Detection of Metallo-Beta-Lactamase-Encoding Genes Among Clinical Isolates of Pseudomonas aeruginosa in Qom Province

Author(s):
Fatemeh MeimaniFatemeh Meimani1, Razieh NazariRazieh NazariRazieh Nazari ORCID1,*, Mahmoud Nateghi RostamiMahmoud Nateghi Rostami2
1Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran
2Department of Parasitology, Pasteur Institute of Iran, Tehran, Iran
*Corresponding Author: Department of Microbiology, Qom Branch, Islamic Azad University, 15 Khordad Blvd., Postal Code: 37185364, Qom, Iran. Tel: +98-2537780001, Email: [email protected]

Zahedan Journal of Research in Medical Sciences:Vol. 20, issue 9; e59559
Published online:Nov 11, 2018
Article type:Research Article
Received:Aug 06, 2017
Accepted:Sep 23, 2018
How to Cite:Meimani F, Nazari R, Nateghi Rostami M. Detection of Metallo-Beta-Lactamase-Encoding Genes Among Clinical Isolates of Pseudomonas aeruginosa in Qom Province. Zahedan J Res Med Sci. 2018;20(9):e59559. doi: https://doi.org/10.5812/zjrms.59559

Abstract

Background:

Carbapenem-resistant Pseudomonas aeruginosa has emerged as a serious problem in many hospitals and intensive care units. The purpose of this study was to determine the antibiotic susceptibility profile and the distribution of metallo-beta-lactamase genes among P. aeruginosa isolates from Qom province of Iran.

Methods:

In this study, 200 P. aeruginosa isolates were collected from several clinical samples in hospitals affiliated to Qom University of Medical Sciences, Qom province, Iran. The antibiotic susceptibility of the isolates was tested by the Kirby-Bauer disc diffusion test and the distribution of MBL genes among carbapenem-resistant isolates was determined by polymerase chain reaction (PCR) method.

Results:

Among carbapenem non-susceptible isolates of P. aeruginosa, 38% (76 isolates) were multidrug resistant, 26% (52 isolates) were pan-drug-resistant and 5% (10 isolates) were extensive drug resistant. 52% of the isolates were resistant to carbapenems. Among carbapenem non-susceptible isolates of P. aeruginosa, 40 isolates (38.4%) exhibited MBL production. Of 40 MBL-producing isolates, 38 isolates (36.5%) contained the blaIMP gene and two (1.9%) isolates contained the blaVIM gene.

Conclusions:

Outbreaks of MBL-producing P. aeruginosa isolates will be a serious problem in hospitals in the future and rapid identification of these isolates is necessary to control further dissemination of MBL resistance genes. This is the first report of the rates of MDR, XDR, PDR, and MBL-producing P. aeruginosa isolated from hospitals affiliated to Qom University of Medical Sciences in Qom province of Iran.

1. Background

Pseudomonas aeruginosa is a Gram-negative, glucose non-fermentative bacillus that is often involved in nosocomial infection outbreaks (1). This opportunistic pathogen can cause a variety of infections including pneumonia, septicemia, meningitis, urinary tract infections, and burn wound infections (2, 3). The antibiotic therapy of nosocomial infection caused by P. aeruginosa is often complicated because the drug resistance of this organism has increased recently (4). The terms pan-drug-resistant (PDR), extensive drug resistance (XDR), and multidrug resistance (MDR) are defined as resistance to all antibiotics in all different categories of antimicrobial agents, resistance to at least one antibiotic in all except one or two antimicrobial categories, and resistance to at least one antibiotic in ≥ 3 antimicrobial categories, respectively. The antimicrobial categories contain aminoglycosides, carbapenems, cephalosporins, fluoroquinolones, penicillins, monobactams, and polymyxins (5). Carbapenems are effective agents for the treatment of important Gram-negative bacilli infections, especially P. aeruginosa (3). Among various mechanisms involved in resistance to carbapenems in P. aeruginosa, the production of metallo-beta-lactamases (MBLs) is a very important mechanism through which all carbapenems are hydrolyzed (4, 6, 7). Furthermore, the metallo-beta-lactamase genes located on integrons may elucidate their wide distribution between strains (8). At present, different groups of MBLs have been identified in P. aeruginosa but the IMP (Imipenenase) and VIM (Verona integron-encoded metallo-beta-lactamase) groups are the most widespread groups of MBLs (9-). This study was done to detect the antimicrobial susceptibility profile and the rate of MDR, XDR, and PDR among P. aeruginosa isolated from multiple hospitals of Qom province and to determine the distribution of MBL genes among carbapenem non-susceptible isolates.

2. Methods

2.1. Bacterial Isolation and Identification

In a study that was done between November 2013 and October 2014, 200 non-duplicated P. aeruginosa isolates were collected from different specimens at Shahid Beheshti, Nekoei, Kamkar, and Valiasr Hospitals (affiliated to Qom University of Medical Sciences, Iran). The clinical specimens included tracheal aspirate, urine, burn wound, blood, surgical wound, and stool. The samples were immediately inoculated in MacConkey agars. The identification of the isolates was carried out using standard microbiological and biochemical methods including Gram-staining, colony morphology, glucose oxidation, citrate utilization, oxidase test, and pigment production (13).

2.2. Antibiotic Susceptibility Testing

Antibiotic susceptibility profile of isolates was tested by standard disc diffusion method according to the Clinical Laboratory Standard Institute (CLSI) guidelines (14). The antibiotic discs contained ceftriaxone (30 µg), ceftazidime (30 µg), ceftizoxime (30 µg), cefotaxime (30 µg), gentamicin (10 µg), Amikacin (30 µg), ciprofloxacin (5 µg), piperacillin (100 µg), piperacillin-tazobactam (100/10 µg), imipenem (10 µg), meropenem (10 µg), Aztreonam (30 µg), colistin (10 µg), and polymyxin B (300 units) (MAST, United Kingdom). Escherichia coli ATCC 25922 and P. aeruginosa ATCC 27853 were used as control strains in the tests. The isolates that were intermediate-resistant to antibiotics were considered as resistance. The minimum inhibitory concentrations (MIC) of all imipenem non-susceptible isolates for imipenem was obtained by microbroth dilution method according to the recommendations of the standard protocol of CLSI (14).

2.3. Detection of MBL Producing Isolates and MBL Genes

The detection of MBL production in carbapenem-resistant isolates of P. aeruginosa was carried out by double disk synergy test (DDST) (15). DNA of carbapenem resistant isolates was extracted by boiling method (15). The detection of blaIMP and blaVIM genes in P. aeruginosa isolates was achieved by PCR with specific primers (Table 1) (16). The amplification steps were as follows: Initial denaturation for 3 minutes at 94ºC; 35 cycles with denaturation for 1 minute at 94ºC, annealing for 1 minute at 53ºC, extension for 1 minute at 72ºC, and final extension for 7 minutes at 72ºC. Gel electrophoresis was performed in 1.2% agarose gel at 85 V. P. aeruginosa ATCC 27853 was used as the negative control strain and P. aeruginosa harboring blaIMP and blaVIM genes (obtained from Dr. Hashemi, Iran) were used as the positive control.
Table 1.The Sequence of Primers Used for Detection of MBL-Encoding Genes
PrimersSequence (5'- 3')Product Size, bp
IMP- FACCGCAGCAGAGTCTTTGCC587
IMP- RACAACCAGTTTTGCCTTACC
VIM - FATGTTCAAACTTTTGAGTAAG801
VIM- RCTACTCAACGACTGAGCG

2.4. Statistical Analysis

Differences in variables were analyzed using Chi-Square test and P-values of less than 0.05 were considered statistically significant. All the available data were analyzed by a computer program (SPSS).

3. Results

In total, 200 P. aeruginosa isolates were collected from tracheal aspirate (78 isolates, 39%), urine (52 isolates, 26%), burn wound (42 isolates, 21%), blood (13 isolates, 6.5%), surgical wound (12 isolates, 6%), and stool (three isolates, 1.5%). 73 patients (73%) were male and 26 (27%) were female. The age range of the patients was 20 - 86 years. P. aeruginosa isolates were recovered from several hospital settings as follows: intensive care unit (ICU) (39%), burn unit (21%), trauma and emergency wards (16.5%), general surgery wards (14%), and internal wards (9.5%). Among the P. aeruginosa isolates, 76 isolates (38%) were multidrug-resistant (MDR), 52 isolates (26%) were pan-drug-resistant (PDR), and 10 isolates (5%) were extensive drug resistant (XDR) (Table 2). On the other hand, among the 200 P. aeruginosa isolates, 104 isolates (52%) were resistant to imipenem and meropenem. The majority of isolates (94.4%) showed MIC ≥ 32 mg/L for imipenem. The results of the DDST method showed that among 104 carbapenem non-susceptible isolates of P. aeruginosa, 40 isolates (38.4%) produced metallo-beta-lactamases. The P. aeruginosa isolates producing metallo-beta-lactamases were mainly obtained from tracheal aspirate (63%), burn wound (28%), and urine (9%). Of the 104 carbapenem non-susceptible isolates, 38 (36.5%) isolates carried the blaIMP gene and two (1.9%) isolates carried the blaVIM gene (Figure 1). Of the 40 MBL-producing isolates, 21 isolates (52.5%) were PDR and 19 (47.5%) isolates were MDR. The Pearson Chi-Square analysis showed that the rates of resistance to imipenem, meropenem, ceftazidime, cefotaxime, gentamicin, amikacin, ciprofloxacin, and piperacillin-tazobactam were significantly higher in isolates with blaIMP gene than in isolates without the gene (P-values ≤ 0.001). The rates of resistance to piperacillin and colistin were statistically higher in isolates with blaIMP gene than in isolates without the gen (P-values ≤ 0.05). The rates of resistance to tested antibiotics were not significantly different between isolates in which blaVIM gene was detected and isolates in which it was not detected.
Table 2.Antimicrobial Susceptibility Patterns of Pseudomonas aeruginosa Isolated from Four University Hospitals in Qom, Iran
Antimicrobial AgentSusceptible, %Intermediate, %Resistant, %
Ceftizoxim71182
Cefotaxim72865
Imipenem48745
Meropenem481042
Ceftazidime41950
Ceftriaxone222850
Ciprofloxacin411346
Gentamicin371746
Aztreonam342343
Piperacillin59635
Piperacillin-tazobactam492328
Amikacin63928
Polymyxin B97-3
Colistin88-12
PCR amplification of IMP-type and VIM-type MBLs of <i>P. aeruginosa</i> isolates. Lane 1: DNA size marker; Lane 2: bla<sub>VIM</sub> positive isolate; Lane 3: bla<sub>IMP</sub> positive isolate
Figure 1.

PCR amplification of IMP-type and VIM-type MBLs of P. aeruginosa isolates. Lane 1: DNA size marker; Lane 2: blaVIM positive isolate; Lane 3: blaIMP positive isolate

4. Discussion

P. aeruginosa is one of the most important Gram-negative opportunistic pathogens, which is recognized as an agent of nosocomial infections. Our study showed that 39% of the P. aeruginosa isolates were collected from patients in ICUs, indicating that invasive devices play an important role in P. aeruginosa infections (17-20). The rate of resistance to carbapenems in P. aeruginosa isolates in this study was 52%, which is higher than the rates of resistant to carbapenems (32% and 12.4% among P. aeruginosa isolates) in previous studies reported from Iran (21, 22). These results indicate that carbapenem-resistant P. aeruginosa has increased recently (17, 23). In the present study, the distribution of MDR, PDR, and XDR was found to be 38%, 26%, and 5%, and this finding is the first report of the distribution of PDR and XDR isolates in P. aeruginosa from Iran. In the present study, higher rates of resistance to third-generation cephalosporins including ceftizoxime (93%), cefotaxime (93%), ceftazidime (59%), and ceftriaxone (78%) were observed, implying that third-generation cephalosporins are no longer secure to treat P. aeruginosa in our hospitals. Therefore, finding an appropriate therapy for infections caused by multidrug-resistant P. aeruginosa is a newly difficult situation. Our results were consistent with the observations in previous studies from Iran indicating that the majority of P. aeruginosa isolates showed MIC ≥ 32 mg/L for imipenem (21). In our study, we tested MBLs production by using the DDST method and demonstrated that 38.4% (n = 40) of the carbapenem non-susceptible P. aeruginosa isolates were MBL positive. This result is consistent with those of previous reports from Iran and Brazil (21, 24, 25). In the present study, 61.6% of the carbapenem non-susceptible P. aeruginosa were MBL negative, which suggests that other factors such as deficiency in porin or reduced expression of outer membranes proteins might be associated with carbapenem resistance. In the present study, the distribution of IMP-type MBLs among carbapenem-resistant isolates of P. aeruginosa was 36.5%. Other studies demonstrated that 5.77% of P. aeruginosa isolates from the northwest of Iran (2010) (21) and 24% from the center of Iran (2013) (26) were IMP-type positive. These results indicate that the distribution of IMP-type MBLs among the isolates of P. aeruginosa in Iran in recent years has increased significantly. In our study, 1.9% of the imipenem non-susceptible isolates of P. aeruginosa carried VIM-type MBLs. Bagheri Bejestani et al. reported that blaVIM gene was not detected among the studied isolates in the center of Iran (27). However, several previous reports revealed that the genes of blaIMP and blaVIM-type MBL are often encoded on mobile genetic cassettes, which can easily spread among isolates.

4.1. Conclusions

This study showed that susceptibility to carbapenems among isolates of P. aeruginosa reduced in Iran and the IMP-type MBLs were the most prevalent MBLs among imipenem non-susceptible P. aeruginosa isolates in this area. MBL-producing P. aeruginosa in recent years has become a serious problem. The rapid identification of MBL-producing isolates is very important and the use of specific methods is necessary to control the further transmission of infection by these organisms.

Acknowledgments

References

  • 1.
    Rodrigues AC, Chang MR, Nobrega GD, Rodrigues MS, Carvalho NC, Gomes BG, et al. Metallo-beta-lactamase and genetic diversity of Pseudomonas aeruginosa in intensive care units in Campo Grande, MS, Brazil. Braz J Infect Dis. 2011;15(3):195-9. [PubMed ID: 21670916]. https://doi.org/10.1016/S1413-8670(11)70174-X.
  • 2.
    Church D, Elsayed S, Reid O, Winston B, Lindsay R. Burn wound infections. Clin Microbiol Rev. 2006;19(2):403-34. [PubMed ID: 16614255]. [PubMed Central ID: PMC1471990]. https://doi.org/10.1128/CMR.19.2.403-434.2006.
  • 3.
    Livermore DM. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: Our worst nightmare? Clin Infect Dis. 2002;34(5):634-40. [PubMed ID: 11823954]. https://doi.org/10.1086/338782.
  • 4.
    Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect. 2002;8(6):321-31. [PubMed ID: 12084099]. https://doi.org/10.1046/j.1469-0691.2002.00401.x.
  • 5.
    Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-81. [PubMed ID: 21793988]. https://doi.org/10.1111/j.1469-0691.2011.03570.x.
  • 6.
    Kohler T, Michea-Hamzehpour M, Epp SF, Pechere JC. Carbapenem activities against Pseudomonas aeruginosa: Respective contributions of OprD and efflux systems. Antimicrob Agents Chemother. 1999;43(2):424-7. [PubMed ID: 9925552]. [PubMed Central ID: PMC89097]. https://doi.org/10.1128/AAC.43.2.424.
  • 7.
    Livermore DM. Interplay of impermeability and chromosomal beta-lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1992;36(9):2046-8. [PubMed ID: 1329641]. [PubMed Central ID: PMC192435]. https://doi.org/10.1128/AAC.36.9.2046.
  • 8.
    Lee K, Ha GY, Shin BM, Kim JJ, Kang JO, Jang SJ, et al. Metallo-beta-lactamase-producing gram-negative bacilli in Korean nationwide surveillance of antimicrobial resistance group hospitals in 2003: Continued prevalence of VIM-producing Pseudomonas spp. and increase of IMP-producing Acinetobacter spp. Diagn Microbiol Infect Dis. 2004;50(1):51-8. [PubMed ID: 15380278]. https://doi.org/10.1016/j.diagmicrobio.2004.05.002.
  • 9.
    Valenza G, Joseph B, Elias J, Claus H, Oesterlein A, Engelhardt K, et al. First survey of metallo-beta-lactamases in clinical isolates of Pseudomonas aeruginosa in a German university hospital. Antimicrob Agents Chemother. 2010;54(8):3493-7. [PubMed ID: 20498315]. [PubMed Central ID: PMC2916321]. https://doi.org/10.1128/AAC.00080-10.
  • 10.
    Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046-54. [PubMed ID: 19770275]. [PubMed Central ID: PMC2786356]. https://doi.org/10.1128/AAC.00774-09.
  • 11.
    Cornaglia G, Giamarellou H, Rossolini GM. Metallo-beta-lactamases: A last frontier for beta-lactams? Lancet Infect Dis. 2011;11(5):381-93. [PubMed ID: 21530894]. https://doi.org/10.1016/S1473-3099(11)70056-1.
  • 12.
    Kouda S, Ohara M, Onodera M, Fujiue Y, Sasaki M, Kohara T, et al. Increased prevalence and clonal dissemination of multidrug-resistant Pseudomonas aeruginosa with the blaIMP-1 gene cassette in Hiroshima. J Antimicrob Chemother. 2009;64(1):46-51. [PubMed ID: 19398456]. https://doi.org/10.1093/jac/dkp142.
  • 13.
    Hall GS. Nonfermenting and miscellaneous gram-negative bacilli. In: Mahon CR, Lehman DC, Manuselis G, editors. Textbook of diagnostic microbiology. 3th ed. Ohio: Saunders-Elsevier; 2007. p. 564-84.
  • 14.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility tests, Approved standard-Eleventh edition (M02-A11). Clinical and Laboratory Standards Institute (CLSI); 2012.
  • 15.
    Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-beta-lactamases in a large centralized laboratory. J Clin Microbiol. 2005;43(7):3129-35. [PubMed ID: 16000424]. [PubMed Central ID: PMC1169086]. https://doi.org/10.1128/JCM.43.7.3129-3135.2005.
  • 16.
    Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. PCR typing of genetic determinants for metallo-beta-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol. 2003;41(12):5407-13. [PubMed ID: 14662918]. [PubMed Central ID: PMC309014]. https://doi.org/10.1128/JCM.41.12.5407-5413.2003.
  • 17.
    Dong F, Xu XW, Song WQ, Lu P, Yu SJ, Yang YH, et al. Characterization of multidrug-resistant and metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from a paediatric clinic in China. Chin Med J (Engl). 2008;121(17):1611-6. [PubMed ID: 19024085].
  • 18.
    Hadadi A, Rasoulinejad M, Maleki Z, Yonesian M, Shirani A, Kourorian Z. Antimicrobial resistance pattern of Gram-negative bacilli of nosocomial origin at 2 university hospitals in Iran. Diagn Microbiol Infect Dis. 2008;60(3):301-5. [PubMed ID: 18036759]. https://doi.org/10.1016/j.diagmicrobio.2007.10.010.
  • 19.
    Farajzadeh T, Goudarzi H, Hashemi A, Fallah F, Doustdar F, Bostan H. [Detection of bla NDM, bla DIM, bla IMP, bla VIM and bla CTX-M-15 betalactamase genes among Pseudomonas aeruginosa and Acinetobacter baumannii strains isolated from two hospitals of Tehran, Iran]. Novelty Biomed. 2016;4:153-8. Persian.
  • 20.
    Cao B, Wang H, Sun H, Zhu Y, Chen M. Risk factors and clinical outcomes of nosocomial multi-drug resistant Pseudomonas aeruginosa infections. J Hosp Infect. 2004;57(2):112-8. [PubMed ID: 15183240]. https://doi.org/10.1016/j.jhin.2004.03.021.
  • 21.
    Yousefi S, Farajnia S, Nahaei MR, Akhi MT, Ghotaslou R, Soroush MH, et al. Detection of metallo-beta-lactamase-encoding genes among clinical isolates of Pseudomonas aeruginosa in northwest of Iran. Diagn Microbiol Infect Dis. 2010;68(3):322-5. [PubMed ID: 20846807]. https://doi.org/10.1016/j.diagmicrobio.2010.06.018.
  • 22.
    Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol. 2010;33(3):243-8. [PubMed ID: 20954442].
  • 23.
    Franco MR, Caiaffa-Filho HH, Burattini MN, Rossi F. Metallo-beta-lactamases among imipenem-resistant Pseudomonas aeruginosa in a Brazilian university hospital. Clinics (Sao Paulo). 2010;65(9):825-9. [PubMed ID: 21049207]. [PubMed Central ID: PMC2954731]. https://doi.org/10.1590/S1807-59322010000900002.
  • 24.
    Yan JJ, Wu JJ, Tsai SH, Chuang CL. Comparison of the double-disk, combined disk, and Etest methods for detecting metallo-beta-lactamases in gram-negative bacilli. Diagn Microbiol Infect Dis. 2004;49(1):5-11. [PubMed ID: 15135493]. https://doi.org/10.1016/j.diagmicrobio.2004.01.002.
  • 25.
    Sader HS, Reis AO, Silbert S, Gales AC. IMPs, VIMs and SPMs: The diversity of metallo-beta-lactamases produced by carbapenem-resistant Pseudomonas aeruginosa in a Brazilian hospital. Clin Microbiol Infect. 2005;11(1):73-6. [PubMed ID: 15649310]. https://doi.org/10.1111/j.1469-0691.2004.01031.x.
  • 26.
    Doosti M, Ramazani A, Garshasbi M. Identification and characterization of metallo-beta-lactamases producing Pseudomonas aeruginosa clinical isolates in University Hospital from Zanjan Province, Iran. Iran Biomed J. 2013;17(3):129-33. [PubMed ID: 23748890]. [PubMed Central ID: PMC3770254].
  • 27.
    Bagheri Bejestani F, Hakemi-Vala M, Momtaheni R, Bagheri Bejestani O, Gholami M. The frequency of imp and vim genes among Pseudomonas aeruginosa isolates from children’s medical center of Tehran. Archives of Clinical Infectious Diseases. 2015;10(1). https://doi.org/10.5812/archcid.20991.

Copyright

Copyright © 2018, Zahedan Journal of Research in Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

1
Sep
2013

Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran

Mahnaz Sarhangi,
Mohammad Motamedifar,
Jamal Sarvari

Sarhangi M, Motamedifar M, Sarvari J. Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran. Jundishapur J Microbiol. 2013;6(7):e6920. doi: https://doi.org/10.5812/jjm.6920

22
Sep
2015

Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran

Ramin Abiri,
Pantea Mohammadi,
Navid Shavani,
Mansour Rezaei

Abiri R, Mohammadi P, Shavani N, Rezaei M. Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran. Jundishapur J Microbiol. 2015;8(9):e22582. doi: https://doi.org/10.5812/jjm.22582

13
Sep
2021
Jundishapur J Microbiol

Molecular Detection of Carbapenemases and Extended-Spectrum β-Lactamases-Encoding Genes in Clinical Isolates of Pseudomonas aeruginosa in Iran

Esmaeil Rahimi,
Ali Asgari,
Taher Azimi,
Saeed Soleiman-Meigooni

Rahimi E, Asgari A, Azimi T, Soleiman-Meigooni S. Molecular Detection of Carbapenemases and Extended-Spectrum β-Lactamases-Encoding Genes in Clinical Isolates of Pseudomonas aeruginosa in Iran. Jundishapur J Microbiol. 2021;14(7):e115977. doi: https://doi.org/10.5812/jjm.115977

18
Apr
2015

Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran

Mehdi Ghamgosha,
Shahram Shahrekizahedani,
Farshid Kafilzadeh,
Zakaria Bameri,
Ramezan Ali Taheri,
Gholamreza Farnoosh

Ghamgosha M, Shahrekizahedani S, Kafilzadeh F, Bameri Z, Taheri RA, et al. Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran. Jundishapur J Microbiol. 2015;8(4):e17489. doi: https://doi.org/10.5812/jjm.8(4)2015.17489

20
Jun
2023
Arch Clin Infect Dis

Evaluation of β-lactamases and Molecular Typing of Pseudomonas aeruginosa Clinical Strains Isolated from Hospitalized Children in Tehran, Iran

Hossein Goudarzi,
Narjess Bostanghadiri,
Zahra Riahi Rad,
Zohreh Riahi Rad,
Javad Yasbolaghi Sharahi

Goudarzi H, Bostanghadiri N, Riahi Rad Z, Riahi Rad Z, Yasbolaghi Sharahi J. Evaluation of β-lactamases and Molecular Typing of Pseudomonas aeruginosa Clinical Strains Isolated from Hospitalized Children in Tehran, Iran. Arch Clin Infect Dis. 2023;18(2):e134837. doi: https://doi.org/10.5812/archcid-134837

Download PDF183.63 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles