APOE and CPT1-A Promoter Methylation and Expression Profiles in Patients with Schizophrenia

Author(s):
Dor Mohammad Kordi-TamandaniDor Mohammad Kordi-TamandaniDor Mohammad Kordi-Tamandani ORCID1, 2,*, Maryam NajafiMaryam Najafi1, Azizall MojahadAzizall Mojahad3
1Department of Biology, University of Sistan and Baluchestan, Zahedan, IR Iran
2Genetic of Non-Communicable Diseases Research Ccenter, Zahedan University of Medical Sciences, Zahedan, IR Iran
3Department of Clinical Psychology, Zahedan University of Medical Science, Zahedan, IR Iran
*Corresponding Author: Corresponding author: Dor Mohammad Kordi-Tamandani, Department of Biology, University of Sistan and Baluchestan, P.O. Box: 98155-411, Zahedan, IR Iran. Tel: +98-5412452335, Fax: +98-5412446565, E-mail: Email: [email protected]

Gene, Cell and Tissue:Vol. 1, issue 1; e18359
Published online:Mar 12, 2014
Article type:Research Article
Received:Nov 18, 2013
Accepted:Feb 19, 2014
How to Cite:Kordi-Tamandani DM, Najafi M, Mojahad A. APOE and CPT1-A Promoter Methylation and Expression Profiles in Patients with Schizophrenia. Gene Cell Tissue. 2014;1(1):e18359. doi: https://doi.org/10.17795/gct-18359

Abstract

Background:

Apo-lipoprotein E (APOE) and Carnitine palmitoyltransferase1-A (CPT1-A) genes are well known to be involved in the pathophysiology of psychiatric disorders such as schizophrenia but regarding their CPG island methylation status data is sparse.

Objectives:

The aims of the current study were to highlight the effect of the promoter “hypermethylation” in the development of SCZ.

Patients and Methods:

Genomic DNA was extracted from peripheral blood of 80 patients with schizophrenia and 71 healthy controls. The Methylation pattern was studied using Methylation-Specific PCR. RNA expression analysis was performed on extracted RNA from blood samples of patients suffering from schizophrenia (n = 17) and healthy controls (n = 17).

Results:

Frequency of the APOE and CPT1-A methylation show insignificant relationship between cases and controls. Estimates of relative gene expression revealed no significant statistical association of the APOE and CPT1-A genes between schizophrenic patients and healthy controls.

Conclusions:

This is the first evidence regarding APOE and CPT1-A gene methylation and their expression profile related to risk of schizophrenia which indicate no significant association between the APOE and CPT1-A gene methylation and development of schizophrenia.

1. Background

Schizophrenia (SCZ) is a disorder with a prevalence rate of 1.1% in the population over the age of 18. Men tend to develop SZC symptoms earlier than women but frequency of occurrence in both sexes is the same (1, 2). Combined genetic predisposition and environmental exposure play a significant role in outbreak of this disorder (3). Genome and environmental interaction may provoke occurrence of neurobehavioral disease through DNA methylation in the regulatory region at the promoter sites (CPG islands) (4). Apolipoprotein E (APOE) is a Polymorphic Plasma Protein with three common isoforms E2, E3, and E4 of the APOE gene, which is situated on chromosome 19q13.21. There is a functional difference between 5' and 3' CpG islands of APOE, because APOE CpG island is methylated in all tissues except sperm but this gene is expressed in many tissues in terms of location of CPG island within the last exon of the gene (5). APOE protein as a lipid transporter is the main regulator of blood lipid in humans and plays an important pleiotropic function in the development of the central nervous system and synaptic plasticity (6). It is also involved in various pathways that are unrelated to lipid transport including suppression of T cell proliferation, regulation of macrophage function, facilitating of lipid antigen presentation by CD1 molecules to natural killer cells, and modulation of inflammation and oxidation (7, 8). Therefore APOE could be one of the candidate genes for long term impaired inflammatory reactions in schizophrenia patients.
Saiz PA et al. (2002) results showed that variation in the APOE gene expression indicate insignificant relationship with the development of schizophrenia in a Spanish population (9). By comparison, allelic variations of APOE gene seem to be momentous in pathogenesis of schizophrenic disorders in the Korean population (10). Schurhoff F et al. (2003) observed a possible association between male schizophrenic patients and the APOE epsilon 2, epsilon 3 genotype in the French population (11).
Carnitine palmitoyltransferase in mammals shows three isoforms; a liver isoform CPT1-A, a heart/skeletal muscle isoform CPT1-B and CPT1-C which exists in the endoplasmic reticulum of hippocampus neurons. These are the products of three different genes which are located at 11q13 (CT1-A), 22q13.3 (CPT1-B) and 19q13 (CPT1-C) chromosomes (12, 13), respectively. The CPT1-A gene provides instructions for making a mitochondrial enzyme called carnitine palmitoyltransferase 1A, which is found in tissues involved in glucose sensing, such as liver, pancreatic β-cells and hypothalamic neurons (14). Carnitine palmitoyltransferase (Cpt) mediates fatty acid translocation in β-oxidation process across the mitochondrial membrane which impairs it in its task and has simultaneous effects on fatty acid and glucose metabolism that can lead to a number of features of the chronic SCZ, such as hypoglycemia or hypoketosis which cause brain damage due to reduced energy production (15-17). Additionally, increased β-oxidation and decreased fatty acid/lipid synthesis may be associated with down regulation of myelination-and oligodendrocyte-related genes in SCZ (18).

2. Objectives

The goal of the present study was to investigate the effects of the promoter “hypermethylation” of APOE and CPT1-A and their expression profiles in the development of SCZ.

3. Patients and Methods

3.1. Study Subjects

This case–control study was conducted on 80 newly diagnosed and untreated SCZ individuals with mean age of 47.53 ± 10.801 and average onset age of 8.729 ± 20.79, who were admitted to Azadi and Emam Hussein Hospitals during 2010 and 2011 in Tehran, Iran. The Ethics Committees of Azadi and Emam Hossein Hospitals approved this study. The Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV) (American Psychiatric Association 1994) rules were applied while diagnosing the patients. Medical and paramedical staff volunteers were used as the healthy group (n = 71, mean age 46.70 ± 11.716) who were free of any signs of neuropsychiatric disorders. Both patients and control groups were free from diabetes, dyslipidemia and cardiovascular disease. Consent forms were collected from all participants once the research had been thoroughly expressed. Demoghraphic characterization of the population is shown in Table 1.
Table 1. The Socio-Demographic Characteristics of the Case and Control Groups a,b
VariablesCasesControlsP Valuec
Age, y, mean ± SD47.53 ± 10.80146.70 ± 11.716˃ 0.05
Age of onset20.79 ± 8.729--
Gender
Female2629
Male6770˃ 0.05
Smoking status
Non-smokers-54-
Smokers9345˂ 0.001
Educational level
Illiteracy3--
Primary81-
School
Guidance165-
High school5328˂ 0.001
AD226-
BA828-
MA211-
Marital status
Single6029-
Married1764˂ 0.001
Divorced166-

a Abbreviations: AD, associate diploma; BA, bachelor of arts; MA, master of arts

b Data are presented as No., otherwise indicated in the table.

c P values for Chi-square test.

3.2. DNA Isolation, DNA Modification, and Methylation-Specific PCR (MSP)

Two mL of blood was drawn from each participant for DNA extraction and further analysis (19). DNA bisulfate modification was prepared as earlier published (20, 21). Online software MatPrime was used to design methylated and unmethylated primers from the preferred sequences of APOE and CPT1-A promoters as shown in Table 2. Reaction for Methylation-specific PCR (MSP) was prepared in a total volume of 25 mL of liquid, including 16.0 mL double distilled water, Star Taq 5 U/mL,1 mL of dNTPs mix (10 mmol/L), 2 mL of Mg (25 mmol/L), and 0.5 mL of each primer (10mmol/L). MSP reactions for APOE gene were subjected to an initial incubation at 95ºC for 5 minutes, followed by 40 cycles of denaturation at 95˚C for 40 seconds, annealing at 58˚C for methyl primer and 59˚C for unmethyl primer for 30 seconds and extension at 72˚C for 30 seconds. Final extension was completed by incubation at 72˚C for 10 minutes. MSP reactions for CPT1-A gene were subjected to an initial incubation at 95ºC for 5 minutes, followed by 40 cycles of denaturation at 95˚C for 40 seconds, annealing at 58˚C for methyl primer and 62˚C unmethyl primer for 30 seconds and extension at 72˚C for 30 seconds. Final extension was completed by incubation at 72˚C for 10 minutes.
Table 2. Primer Sequences and Annealing Temperatures
GenesSequences (5´-3´)Annealing Temperature (˚C)Product Size
Cpt-1A M F:TAGGAGGTATATCGACGGTTAAC--
R:AAACAAATCTCTACTAAAAAACGAA58184
Cpt-1A UF:TAGGAGGTATATTGATGGTTAATGT62184
R:AAACAAATCTCTACTAAAAAACAAA--
APOE MF:GTTGGGGTTAGTTGATGTTTATTAC58203
R:AAAAAAACTAAACTCCTAATTCGAA--
APOE UF:GGTTGGGGTTAGTTGATGTTTATTAT59204
R:AAAAAAACTAAACTCCTAATTCAAA--

3.3. RNA Isolation and Real Time PCR

RNA isolation from fresh EDTA blood was conducted as earlier described (22). Revert Aid First-Strand cDNA Synthesis Kit (Fermentas, Cat. No. K1621) was used for reverse transcription of 1 mg RNA, according to manufacturer's instructions, in a final volume of 20 mL. AB15700 sequence detection system (Applied Biosystem) was utilized to analyze real time quantitative PCR of targeted cDNA. Amplification of each sample was performed in triplicate in a 25 µL reaction mixture containing 1 µL of CDNA, 10 µL of 2x_Sybergreen, 1 µL of each specific primer, and 8 µL of RNase free water. Primers which were used for expression analysis are indicated in Table 3.
Table 3. Primers Used for Expression Analysis
GenesSequencesAnnealing Temperature
RNA 18s (Real Time- PCR)60°C
F: GTAACCCGTTGAACCCCATT
R: CCATCCAATCGGTAGTAGCG
APOE (Real Time- PCR)60°C
F: AGAGTTGGATGTGACCCTGCA
R: TCAGCTAAGGAGATGTGAGGACC
Cpt-1A (Real Time- PCR)60°C
F: TCACCCTGTACCAGTCCAATACC
R: CTGCCTCCTGCTGGTCCTT T

3.4. Statistical Analysis

Binary Logistic Regression Model was used for assessment of odds ratio (OR) and 95 % confidence intervals (95 % CI) of methylation status between cases and controls, while the Mann–Whitney test was used to analyze the expression level between cases and controls.

4. Results

As shown in Table 2 methylation frequency for the APOE gene was 57 (71.25 %) for cases and 57 (80.28%) for controls. It was highlighted as a statistically insignificant difference between cases and controls regarding comparison of methylated pattern to unmethylate as reference. Analysis of the CPT1-A gene showed insignificant results in cases (43.75%: n = 35) compared to controls (40.84%: n = 29) concerning the status of promoter methylation(Table 4). Promoter methylation photographs are shown in Figure 1 and Figure 2. Gene expression profile of the cases and controls were not significant for the APOE and CPT1-A genes. As shown in Table 5, analysis of relative gene expression for APO E was (mean ± SD = 0.9252 ± 0.41611; Range = 0.35-1.75) and CPT1A was (mean ± SD = 0.4209 ± 0.37185; Range = 0.12-1.54) which was not significant.
Table 4. Promoter Methylation Frequency of APOE and CPT Genes in Cases With Schizophrenia and Healthy Controls
GenesMethylation StatusControls, No. (%) (n = 71)Cases, No. (%) (n = 80)P Value
APOE0.198
Present57 (80.28)57 (71.25)
Absent14 (19.72)23 (28.75)
CPT1A0.718
Present29 (40.84)35 (43.75)
Absent42 (59.15)45 (56.25)
Lane U: Amplified product with primers recognizing unmethylated sequence; Lane M: Amplified product with primers recognizing methylated sequence. L: Ladder.
Figure 1.

Lane U: Amplified product with primers recognizing unmethylated sequence; Lane M: Amplified product with primers recognizing methylated sequence. L: Ladder.

Lane U: Amplified product with primers recognizing unmethylated sequence; Lane M: Amplified product with primers recognizing methylated sequence. L: Ladder
Figure 2.

Lane U: Amplified product with primers recognizing unmethylated sequence; Lane M: Amplified product with primers recognizing methylated sequence. L: Ladder

Table 5. Comparison of Relative Gene Expression for APOE and CPT among Cases With Schizophrenia and Healthy Controls
GenesPatients, No.mean ± SDRangeP Value
APOE0.174
Cases170.9252 ± 0.416110.35 - 1.75
Controls171.1050 ± 0.323280.61 - 1.73
Cpt-1A0.986
Cases170.4209 ± 0.371850.12 - 1.54
Controls170.4426 ± 0.339790.07 - 1.21

5. Discussion

Our results indicated that the promoter methylation variation of the APOE and Cpt1-A genes have no effect on the progress of SCZ and provide some initial evidence for APOE and CPT1-A genes in patients with SCZ. One of the main physiological processes influenced by different alleles of APOE is the sequestration of NMDA (N-methyl-D-aspartate) and AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionicacid) receptors in intracellular compartments, which could lead to changes in long-term potentiation (LTP) induction and neuronal degeneration. Therefore, this protein possibly plays a considerable role in synaptic plasticity by impairing the glutamatergic neurotransmission pathway (23, 24). Hasan et al. (2011) indicated that disturbed neuronal plasticity is considered to be part of the pathophysiology of schizophrenia and has been linked to the different clinical features of this severe illness (25). Concerning the role of APOE isoforms in the pathogenesis of schizophrenic disorders periodic controversial data has been published so far, certain of them highlight the significant role of APOE in development of SCZ (26, 27). Other studies indicated that the APOE gene is not of major importance in progress of SCZ (28-31). Daniel Martins-De-Souza et al. (2010) has found that expression analysis of apolipoprotein E in cerebro-spinal fluid may be a potential diagnostic tool for schizophrenia. In line with our study, Shinkai et al. (1998) have concluded that variation in the regulatory region of the APOE gene is not a risk factor for susceptibility to schizophrenia (32).The abnormal CpG island methylation of CPT1A took place during the differentiation of human embryonic stem cells (hESC) (33). Burke et al. (2006) have reported that environmental factors may contribute to the endophenotype of schizophrenia through the activation of specific genes such as CPT1. Prabakarans et al. (2004) showed that the transcriptional level of CPT1 significantly increases in brain of individuals with the SCZ disorder (18). The present study is the first evidence to highlight the position of promoter methylation of the APOE and CPT1 genes as a key regulator in CNS. Our outcomes may open a new window for studying the pathogenesis of schizophrenia, suggesting more studies with larger sample sizes in varied populations to validate this data.

Acknowledgments

Footnotes

  • Implication for health policy/practice/research/medical education:This study has been developed to highlight the epigenetic variations in related to risk of schizophrenia.

  • Authors’ Contribution:DMKT contributed to design the setup and MN and AM preparing the manuscript.

  • Financial Disclosure:There is no financial disclosure in this manuscript

  • Funding/Support:University of Sistan and Baluchestan financially supported this project through grants to DMKT.

References

  • 1.
    Schultz SH, North SW, Shields CG. Schizophrenia: a review. Am Fam Physician. 2007;75(12):1821-9. [PubMed ID: 17619525].
  • 2.
    Mortensen PB, Pedersen CB, Westergaard T, Wohlfahrt J, Ewald H, Mors O, et al. Effects of family history and place and season of birth on the risk of schizophrenia. N Engl J Med. 1999;340(8):603-8. [PubMed ID: 10029644]. https://doi.org/10.1056/NEJM199902253400803.
  • 3.
    Kofink D, Boks MP, Timmers HT, Kas MJ. Epigenetic dynamics in psychiatric disorders: environmental programming of neurodevelopmental processes. Neurosci Biobehav Rev. 2013;37(5):831-45. [PubMed ID: 23567520]. https://doi.org/10.1016/j.neubiorev.2013.03.020.
  • 4.
    Iraola-Guzman S, Estivill X, Rabionet R. DNA methylation in neurodegenerative disorders: a missing link between genome and environment? Clin Genet. 2011;80(1):1-4. [PubMed ID: 21542837]. https://doi.org/10.1111/j.1399-0004.2011.01673.x.
  • 5.
    Larsen F, Solheim J, Prydz H. A methylated CpG island 3' in the apolipoprotein-E gene does not repress its transcription. Hum Mol Genet. 1993;2(6):775-80. [PubMed ID: 8102571].
  • 6.
    Chen Y, Durakoglugil MS, Xian X, Herz J. ApoE4 reduces glutamate receptor function and synaptic plasticity by selectively impairing ApoE receptor recycling. Proc Natl Acad Sci U S A. 2010;107(26):12011-6. [PubMed ID: 20547867]. https://doi.org/10.1073/pnas.0914984107.
  • 7.
    Zhang H, Wu LM, Wu J. Cross-talk between apolipoprotein E and cytokines. Mediators Inflamm. 2011;2011:949072. [PubMed ID: 21772670]. https://doi.org/10.1155/2011/949072.
  • 8.
    Boskovic M, Vovk T, Kores Plesnicar B, Grabnar I. Oxidative stress in schizophrenia. Curr Neuropharmacol. 2011;9(2):301-12. [PubMed ID: 22131939]. https://doi.org/10.2174/157015911795596595.
  • 9.
    Saiz PA, Morales B, G. Portilla MP, Alvarez V, Coto E, Fernandez JM, et al. Apolipoprotein E genotype and schizophrenia: further negative evidence. Acta Psychiatr Scand. 2002;105(1):71-5. [PubMed ID: 12086229].
  • 10.
    Lee MK, Park AJ, Nam BY, Min KJ, Kee BS, Park DB. Apolipoprotein E genotype in Korean schizophrenic patients. J Korean Med Sci. 2001;16(6):781-3. [PubMed ID: 11748362].
  • 11.
    Schurhoff F, Krebs MO, Szoke A, Loze JY, Goldberger C, Quignon V, et al. Apolipoprotein E in schizophrenia: a French association study and meta-analysis. Am J Med Genet B Neuropsychiatr Genet. 2003;119B(1):18-23. [PubMed ID: 12707932]. https://doi.org/10.1002/ajmg.b.20007.
  • 12.
    Price NT, Jackson VN, van der Leij FR, Cameron JM, Travers MT, Bartelds B, et al. Cloning and expression of the liver and muscle isoforms of ovine carnitine palmitoyltransferase 1: residues within the N-terminus of the muscle isoform influence the kinetic properties of the enzyme. Biochem J. 2003;372(Pt 3):871-9. [PubMed ID: 12662154]. https://doi.org/10.1042/BJ20030086.
  • 13.
    Sierra AY, Gratacos E, Carrasco P, Clotet J, Urena J, Serra D, et al. CPT1c is localized in endoplasmic reticulum of neurons and has carnitine palmitoyltransferase activity. J Biol Chem. 2008;283(11):6878-85. [PubMed ID: 18192268]. https://doi.org/10.1074/jbc.M707965200.
  • 14.
    Zammit VA. Carnitine palmitoyltransferase 1: central to cell function. IUBMB Life. 2008;60(5):347-54. [PubMed ID: 18421775]. https://doi.org/10.1002/iub.78.
  • 15.
    Bonnefont JP, Djouadi F, Prip-Buus C, Gobin S, Munnich A, Bastin J. Carnitine palmitoyltransferases 1 and 2: biochemical, molecular and medical aspects. Mol Aspects Med. 2004;25(5-6):495-520. [PubMed ID: 15363638]. https://doi.org/10.1016/j.mam.2004.06.004.
  • 16.
    Auer RN. Hypoglycemic brain damage. Metab Brain Dis. 2004;19(3-4):169-75. [PubMed ID: 15554413].
  • 17.
    Languren G, Montiel T, Julio-Amilpas A, Massieu L. Neuronal damage and cognitive impairment associated with hypoglycemia: An integrated view. Neurochem Int. 2013;63(4):331-43. [PubMed ID: 23876631]. https://doi.org/10.1016/j.neuint.2013.06.018.
  • 18.
    Prabakaran S, Swatton JE, Ryan MM, Huffaker SJ, Huang JT, Griffin JL, et al. Mitochondrial dysfunction in schizophrenia: evidence for compromised brain metabolism and oxidative stress. Mol Psychiatry. 2004;9(7):684-97. [PubMed ID: 15098003]. https://doi.org/10.1038/sj.mp.4001511.
  • 19.
    Kordi-Tamandani DM, Hashemi M, Sharifi N, Kaykhaei MA, Torkamanzehi A. Association between paraoxonase-1 gene polymorphisms and risk of metabolic syndrome. Mol Biol Rep. 2012;39(2):937-43. [PubMed ID: 21573798]. https://doi.org/10.1007/s11033-011-0819-x.
  • 20.
    Kordi-Tamandani DM, Moazeni-Roodi A, Rigi Ladez MA, Hashemi M, Birjandian E, Torkamanzehi A. Analysis of methylation patterns and expression profiles of p14ARF gene in patients with oral squamous cell carcinoma. Int J Biol Markers. 2010;25(2):99-103. [PubMed ID: 20586029].
  • 21.
    Kordi-Tamandani DM, Moazeni-Roodi AK, Rigi-Ladiz MA, Hashemi M, Birjandian E, Torkamanzehi A. Promoter hypermethylation and expression profile of MGMT and CDH1 genes in oral cavity cancer. Arch Oral Biol. 2010;55(10):809-14. [PubMed ID: 20674887]. https://doi.org/10.1016/j.archoralbio.2010.06.017.
  • 22.
    Kordi-Tamandani DM, Hashemi M, Birjandian E, Bahari A, Valizadeh J, Torkamanzehi A. Lack of association of GSTT1 and GSTP1 genes methylation and their expression profiles with risk of NAFLD in a sample of Iranian patients. Clin Res Hepatol Gastroenterol. 2011;35(5):387-92. [PubMed ID: 21429837]. https://doi.org/10.1016/j.clinre.2011.01.015.
  • 23.
    Yen YC, Rebok GW, Gallo JJ, Yang MJ, Lung FW, Shih CH. ApoE4 allele is associated with late-life depression: a population-based study. Am J Geriatr Psychiatry. 2007;15(10):858-68. [PubMed ID: 17911363]. https://doi.org/10.1097/JGP.0b013e3180f63373.
  • 24.
    Baitsch D, Bock HH, Engel T, Telgmann R, Muller-Tidow C, Varga G, et al. Apolipoprotein E induces antiinflammatory phenotype in macrophages. Arterioscler Thromb Vasc Biol. 2011;31(5):1160-8. [PubMed ID: 21350196]. https://doi.org/10.1161/ATVBAHA.111.222745.
  • 25.
    Hasan A, Nitsche MA, Rein B, Schneider-Axmann T, Guse B, Gruber O, et al. Dysfunctional long-term potentiation-like plasticity in schizophrenia revealed by transcranial direct current stimulation. Behav Brain Res. 2011;224(1):15-22. [PubMed ID: 21645555]. https://doi.org/10.1016/j.bbr.2011.05.017.
  • 26.
    Chen JY, Hong CJ, Chiu HJ, Lin CY, Bai YM, Song HL, et al. Apolipoprotein E genotype and schizophrenia. Neuropsychobiology. 1999;39(3):141-3. [PubMed ID: 10087458].
  • 27.
    Akanji AO, Ohaeri JU, Al-Shammri SN, Fatania HR. Apolipoprotein E polymorphism and clinical disease phenotypes in Arab patients with schizophrenia. Neuropsychobiology. 2009;60(2):67-72. [PubMed ID: 19752580]. https://doi.org/10.1159/000236446.
  • 28.
    Zhu S, Nothen MM, Uhlhaas S, Rietschel M, Korner J, Lanczik M, et al. Apolipoprotein E genotype distribution in schizophrenia. Psychiatr Genet. 1996;6(2):75-9. [PubMed ID: 8840393].
  • 29.
    Kampman O, Anttila S, Illi A, Mattila KM, Rontu R, Leinonen E, et al. Apolipoprotein E polymorphism is associated with age of onset in schizophrenia. J Hum Genet. 2004;49(7):355-9. [PubMed ID: 15221639]. https://doi.org/10.1007/s10038-004-0157-0.
  • 30.
    Martorell L, Costas J, Valero J, Gutierrez-Zotes A, Phillips C, Torres M, et al. Analyses of variants located in estrogen metabolism genes (ESR1, ESR2, COMT and APOE) and schizophrenia. Schizophr Res. 2008;100(1-3):308-15. [PubMed ID: 18164902]. https://doi.org/10.1016/j.schres.2007.11.001.
  • 31.
    Jonsson E, Lannfelt L, Engvall B, Sedvall G. Lack of association between schizophrenia and the apolipoprotein E epsilon 4 allele. Eur Arch Psychiatry Clin Neurosci. 1996;246(4):182-4. [PubMed ID: 8832195].
  • 32.
    Shinkai T, Ohmori O, Kojima H, Terao T, Suzuki T, Abe K, et al. Apolipoprotein E regulatory region genotype in schizophrenia. Neurosci Lett. 1998;256(1):57-60. [PubMed ID: 9832216].
  • 33.
    Shen Y, Chow J, Wang Z, Fan G. Abnormal CpG island methylation occurs during in vitro differentiation of human embryonic stem cells. Hum Mol Genet. 2006;15(17):2623-35. [PubMed ID: 16870691]. https://doi.org/10.1093/hmg/ddl188.

Copyright

Copyright © 2014, Zahedan University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

15
Oct
2016

Neuregulin-1 Gene and Schizophrenia, and its Negative Symptoms in an Iranian Population

Maryam Hatami,
Narges Karamghadiri,
Hoorie Mohaghegh,
Sadegh Yoosefee,
Morteza Karimipoor,
Mahmoudreza Hadjighasem
,et al.

Hatami M, Karamghadiri N, Mohaghegh H, Yoosefee S, Karimipoor M, et al. Neuregulin-1 Gene and Schizophrenia, and its Negative Symptoms in an Iranian Population. Iran J Psychiatry Behav Sci. 2017;11(4):e4484. doi: https://doi.org/10.5812/ijpbs.4484

13
Jan
2018
Association Between MspI Polymorphisms of the Apolipoprotein A-I Gene and Hyperlipidemia in an Iranian Population

Association Between MspI Polymorphisms of the Apolipoprotein A-I Gene and Hyperlipidemia in an Iranian Population

Abbas Pakdel,
Mohammad Reza Akbari Eidgahi,
Ahmad R. Bandegi

Pakdel A, Akbari Eidgahi MR, Bandegi AR. Association Between MspI Polymorphisms of the Apolipoprotein A-I Gene and Hyperlipidemia in an Iranian Population. Middle East J Rehabil Health Stud. 2018;5(1):e60496. doi: https://doi.org/10.5812/mejrh.60496

21
Sep
2016

Polymorphism of CYP46A1 Gene and Alzheimer’s Disease in the Iranian Population

Rohollah Mousavidehmordi,
Hossain Babaahmadi,
Bita Shalbafan,
Ghorban Mohammadzadeh,
Mohammadreza Afsharmanesh,
Alireza Kheirollah

Mousavidehmordi R, Babaahmadi H, Shalbafan B, Mohammadzadeh G, Afsharmanesh M, et al. Polymorphism of CYP46A1 Gene and Alzheimer’s Disease in the Iranian Population. Shiraz E-Med J. 2016;17(9):e59932. doi: https://doi.org/10.17795/semj41218

30
Jun
2015

Different Apolipoprotein E Polymorphisms Are Not Associated with Different Carotid Intima-Media Thickness Values in a Sample of Spanish General Population

Pilar Calmarza,
José María Trejo,
Carlos Lapresta,
María Fernández,
Pilar López

Calmarza P, María Trejo J, Lapresta C, Fernández M, López P. Different Apolipoprotein E Polymorphisms Are Not Associated with Different Carotid Intima-Media Thickness Values in a Sample of Spanish General Population. Int Cardiovasc Res J. 2017;9(2):e11399. doi:

19
Jan
2025

Investigation of the Methylation Status of Two Autophagy Genes, LC3B and ATG5, with Autophagy Gene Polymorphism ATG16L1 in Patients with Colorectal Cancer in Fars Province

Leila Shafiee,
Pooneh Mokarram,
Seyedeh Azra Shamsdin,
Zahra Khoshdel

Shafiee L, Mokarram P, Shamsdin SA, Khoshdel Z. Investigation of the Methylation Status of Two Autophagy Genes, LC3B and ATG5, with Autophagy Gene Polymorphism ATG16L1 in Patients with Colorectal Cancer in Fars Province. Shiraz E-Med J. 2025;26(4):e142779. doi: https://doi.org/10.5812/semj-142779

Download PDF155.72 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles