25 ng). Cycle amplification was performed in the Master Cycler (Eppendorf 5331, Germany), (5 minutes at 95°C as an initial denaturation, 35 cycles of 30 seconds at 95°C, 1 minute at an annealing temperature (64°C for KG8, 67°C for D16S291 and D4S423, 58 °C for D4S231), 1 minute at 72°C and 10 minutes at 72°C for final extension). 5 mL of mixture was loaded on a 12% polyacrylamide gel containing 0.5 × TBE buffer for resolving the markers. The gel was run for 5 hours with 100 voltage; after electrophoresis and colored by silver nitrate, the gel was scanned and the allele patterns were analyzed manually. The size of alleles and the informative marker are different in different populations and the sample size and number of evaluated markers are effective in the detection and selection of the informative marker.

2.3. Linkage Analysis and Haplotype Construction

Due to more suitability for a genetic linkage study, the large families were investigated and the evidence of the linkage to PKD1 and PKD2 loci was obtained by using of flanking microsatellite polymorphisms. The calculation of LOD scores for this two-point linkage analysis was done via the FASTLINK software. The resultant data in each family were integrated by means of Bayesian weighting formula for the likelihood estimation of a family to one or other locus (14). The genotyping of individuals includes descendent and married-in patients, where extracted and the founders of genotypes were reconstructed. The relative location of PKD1 and PKD2 satellite markers are illustrated in Figure 1. The haplotypes of them in members of ADPKD families were also shown in Figure 2.

The Relative Locations of the Microsatellite Markers of <i>PKD1</i> on Chromosome 16 and <i>PKD2</i> on Chromosome 4
Figure 1.

The Relative Locations of the Microsatellite Markers of PKD1 on Chromosome 16 and PKD2 on Chromosome 4

A Pedigree That Show the Polycystic Kidney Disease with Autosomal Dominant Inheritance.
Figure 2.

A Pedigree That Show the Polycystic Kidney Disease with Autosomal Dominant Inheritance.

3. Results

D4S423, D4S231, and 16AC2.5 show significant linkage with PKD2 and PKD1, respectively.

The heterozygosity of 18 unrelated families was analyzed. Sixteen different sizes of alleles were seen in 4 markers as presented in Tables 2 and 3. According to the findings 16AC2.5, D4S423, and D4S231 markers are suitable for linkage analysis. There were 5 alleles found for 16AC2.5 marker in our understudied population. The HET and PIC values for these markers were also determined 0.782 and 0.798, respectively. Our finding shows D4S423 and D4S231 had both, 4 alleles. Their HET values were 0.840 and 0.775 and their PIC values were 0.807 and 0.741, respectively. Based on our findings, the evaluated microsatellite markers had the acceptable range for HET and PIC values in our linkage analysis on PKD1 and PKD2 among the ADPKD patients (Table 2). The LOD scores of our linked microsatellite markers to PKD1 and PKD2 were determined. This two-point linkage analysis showed these markers were informative and located at the most flanking locus in each family. The θ values of the maximum LOD scores are also presented in Table 4.

Table 2.Number and Size of Alleles, heterozygosity of Polymorphic Markers Linked to PKD1 and PKD2 in the Iranian Population
MarkersNumber of AllelesAlleles Size, bpHETaPICb
PKD1
KG83109, 118, 1260.3400.329
16AC2.55109, 113, 122, 130, 1420.7820.798
PKD2
D4S4234103, 107, 117, 1210.8400.807
D4S2314144, 148, 153, 1570.7750.741

aHeterozygosity

bPolymorphic information content

Table 3.The Frequency of the Marker Alleles Linked to PKD1 and PKD2 in the Iranian Population
Genes and AllelesNo. (%)
PKD1
KG8
10927 (57.5)
11816 (34.1)
1264 (8.4)
16AC2.5
1092 (4.2)
1133 (6.4)
1223 (6.4)
13015 (31.9)
14224 (51.1)
PKD2
D4S231
1032 (4.2)
1072 (4.2)
11714 (29.8)
12129 (61.8)
D4S423
14423 (48.9)
14811 (23.4)
1537 (14.9)
1576 (12.8)
Table 4.Pairwise Z Values for Linkage Between ADPKD and Chromosome 4 Markers
LOD Scores
Markersθ = 0.0θ = 0.01θ = 0.03θ = 0.05θ = 0.07θ = 0.1θ = 0.15
PKD1KG80.280.280.270.260.250.230.20
16AC2.52.652.191.511.140.900.760.65
PKD2D4S4234.254.173.803.523.222.480.98
D4S2313.853.252.902.452.201.350.67

Abbreviation: LOD scores, logarithm of the odds; θ, Recombination Frequency.

3.1. KG8 Shows Insignificant Linkage with PKD1

The alleles of KG8 marker were 3 forms that the HET and PIC values for this marker were 0.340 and 0.329, respectively. These qualities for HET and PIC were in an acceptable range, however, the calculated LOD and θ values of the maximum LOD scores were not signified regarding KG8 linkage to PKD1 (Table 4).

3.2. The Linkage Analysis and Genotype of the ADPKD Families

The LOD scores and allele segregation analysis showed the linkage to PKD1 was possible approximately 77.8% in 10 families (pedigrees K1-K4, K6, K7, K10-K13, K16, and K17) and this possibility for PKD2 was 16.7% in 7 families (pedigrees K3, K8, K9, K14, K15 and K18).

LOD scores K5 family were mostly negative and linkage to neither of the 2 PKD loci could be assumed. All families with linkage to PKD1 and PKD2 or to either PKD1 or PKD2 were selected for screening the further mutation (Table 5).

Table 5.Linkage Analysis and Genotype in 18 Iranian ADPKD Families
FamiliesPKD1PKD2
ZmaxθmaxZmaxθmaxGenotypes
K10.4020.00-1.210.099PKD1
K20.4500.00-4.000.005PKD1
K3-0.9420.001.420.005PKD2
K40.3080.00-1.480.019PKD1
K5∞-0.00-1.450.015-
K60.7200.014-2.450.013PKD1
K7-0.6080.00-1.430.015PKD1
K8-0.9050.000.1120.125PKD2
K9-0.3060.003.890.006PKD2
K100.6980.00-3.000.113PKD1
K110.5670.014-2.050.007PKD1
K121.200.00-5.800.004PKD1
K130.7250.00-2.600.015PKD1
K14-0.6030.000.1150.013PKD2
K15-0.3050.003.200.019PKD2
K160.5020.014-3.000.006PKD1
K17-0.9350.00-3.150.014PKD1
K18-1.300.004.000.088PKD2

4. Discussion

The main part of PKD patients has composed of mutation carriers of PKD1 and PKD2 genes that these genes are responsible for ADPKD in approximately 85% and 15% of cases, respectively. The percentage of non-autosomal dominant PKD patients is also less than 10% among different populations (3, 4). Several studies from around the world report similar results as mentioned above; for example Mizoguchi et al. in 21 Japanese ADPKD families, including 96 individuals and 57 affected members, reported that 17 families (81%) had linkage to PKD1, 2 families (10%); PKD2 and 2 families did not have linkage to either PKD1 or PKD2 (14). Another study was performed by colleagues on 48 Korean families that the results were composed of PKD1 (79%) and PKD2 (21%) (15). Moreover, the similar rate of the genetic heterogeneity has been shown in other populations, such as Argentinians (91%) (16), Bulgarians (73%) (17), and Caucasians (81%) (18). Radpour et al. study, the closest one to our investigation, evaluated 15 Iranian families and reported that the proportion of families linked to PKD1, PKD2, or to other genes was 73%, 13%, and 13%, respectively (5).

Our allele frequencies of PKD1 and PKD2 markers (16AC2.5, KG8, D4S423 and D4S231) were not similar to earlier reports in Caucasian ethnics (8, 10, 19-21), however, our results were compliance with Radpour et. al in an Iranian population (5). For instance, among Spanish ADPKD families (48 ADPKD-affected families), it was reported that 7 alleles for D4S231 (HET: 0.71, Zmax: 4.28) as well as 9 for D4S423 (HET: 0.83, Zmax: 9.03) markers for linkage to PKD2 (8) and 8 different alleles for the KG8 marker and 10 alleles for 16AC2.5 for linkage to PKD1 (19). There is also another study on 30 Hungarian ADPKD-affected families that reported 12 alleles for D16S663 marker, while 16AC2.5, KG8, D4S1563, and D4S2462 had 10, 8, 12, and 11 alleles, respectively (21).

In summary, according to the results, D4S423 (HET: 0.84, PIC: 0.80), D4S231 (HET: 0.77, PIC: 0.74) and 16AC2.5 (HET: 0.78, PIC: 0.79) had the highest heterozygosity rates as well as PIC values and were the most informative markers for PKD1 and PKD2 loci to diagnose ADPKD while the less informative marker was KG8 (HET: 0.34, PIC: 0.32) for PKD1 locus in the population. Therefore, 1 marker linked to the PKD1 gene (16AC2.5) and the 2 markers linked to PKD2 genes (D4S423 and D4S231) were informative for screening of ADPKD patients in our population.

Acknowledgments

Footnotes

References

  • 1.
    Paul BM, Vanden Heuvel GB. Kidney: polycystic kidney disease. Wiley Interdiscip Rev Dev Biol. 2014;3(6):465-87. [PubMed ID: 25186187]. https://doi.org/10.1002/wdev.152.
  • 2.
    Bergmann C. ARPKD and early manifestations of ADPKD: the original polycystic kidney disease and phenocopies. Pediatr Nephrol. 2015;30(1):15-30. [PubMed ID: 24584572]. https://doi.org/10.1007/s00467-013-2706-2.
  • 3.
    Hafizi A, Khatami SR, Galehdari H, Shariati GR, Saberi AH, Hamid M. A Novel CAT> GAT (H 3311R) Missense Mutation in Exon 30 of the PKD1 Gene in a Patient Affected With Autosomal Dominant Polycystic Kidney. Zahedan J Res Med Sci. 2015;17(5).
  • 4.
    Hafizi A, Khatami SR, Galehdari H, Shariati G, Saberi AH, Hamid M. Exon sequencing of PKD1 gene in an Iranian patient with autosomal-dominant polycystic kidney disease. Iran Biomed J. 2014;18(3):143-50. [PubMed ID: 24842140].
  • 5.
    Radpour R, Rezaee M, Haghighi MM, Ohadi M, Najmabadi H, Hajibeigi A. Genetic Heterogeneity of PKD1 and PKD2 Genes in Iran and Determination of the Genotype/Phenotype Correlations in Several Families with Autosomal Dominant Polycystic Kidney Disease. Iran Biomed J. 2006;10(1):1-8.
  • 6.
    Binczak-Kuleta A, Rozanski J, Domanski L, Myslak M, Ciechanowski K, Ciechanowicz A. DNA microsatellite analysis in families with autosomal dominant polycystic kidney disease (ADPKD): the first Polish study. J Appl Genet. 2006;47(4):383-9. [PubMed ID: 17132904]. https://doi.org/10.1007/BF03194649.
  • 7.
    Vouk K, Gazvoda B, Komel R. Fluorescent multiplex PCR and capillary electrophoresis for analysis of PKD1 and PKD2 associated microsatellite markers. Biotechniques. 2000;29(6):1186-8. 1190. [PubMed ID: 11126118].
  • 8.
    San Millan JL, Viribay M, Peral B, Martinez I, Weissenbach J, Moreno F. Refining the localization of the PKD2 locus on chromosome 4q by linkage analysis in Spanish families with autosomal dominant polycystic kidney disease type 2. Am J Hum Genet. 1995;56(1):248-53. [PubMed ID: 7825585].
  • 9.
    Harris PC, Thomas S, Ratcliffe PJ, Breuning MH, Coto E, Lopez-Larrea C. Rapid genetic analysis of families with polycystic kidney disease 1 by means of a microsatellite marker. Lancet. 1991;338(8781):1484-7. [PubMed ID: 1683919].
  • 10.
    Thompson AD, Shen Y, Holman K, Sutherland GR, Callen DF, Richards RI. Isolation and characterisation of (AC)n microsatellite genetic markers from human chromosome 16. Genomics. 1992;13(2):402-8. [PubMed ID: 1612599].
  • 11.
    Viribay M, Ferreira R, Peral B, Bello D, Ward CJ, Davalos J, et al. Genetic analysis of Cuban autosomal dominant polycystic kidney disease kindreds using RFLPs and microsatellite polymorphisms linked to the PKD1 locus. Hum Genet. 1994;94(4):432-6. [PubMed ID: 7927343].
  • 12.
    Mills KA, Buetow KH, Xu Y, Weber JL, Altherr MR, Wasmuth JJ, et al. Genetic and physical maps of human chromosome 4 based on dinucleotide repeats. Genomics. 1992;14(2):209-19. [PubMed ID: 1427835].
  • 13.
    Zhao X, Paterson AD, Zahirieh A, He N, Wang K, Pei Y. Molecular diagnostics in autosomal dominant polycystic kidney disease: utility and limitations. Clin J Am Soc Nephrol. 2008;3(1):146-52. [PubMed ID: 18077784]. https://doi.org/10.2215/CJN.03430807.
  • 14.
    Mizoguchi M, Tamura T, Yamaki A, Higashihara E, Shimizu Y. Genotypes of autosomal dominant polycystic kidney disease in Japanese. J Hum Genet. 2002;47(1):51-4. [PubMed ID: 11829141]. https://doi.org/10.1007/s10038-002-8654-5.
  • 15.
    Lee JG, Lee KB, Kim UK, Ahn C, Hwang DY, Hwang YH, et al. Genetic heterogeneity in Korean families with autosomal-dominant polycystic kidney disease (ADPKD): the first Asian report. Clin Genet. 2001;60(2):138-44. [PubMed ID: 11553048].
  • 16.
    Iglesias DM, Martin RS, Fraga A, Virginillo M, Kornblihtt AR, Arrizurieta E, et al. Genetic heterogeneity of autosomal dominant polycystic kidney disease in Argentina. J Med Genet. 1997;34(10):827-30. [PubMed ID: 9350815].
  • 17.
    Bogdanova N, Dworniczak B, Dragova D, Todorov V, Dimitrakov D, Kalinov K, et al. Genetic heterogeneity of polycystic kidney disease in Bulgaria. Hum Genet. 1995;95(6):645-50. [PubMed ID: 7789949].
  • 18.
    Wright AF, Teague PW, Pound SE, Pignatelli PM, Macnicol AM, Carothers AD, et al. A study of genetic linkage heterogeneity in 35 adult-onset polycystic kidney disease families. Hum Genet. 1993;90(5):569-71. [PubMed ID: 8428756].
  • 19.
    Peral B, Ward CJ, San Millan JL, Thomas S, Stallings RL, Moreno F, et al. Evidence of linkage disequilibrium in the Spanish polycystic kidney disease I population. Am J Hum Genet. 1994;54(5):899-908. [PubMed ID: 7909986].
  • 20.
    Snarey A, Thomas S, Schneider MC, Pound SE, Barton N, Wright AF, et al. Linkage disequilibrium in the region of the autosomal dominant polycystic kidney disease gene (PKD1). Am J Hum Genet. 1994;55(2):365-71. [PubMed ID: 8037213].
  • 21.
    Endreffy E, Maroti Z, Bereczki C, Turi S. Usefulness of combined genetic data in Hungarian families affected by autosomal dominant polycystic kidney disease. Mol Cell Probes. 2009;23(1):39-43. [PubMed ID: 19056484]. https://doi.org/10.1016/j.mcp.2008.11.001.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles