DAT1 Gene Polymorphism in Children with Attention Deficit Hyperactivity Disorder

Author(s):
Seyed - Mahmoud TabatabaeiSeyed - Mahmoud Tabatabaei1, 2,*, Shahrokh AmiriShahrokh AmiriShahrokh Amiri ORCID2, Nasrin ForghaniNasrin Forghani2, Seyed - Gholamreza NoorazarSeyed - Gholamreza Noorazar2, Shahin Abdollahi - FakhimShahin Abdollahi - Fakhim3, Habibeh BarzegarHabibeh BarzegarHabibeh Barzegar ORCID2, Mir - Mahmoud MirnasabMir - Mahmoud Mirnasab4
1Department of Physiology, Tabriz Branch, Islamic Azad University, Tabriz, Iran
2Research Center of Psychiatry and Behavioral Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
3Department of Otolaryngology - Head and Neck Surgery, Tabriz University of Medical Sciences, Tabriz, Iran
4Department of Education, Faculty of Education and Psychology, University of Tabriz, Tabriz, Iran

Innovative Journal of Pediatrics:Vol. 28, issue 3; e13544
Published online:May 16, 2018
Article type:Research Article
Received:May 16, 2017
Accepted:Mar 04, 2018
How to Cite:- Mahmoud Tabatabaei S, Amiri S, Forghani N, - Gholamreza Noorazar S, Abdollahi - Fakhim S, et al. DAT1 Gene Polymorphism in Children with Attention Deficit Hyperactivity Disorder. Inn J Pediatr. 2018;28(3):e13544. doi: https://doi.org/10.5812/ijp.13544

Abstract

Background:

Attention deficit hyperactivity disorder (ADHD) as a commonneuro - developmental disorder is associated with inattention, excessive activity, impulsive behavior or a combination of these symptoms. Environmental and genetic factors are involved in this disorder; Dopamine Active Transporter 1 gene (DAT1) is one of these genetic factors. In this study the association between the 10 or 9 - repeat allele of a variable number tandem repeat (VNTR) polymorphism in the 3’-untranslated region (UTR) of the DAT1 gene and ADHD, is examined.

Methods:

A total of 124 children with ADHD and 129 healthy children, ranging from 5 to 14 years old were selected from the north - western area of Iran as the case group and the control group, respectively. DAT1 gene polymorphism was investigated using the PCR-VNTR technique.

Results:

Using the Hardy - Weinberg law and chi - square test for analyzing the results of the DAT1 gene, it was observed that the genotypes 9/10 and 10/10 of DAT1 gene were significantly higher among children with ADHD than that in control group (P = 0.002).

Conclusions:

Based on these finding, it can be concluded that a significant relationship exists between DAT1 gene repeats and ADHD in North - west Iran and this can be used as a diagnostic biomarker in the prognosis of this disorder.

1. Background

Attention deficit hyperactivity disorder (ADHD) is one of the most common psychiatric problems in school - aged children (1). ADHD is a developmental disorder characterized by inattention, impulsivity and hyperactivity. The global prevalence of this disorder in school - age children is 4 - 8%. The symptoms continue into adolescence and adulthood in 50 - 80% of cases (2). According to Meysamie et al. of 1403 Iranian children aged 3 - 6 years, 362 (25.8%) were classified as having ADHD symptoms according to their parent evaluation and 239 17% according to their teacher’s evaluation (3). The prevalence of the disorder in Tabriz is estimated 9.7% among children and 3.8% in adults (4, 5). ADHD is a heterogeneous neurobehavioral disorder and symptoms are different in boys and girls. Many studies showed that girls had significantly lower scores in attention problems. Delinquent behavior, aggressive behavior, and externalizing problems were frequent in boys (6).
ADHD is a multifactorial disorder, including psychological, environmental and genetic factors (7). Several studies have shown that genetic factors contribute to 80% of this disorder’s phenotype (8-10). The data obtained from study of families and twins have shown that ADHD has a strong genetic predisposition, so that an amount of 60 - 90% have been reported by some authors (9, 11).
Several studies have shown that neural pathways of catecholamines are involved in the neurobiological basis of the disorder including dopamine and norepinephrine neurotransmitters that are involved in neurological function, concentration and awareness (12).
Polymorphism of DAT1, DBH, DRD4 and DRD5 genes has been reported as important genetic factors in the etiology of ADHD (7). DAT1 is one of the most studied genes located on chromosome 5 (13). It is one of the main regulators of dopamine transport in the synaptic space, its expression is limited to the central nervous system and is mainly expressed in the midbrain dopamine neurons. This major transporter performs its task by reuptaking dopamine and controlling its amount in synaptic space. Imbalance in the dopaminergic system creates other neurological disorders, including ADHD, schizophrenia, bipolar disorder and Parkinson disease (14).
Some studies have shown the increased density of DAT1 in the brain of ADHD patients compared with healthy people (15). But there is no definite result regarding the extent of penetration of this polymorphism in the disorder. However, numerous studies have shown a weak relationship or even the lack of relationship between DAT1 polymorphism and ADHD (16). But it is not yet clear whether the negative results are due to differences in groups and populations with different races, genetics and heterogeneity or because of weakness in performing and interpreting statistical tests or they really represent an actual difference between different communities. Therefore, the present study aimed to examine the relationship between DAT1 gene polymorphism in children with ADHD in Northwest Iran. Also we examined the association between 10 or 9 - repeat allele of a variable number tandem repeat (VNTR) polymorphism in the 3’ - untranslated region (UTR) of the DAT1 gene and ADHD.

2. Methods

2.1. Samples

A total of 130 children with ADHD from northwestern Iran, who were referred to the psychiatrc clinic and diagnosed according to the Diagnostic and Statistical Manual (DSM - 5) by the child and adolescent psychiatrists, were introduced as the experimental group. Also, 130 healthy children with a similar mean age were considered as the control group. The control group was selected from non - psychiatric patients who were referred to the Children’s Hospital affiliated to Tabriz University of Medical Sciences for adenotonsillectomy and required routine lab tests. The ADHD case selection was performed by the same child and adolescent psychiatrist.
The participants were selected through the convenience sampling method according to inclusion and exclusion criteria. Since all participants were children, written informed consents were obtained from their parents. This study was verified by the scientific and Ethics Committee of Tabriz University of Medical Sciences as a doctoral thesis.

2.2. Inclusion Criteria

  1. ADHD, diagnosed based on criteria specified in DSM - 5 through clinical interviews by child and adolescent psychiatrists and the semi - structured interview form SADS - K - PL.
  2. Age range 4 to 14 years.

2.3. Exclusion Criteria

1. History of head trauma. 2. Psychiatric comorbidity. 3. History of epilepsy. 4. Serious medical illness. 5. Mental retardation.

2.4. Gene Amplification via PCR - VNTR

First of all, 2 mL of peripheral blood was collected from the children in EDTA - containing tubes and stored at -20°C. DNA was extracted using the saturated salt extraction technique. The samples were electrophoresed on 1% agarose gel to be ensured of extraction (Figure 1).
Electrophoresis of the Extracted DNA Samples
Figure 1.

Electrophoresis of the Extracted DNA Samples

Table 1 represents the pair of primers used for amplification of DAT1 gene at 3’ UTR region.
Table 1.The Used Pair of Primers
PrimerSequenceLength (base)
ForwardGCACAAATGAGTGTTCGTGCATGTG25
ReverseAGCAGGAGGGGCTTCCAGGC20
DNA amplification was performed by polymerase chain reaction (PCR) in 20 µL solution containing 150 ng extracted genomic DNA in the Ampliqon master mix (Denmark) and 0.5 mL of each primer using the thermal program shown in Table 2.
Table 2.The Thermal Program Used for Amplification
Cycle No.StepTemperatureTime
1Initial denaturation94°C5 min
30Denaturation94°C45 sec
Annealing94°C45 sec
Extension94°C45 sec
1Final extension72°C10 min
After gene amplification, the PCR products repeats in 2% agarose gel were stained with ethidium bromide and observed under UV light.

2.5. Statistical Analysis

The results of the number of gene products in each sample were entered in SPSS - 21. The data were calculated based on the number and frequency, and the obtained means were analyzed using χ2 test. P values less than 0.05 were considered significant.

3. Results

A total of 260 children, including 130 children in the case group and 130 healthy children (control group) were investigated in this study. From 130 samples in the case group, 6 samples did not respond to PCR, so 124 samples were considered in the calculations. Similarly, of 130 healthy samples, one did not respond to PCR and hence 129 samples were entered into the calculations.
The mean age of children in the case and control group was 7.64 ± 2.35 and 7.52 ± 2.02 years, respectively (P = 0.66). Results of the samples amplified and digested by the restriction enzyme in the case and control groups are shown in Figure 2.
Lane 2, No Response To PCR; Lanes 3 to 16, 9 - Fold Repeats; Lanes 1 and 17 - 20, 10 - Fold Repeats in the Control Group; Lane 21, 50 Bp Size Marker
Figure 2.

Lane 2, No Response To PCR; Lanes 3 to 16, 9 - Fold Repeats; Lanes 1 and 17 - 20, 10 - Fold Repeats in the Control Group; Lane 21, 50 Bp Size Marker

The 9 - fold repeats with a length of 440 bp and the 10 - fold repeats with a length of 480 bp can be seen in this figure. The results show that genotypes 9/10 and 10/10 of DAT1 gene was significantly higher in children with ADHD than that in the healthy group (P = 0.002) (Table 3).
Table 3.Genotypic Percentage and Frequency in Patients with ADHD and Controls
GenotypeCase GroupControl GroupP Value
FrequencyPercentFrequencyPercent
9/910887.112798.40.002
9/101310.521.6
10/1032.400
Data analysis also showed that no significant relationship existed between the age and gender of children with ADHD and their genotype (Table 4).
Table 4.Genotypic Percentage and Frequency in Patients with ADHD and Their Relationship with Age and Gender
VariableGenotype 9/9Genotype 9/10Genotype 10/10P Value
FrequencyPercentFrequencyPercentFrequencyPercent
Age range0.288
5 - 9 years8376.91292.33100
10 - 14 years2523.117.700
Gender0.393
Boy839.761292.3266.7
Girl2523.117.713.7

4. Discussion

ADHD is a neurobehavioral disorder in children (17). Any defect in the synthesis of dopamine inhibitory neurotransmitter or its receptor protein as well as its transporter can cause the disorder. Dopamine transporter is a plasma membrane protein which is responsible for rapid collection of dopamine through its reabsorption in the presynaptic space (14). It is observed that controlling the concentration and duration of dopamine neurotransmission is performed through its reabsorption in the synaptic space (18). Immuno - histochemical studies have shown that DAT1 gene mRNA is expressed in dopaminergic neurons in the brain substantia nigra and ventral tegmental area and the protein is active in areas of the brain with dopaminergic innervation, including ventral mesencephalon and dorsal and ventral parts of corpus striatum (19, 20).
Several studies have shown that the polymorphism of DAT1 gene located at 40 bp from VNTR in the untranslatable 3’ region (3’ UTR) is considered as a risk factor for ADHD and can increase dopamine transporter expression.
This study reports that genotypes 9/10 and 10/10 of DAT1 gene was significantly higher in children with ADHD in our study population. Our results are in agreement with many other studies.
The genotype of these individuals is determined by 40 bp repeats in each of the two alleles. The genotype includes 9 - fold and 10 - fold repeats. Sometimes 10/10 genotype is associated with ADHD, although these repeats were not associated with this genetic variant in all analytical studies. No definitive result has been achieved regarding the extent of penetration of this polymorphism to this disorder so far (7).
Nevertheless, many of the studies performed in the past were unable to achieve an association between DAT1 gene and ADHD. For example, in a study by Muglia et al. (2002), no significant association was found between the frequency of DAT1 allele and children with ADHD (21). In another similar study by Bruggemann et al. (2007) on 122 patients with ADHD and 174 healthy subjects, there was no association between the occurrence of dopamine transporter and the incidence of ADHD (22). Other studies such as that of da Silva et al. (23) and Muller et al. (24) found no association. There was also no significant relationship between ADHD and the incidence of dopamine transporter allele in the study of Yu et al. but a significant relationship was observed between this disease and the allele of dopamine receptor (25).
In contrast, some other studies the relationship of this gene with ADHD is suggest. In a study by Beth Brown et al. 91 persons were examined in terms of genotype of DAT1 gene, of them 53 were ADHD patients and 38 healthy controls; among them, 62% of ADHD patients and 32% of controls had 9/10 allele (genotype 9/10) and a significant relationship existed between allele 9 and the incidence of ADHD. However, they found no association with age, gender and IQ (26). In another study by Barkley et al. 9/10 heterozygous repeat in DAT1 gene was different in many respects with 10/10 allele; such as having severe ADHD, more symptoms, many behavioral problems in childhood and adolescence, weaker relationship with parents and even learning problems at school in adolescence (27). In the study by Franke et al. a significant association was found between DAT1 gene and ADHD and in this respect, the present study is consistent with the results of other researchers (28).
The lack of similar research in other parts of the country to compare the results is a limitation of this research, although in the works of Sharif et al. and Arabgol et al. various issues of ADHD children were contemplated (29, 30).
Understanding of relationship between the number of repetitions of DAT1 gene and ADHD disorder among children in our regions is one of the strengths of this study.

4.1. Conclusion

As can be seen, the existence of a relationship between DAT1 gene polymorphism and ADHD is confirmed in many studies and rejected in many others; these discrepancies are probably due to differences in phylogenetics of different populations and races. However, determining polymorphism of this gene in the population of north - west Iran can be a prognostic tool for diagnosis of ADHD in the studied area.

Acknowledgments

Footnotes

References

  • 1.
    Franke B, Vasquez AA, Johansson S, Hoogman M, Romanos J, Boreatti-Hummer A, et al. Multicenter analysis of the SLC6A3/DAT1 VNTR haplotype in persistent ADHD suggests differential involvement of the gene in childhood and persistent ADHD. Neuropsychopharmacology. 2010;35(3):656-64. [PubMed ID: 19890261]. [PubMed Central ID: PMC3055604]. https://doi.org/10.1038/npp.2009.170.
  • 2.
    Stefanatos GA, Baron IS. Attention-deficit/hyperactivity disorder: a neuropsychological perspective towards DSM-V. Neuropsychol Rev. 2007;17(1):5-38. [PubMed ID: 17318413]. https://doi.org/10.1007/s11065-007-9020-3.
  • 3.
    Meysamie A, Fard MD, Mohammadi MR. Prevalence of Attention-Deficit/Hyperactivity Disorder Symptoms in Preschool-aged Iranian Children. Iran J Pediatr. 2011;21(4):467-72. [PubMed ID: 23056833]. [PubMed Central ID: PMC3446126].
  • 4.
    Amiri S, Ghoreishizadeh MA, Sadeghi-Bazargani H, Jonggoo M, Golmirzaei J, Abdi S, et al. Prevalence of Adult Attention Deficit Hyperactivity Disorder (Adult ADHD): Tabriz. Iran J Psychiatry. 2014;9(2):83-8.
  • 5.
    Amiri S, Fakhari A, Maheri M, Mohammadpoor Asl A. Attention deficit/hyperactivity disorder in primary school children of Tabriz, North-West Iran. Paediatr Perinat Epidemiol. 2010;24(6):597-601. [PubMed ID: 20955237]. https://doi.org/10.1111/j.1365-3016.2010.01145.x.
  • 6.
    Tehrani-Doost M, Shahrivar Z, Pakbaz B, Rezaie A, Ahmadi F. Normative data and psychometric properties of the child behavior checklist and teacher rating form in an Iranian community sample. Iran J Pediatr. 2011;21(3):331-42. [PubMed ID: 23056810]. [PubMed Central ID: PMC3446174].
  • 7.
    Agudelo JA, Galvez JM, Fonseca DJ, Mateus HE, Talero-Gutierrez C, Velez-Van-Meerbeke A. Evidence of an association between 10/10 genotype of DAT1 and endophenotypes of attention deficit/hyperactivity disorder. Neurologia. 2015;30(3):137-43. [PubMed ID: 24461309]. https://doi.org/10.1016/j.nrl.2013.12.005.
  • 8.
    van den Berg SM, Willemsen G, de Geus EJ, Boomsma DI. Genetic etiology of stability of attention problems in young adulthood. Am J Med Genet B Neuropsychiatr Genet. 2006;141B(1):55-60. [PubMed ID: 16287044]. https://doi.org/10.1002/ajmg.b.30251.
  • 9.
    Kuntsi J, Rijsdijk F, Ronald A, Asherson P, Plomin R. Genetic influences on the stability of attention-deficit/hyperactivity disorder symptoms from early to middle childhood. Biol Psychiatry. 2005;57(6):647-54. [PubMed ID: 15780852]. https://doi.org/10.1016/j.biopsych.2004.12.032.
  • 10.
    Larsson JO, Larsson H, Lichtenstein P. Genetic and environmental contributions to stability and change of ADHD symptoms between 8 and 13 years of age: a longitudinal twin study. J Am Acad Child Adolesc Psychiatry. 2004;43(10):1267-75. [PubMed ID: 15381894]. https://doi.org/10.1097/01.chi.0000135622.05219.bf.
  • 11.
    Waldman ID, Rhee SH. Behavioral and molecular genetic studies. In: Sandberg S, editor. Hyperactivity and Attention Disorders of Childhood. 2nd ed. New York: Wiley; 2002. p. 290-335.
  • 12.
    Reiersen AM, Todorov AA. Association between DRD4 genotype and Autistic Symptoms in DSM-IV ADHD. J Can Acad Child Adolesc Psychiatry. 2011;20(1):15-21. [PubMed ID: 21286365]. [PubMed Central ID: PMC3024719].
  • 13.
    Brookes KJ, Neale BM, Sugden K, Khan N, Asherson P, D'Souza UM. Relationship between VNTR polymorphisms of the human dopamine transporter gene and expression in post-mortem midbrain tissue. Am J Med Genet B Neuropsychiatr Genet. 2007;144B(8):1070-8. [PubMed ID: 17579365]. https://doi.org/10.1002/ajmg.b.30572.
  • 14.
    Roman T, Schmitz M, Polanczyk G, Eizirik M, Rohde LA, Hutz MH. Attention-deficit hyperactivity disorder: a study of association with both the dopamine transporter gene and the dopamine D4 receptor gene. Am J Med Genet. 2001;105(5):471-8. [PubMed ID: 11449401].
  • 15.
    Amara SG, Kuhar MJ. Neurotransmitter transporters: recent progress. Annu Rev Neurosci. 1993;16:73-93. [PubMed ID: 8096377]. https://doi.org/10.1146/annurev.ne.16.030193.000445.
  • 16.
    Mick E, Biederman J, Spencer T, Faraone SV, Sklar P. Absence of association with DAT1 polymorphism and response to methylphenidate in a sample of adults with ADHD. Am J Med Genet B Neuropsychiatr Genet. 2006;141B(8):890-4. [PubMed ID: 16917950]. [PubMed Central ID: PMC2715939]. https://doi.org/10.1002/ajmg.b.30376.
  • 17.
    Subcommittee on Attention-Deficit/Hyperactivity D, Steering Committee on Quality I, Wolraich M, Brown L, Brown RT; Management, et al. ADHD: clinical practice guideline for the diagnosis, evaluation, and treatment of attention-deficit/hyperactivity disorder in children and adolescents. Pediatrics. 2011;128(5):1007-22. [PubMed ID: 22003063]. [PubMed Central ID: PMC4500647]. https://doi.org/10.1542/peds.2011-2654.
  • 18.
    Frazer A, Gerhardt GA, Daws LC. New views of biogenic amine transporter function: implications for neuropsychopharmacology. Int J Neuropsychopharmacol. 1999;2(4):305-20. [PubMed ID: 11285147]. https://doi.org/10.1017/S1461145799001625.
  • 19.
    Gainetdinov RR, Jones SR, Fumagalli F, Wightman RM, Caron MG. Re-evaluation of the role of the dopamine transporter in dopamine system homeostasis. Brain Res Brain Res Rev. 1998;26(2-3):148-53. [PubMed ID: 9651511].
  • 20.
    Turic D, Swanson J, Sonuga-Barke E. DRD4 and DAT1 in ADHD: Functional neurobiology to pharmacogenetics. Pharmgenomics Pers Med. 2010;3:61-78. [PubMed ID: 23226043]. [PubMed Central ID: PMC3513209].
  • 21.
    Muglia P, Jain U, Inkster B, Kennedy JL. A quantitative trait locus analysis of the dopamine transporter gene in adults with ADHD. Neuropsychopharmacology. 2002;27(4):655-62. [PubMed ID: 12377402]. https://doi.org/10.1016/S0893-133X(02)00328-7.
  • 22.
    Bruggemann D, Sobanski E, Alm B, Schubert T, Schmalzried H, Philipsen A, et al. No association between a common haplotype of the 6 and 10-repeat alleles in intron 8 and the 3'UTR of the DAT1 gene and adult attention deficit hyperactivity disorder. Psychiatr Genet. 2007;17(2):121. [PubMed ID: 17413453]. https://doi.org/10.1097/YPG.0b013e32801231d4.
  • 23.
    Aparecida da Silva M, Cordeiro Q, Louza M, Vallada H. Lack of association between a 3'UTR VNTR polymorphism of dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. J Atten Disord. 2011;15(4):305-9. [PubMed ID: 20332413]. https://doi.org/10.1177/1087054710365989.
  • 24.
    Muller DJ, Chiesa A, Mandelli L, De Luca V, De Ronchi D, Jain U, et al. Correlation of a set of gene variants, life events and personality features on adult ADHD severity. J Psychiatr Res. 2010;44(9):598-604. [PubMed ID: 20006992]. https://doi.org/10.1016/j.jpsychires.2009.11.011.
  • 25.
    Yu CJ, Du JC, Chiou HC, Feng CC, Chung MY, Yang W, et al. Sugar-Sweetened Beverage Consumption Is Adversely Associated with Childhood Attention Deficit/Hyperactivity Disorder. Int J Environ Res Public Health. 2016;13(7). [PubMed ID: 27384573]. [PubMed Central ID: PMC4962219]. https://doi.org/10.3390/ijerph13070678.
  • 26.
    Brown AB, Biederman J, Valera E, Makris N, Doyle A, Whitfield-Gabrieli S, et al. Relationship of DAT1 and adult ADHD to task-positive and task-negative working memory networks. Psychiatry Res. 2011;193(1):7-16. [PubMed ID: 21596533]. [PubMed Central ID: PMC3105199]. https://doi.org/10.1016/j.pscychresns.2011.01.006.
  • 27.
    Barkley RA, Smith KM, Fischer M, Navia B. An examination of the behavioral and neuropsychological correlates of three ADHD candidate gene polymorphisms (DRD4 7+, DBH TaqI A2, and DAT1 40 bp VNTR) in hyperactive and normal children followed to adulthood. Am J Med Genet B Neuropsychiatr Genet. 2006;141B(5):487-98. [PubMed ID: 16741944]. [PubMed Central ID: PMC2562041]. https://doi.org/10.1002/ajmg.b.30326.
  • 28.
    Franke B, Hoogman M, Arias Vasquez A, Heister JG, Savelkoul PJ, Naber M, et al. Association of the dopamine transporter (SLC6A3/DAT1) gene 9-6 haplotype with adult ADHD. Am J Med Genet B Neuropsychiatr Genet. 2008;147B(8):1576-9. [PubMed ID: 18802924]. https://doi.org/10.1002/ajmg.b.30861.
  • 29.
    Sharif F, Zarei S, Alavi Shooshtari A, Vossoughi M. The Effect of Stress Management Program Using Cognitive Behavior Approach on Mental Health of the Mothers of the Children With Attention Deficit Hyperactivity Disorder. Iran J Pediatr. 2015;25(3). e474. [PubMed ID: 26199709]. [PubMed Central ID: PMC4505991]. https://doi.org/10.5812/ijp.25(3)2015.474.
  • 30.
    Arabgol F, Panaghi L, Nikzad V. Risperidone Versus Methylphenidate in Treatment of Preschool Children With Attention-Deficit Hyperactivity Disorder. Iran J Pediatr. 2015;25(1). e265. [PubMed ID: 26199694]. [PubMed Central ID: PMC4505976]. https://doi.org/10.5812/ijp.265.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles