Jentashapir J Cell Mol Biol

Image Credit:Jentashapir J Cell Mol Biol

Investigating HOTAIR Polymorphisms as a Potential Diagnostic Marker for Type 2 Diabetes in an Iraqi Population

Author(s):
Zainab Hadi TalibZainab Hadi Talib1, Amir JalaliAmir JalaliAmir Jalali ORCID1,*, Abbass HaydarAbbass Haydar2
1Department of Biology, Faculty of Science, Arak University, Arak, Iran
2Department of Anesthesia, Faculty of Health and Medical Technology, Al-Ayen Iraqi University, Thi-Qar, Iraq

Jentashapir Journal of Cellular and Molecular Biology:Vol. 15, issue 4; e154415
Published online:Dec 02, 2024
Article type:Research Article
Received:Sep 28, 2024
Accepted:Nov 16, 2024
How to Cite:Hadi Talib Z, Jalali A, Haydar A. Investigating HOTAIR Polymorphisms as a Potential Diagnostic Marker for Type 2 Diabetes in an Iraqi Population. Jentashapir J Cell Mol Biol. 2024;15(4):e154415. doi: https://doi.org/10.5812/jjcmb-154415

Abstract

Background:

Diabetes mellitus type 2 (T2DM) is a chronic condition characterized by insulin resistance, affecting approximately 530 million adults globally, with a prevalence of 10.5% among individuals aged 20 to 79. In Iraq, the prevalence is significantly higher at 13.9%.

Objectives:

This study examines the relationship between long noncoding RNA HOX transcript antisense RNA (HOTAIR) polymorphisms and T2DM risk, investigating HOTAIR's potential as a diagnostic marker.

Methods:

Blood samples were collected from 28 T2DM patients and 20 healthy controls, with physiological parameters measured. HOTAIR plasma levels were assessed using quantitative real-time (qRT)-PCR, and single-nucleotide polymorphisms rs12826786 and rs1899663 were analyzed through amplification refractory mutation system (ARMS)-PCR.

Results:

HOX transcript antisense RNA expression was found to be 6.6 times higher in T2DM patients compared to controls, suggesting its involvement in T2DM pathophysiology. Genotype distributions adhered to Hardy-Weinberg equilibrium, with the rs12826786 C allele appearing protective against T2DM, while rs1899663 showed no significant association. Statistical analysis identified a significant relationship between the rs12826786 genotype and body mass index (BMI), though other diabetes-related metrics did not show significant results.

Conclusions:

The findings suggest that elevated HOTAIR expression may play a role in T2DM, highlighting the need for further investigation into these associations and their potential implications for diagnosis and risk assessment.

1. Background

Diabetes mellitus (DM) is a chronic metabolic disorder characterized by persistent high blood sugar levels, resulting from impaired insulin secretion, action, or both. The International Diabetes Federation (IDF) estimates that approximately 537 million adults worldwide are affected by diabetes, representing a prevalence of 10.5% among individuals aged 20 to 79. Projections indicate that this number could increase to 643 million by 2030 and 783 million by 2045, reflecting a 46% rise despite a 20% growth in the global population (1). Diabetes mellitus type 2 (T2DM) accounts for approximately 98% of all diabetes cases, with significant regional variations in prevalence (2). The recent surge in diabetes cases is attributed to factors such as urbanization, sedentary lifestyles, and dietary changes, which contribute to rising obesity rates (3). In Iraq, 13.9% of adults are living with diabetes, according to the World Health Organization (WHO) report in 2020. This high prevalence presents considerable public health challenges, necessitating research into the causes, risk factors, and potential diagnostic markers for diabetes to inform effective prevention and management strategies (4).

Genetic factors play a significant role in the etiology of T2DM, with various genetic markers and polymorphisms linked to increased susceptibility (5). Long noncoding RNAs (lncRNAs) have emerged as important regulators of gene expression and metabolic processes (6, 7). One notable lncRNA, HOX transcript antisense RNA (HOTAIR), located on chromosome 12q13.13, consists of 2,158 nucleotides and plays a critical role in regulating gene expression through interactions with chromatin-modifying complexes (8, 9). HOTAIR has been implicated in glucose metabolism and insulin signaling, potentially influencing insulin sensitivity and glucose uptake (10, 11). Research suggests that HOTAIR may regulate glucose transporters such as GLUT1, which is vital for glucose uptake. Understanding the mechanisms by which HOTAIR affects glucose metabolism could identify therapeutic targets for T2DM management (12, 13). Specific single-nucleotide polymorphisms (SNPs) in the HOTAIR gene, such as rs874945, rs7958904, rs12826786, and rs1899663, may alter HOTAIR expression and contribute to T2DM risk. A meta-analysis highlighted 31 genes significantly associated with T2DM risk in Iraq, emphasizing the need for further investigation (14-16).

Although a meta-analysis by Musafer et al. identified 31 genes across 41 studies that are strongly associated with the risk of T2DM in Iraq (17), no research has been conducted on the association between HOTAIR SNPs, the expression levels of this lncRNA, and T2DM in Iraqi populations.

2. Objectives

This study examines the relationship between HOTAIR SNPs rs12826786 (C > T) and rs1899663 (G > T) and the risk of T2DM in an Iraqi population, aiming to evaluate whether HOTAIR expression can serve as a diagnostic marker for identifying individuals predisposed to diabetes.

3. Methods

3.1. Patients and Controls

This study included 48 participants aged 22 to 60, consisting of 28 patients with T2DM from Thi-Qar Governorate, Iraq, and 20 healthy controls. Patients were selected based on WHO criteria for diabetes diagnosis. Inclusion criteria required confirmed T2DM diagnoses, while exclusion criteria ruled out individuals with other types of diabetes, severe cardiovascular disease, malignancies, autoimmune disorders, recent corticosteroid treatments, recent surgeries, blood transfusions, diabetes-related complications, or uncontrolled hyperglycemia. All patients were newly diagnosed with T2DM and had not received any diabetes treatment prior to sampling, ensuring that complications or uncontrolled hyperglycemia were not present at the time of diagnosis.

3.2. Genotyping

Blood samples (5 mL) were collected in EDTA tubes, diluted tenfold, and frozen using a programmable freezer (Plate freezer RoSS.pFTU, USA) following this protocol: Cooled from 5°C to -10°C at a rate of 1°C/min, held at -10°C for 3 minutes, and then cooled from -10°C to -20°C at 1°C/min. The frozen blood was stored at -20°C until DNA extraction. For genomic DNA extraction, the samples were thawed by incubation at 37°C for 15 minutes, and the Geneaid USA gSYNCTM DNA extraction kit, specifically designed for frozen blood, was utilized.

Genotyping of SNPs rs12826786 and rs1899663 was performed using the amplification refractory mutation system (ARMS)-PCR, with primers designed using Primer3 software, as detailed in Table 1. The PCR protocol included an initial denaturation at 95°C for 5 minutes, followed by 35 cycles at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, ending with a final extension at 72°C for 5 minutes. The total reaction volume was 25 μL, utilizing GoTaq® G2 Green Master Mix. PCR products were analyzed via agarose gel electrophoresis, and selected samples were sequenced with an ABI automated DNA sequencer (Applied Biosystems, USA).

Table 1.Oligonucleotide Primers Used in Amplification Refractory Mutation System PCR
Variables and PrimersSequence (5ʹ → 3ʹ)Product Size (bp)
rs1899663247
Wild type forward C allele primer AAGCCTCTAATTGTTGTCATC
Mutant forward A allele primerAAGCCTCTAATTGTTGTCATA
Generic reverse primerTAATCAAATCCTCTTCCTTTGT
rs12826786140
Wild type reverse C allele primer GAGGGAAGGAGCTTAGGATAAATG
Mutant reverse T allele primerGAGGGAAGGAGCTTAGGATAAATA
Generic forward primerATCTGTCCAGTCGCTCGTC

3.3. HOTAIR Gene Expression Analysis

Total RNA was extracted from blood samples using the TRIzol® Reagent Kit, and its quantity and quality were evaluated with a NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA). To eliminate residual genomic DNA, RNA samples were treated with DNase I. First-strand complementary DNA (cDNA) was synthesized using the QIAGEN cDNA synthesis kit (QIAGEN, Germany), with primers designed using Primer3 software, as detailed in Table 2.

Table 2.Forward and Reverse Primer Sequences
PrimersSequence (5ʹ → 3ʹ)Product Size (bp)NCBI Reference
HOTAIR140NR_003716.4
FACCAGCAATTACACCCAAGC
RTGCATTTCTCTGCGTGGTTC
GAPDH129NM_001256799.3
FTCACCAGGGCTGCTTTTAAC
RTGACGGTGCCATGGAATTTG

Quantitative real-time PCR (qRT-PCR) was performed in triplicate in a 20 µL reaction volume, consisting of 5 µL of cDNA (100 ng), 1.0 µL of each forward and reverse primer (10 pmol), 10 µL of SYBR Green master mix, and 3.0 µL of DEPC-treated water, with GAPDH as the normalization gene. Relative expression levels of the HOTAIR gene were calculated using the 2-ΔΔCT method. qRT-PCR was conducted on an ABI 7500 real-time PCR system (Applied Biosystems, USA), following specific cycling conditions: Initial denaturation at 95°C for 5 minutes, followed by 35 cycles at 95°C for 20 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

3.4. Statistical Analysis

To evaluate Hardy-Weinberg equilibrium for allele frequencies of the two SNPs, a chi-square test was conducted. Genotype and allele frequencies were compared using odds ratios (ORs), and a logistic regression model was employed to assess the association between SNP genotypes and T2DM risk. Gene expression levels in control and treated samples were analyzed using Tukey's HSD post-hoc test. Results are presented as mean ± standard error, with statistical significance set at P ≤ 0.05. Statistical analyses were performed using SPSS version 21.0.

4. Results

The study evaluated HOTAIR gene expression levels in individuals with T2DM, finding them to be 6.6 times higher than in healthy controls, indicating HOTAIR's potential role in T2DM pathophysiology. Regression analysis confirmed the validity of the model used (Figure 1). Agarose gel electrophoresis was employed to analyze the HOTAIR polymorphisms rs1899663 and rs12826786, identifying three genotypes for each: GG, TT, and GT (274 bp) for rs1899663, and CC, TT, and CT (140 bp) for rs12826786 (Figure 2).

The relative expression of <i>HOTAIR</i> gene in diabetes mellitus type 2 (T2DM) patients compared to healthy control. A, the mean of fold change (2<sup>-ΔΔCT</sup>) values between the control and patient’s groups. The error bars represent the standard deviation. This graph shows a significant difference in the mean fold change between the two groups; B, the normal P-P plot of regression standardized residual for the dependent variable "ΔCT patients". The plot demonstrates that the residuals follow a normal distribution, which is an important assumption for the regression analysis performed. Data are expressed as mean ± SD (n = 3). P-values &lt; 0.05 indicate statistically significant differences.
Figure 1.

The relative expression of HOTAIR gene in diabetes mellitus type 2 (T2DM) patients compared to healthy control. A, the mean of fold change (2-ΔΔCT) values between the control and patient’s groups. The error bars represent the standard deviation. This graph shows a significant difference in the mean fold change between the two groups; B, the normal P-P plot of regression standardized residual for the dependent variable "ΔCT patients". The plot demonstrates that the residuals follow a normal distribution, which is an important assumption for the regression analysis performed. Data are expressed as mean ± SD (n = 3). P-values < 0.05 indicate statistically significant differences.

Amplicons for A, rs1899663; and B, rs12826786 <i>HOTAIR</i> gene single nucleotide polymorphism. M: Molecular ladder.
Figure 2.

Amplicons for A, rs1899663; and B, rs12826786 HOTAIR gene single nucleotide polymorphism. M: Molecular ladder.

Hardy-Weinberg equilibrium (HWE) assessments yielded P-values of 0.082 for rs12826786 in patients and 0.44 in controls, indicating equilibrium. For rs1899663, the P-values were 0.525 and 0.245 in patients and controls, respectively. An online tool was used to calculate odds ratios and confidence intervals, revealing no significant association between rs1899663 and T2DM, while rs12826786 showed a significant association with the protective C allele (Table 3).

Table 3.Distribution of Allele and Frequencies of HOTAIR Gene Polymorphisms: Analysis of Single-Nucleotide Polymorphisms in Diabetes Mellitus Type 2 Patients and Healthy Controls
VariablesT2DM PatientsControlORCI 95%P-Value a
rs1899663 (G > T)
Genotype frequency
GG9 (50)9 (50)0.570.176 - 1.890.36
GT11 (64.7)6 (35.3)1.50.44 - 5.110.5
TT8 (61.5)5 (38.5)1.20.32 - 4.40.78
Allele frequency0.710.31 - 1.620.42
G29 (54.7)24 (45.3)
T27 (62.8)16 (37.2)
Recessive model0.830.22 - 3.060.78
GG+GT20 (57.1)15 (42.9)
TT8 (61.6)5 (38.4)
Dominant model0.570.17 - 1.890.36
GG9 (50)9 (50)
TT+GT19 (63.3)11 (36.7)
rs12826786 (C > T)
Genotype frequency
CC9 (45)11 (55)0.38760.1185 - 1.26810.117
CT8 (57.1)6 (42.9)0.9330.2648 - 3.28950.9145
TT11 (78.6)3 (41.4)3.660.86 - 15.50.077
Allele frequency0.370.15 - 0.870.023
C26 (48.1)28 (51.9)
T30 (71.4)12 (28.6)
Recessive model0.270.06 - 1.150.07
CC+CT17 (50)17 (50)
TT11 (78.6)3 (41.4)
Dominant model0.70.244 - 2.190.57
CC9 (45)11 (55)
TT+CT19 (52.7)17 (47.3)

Abbreviations: T2DM, diabetes mellitus type 2; OR, odds ratio; CI, confidence interval.

a P-value was calculated by chi-square test and statistically significant at ≤ 0.05.

The study also examined the relationship between these genotypes and various blood parameters, including body mass index (BMI), glycated hemoglobin (HbA1c), cholesterol, high-density lipoprotein (HDL), triglycerides, and fasting blood sugar (FBS). Statistical analysis confirmed normality and homogeneity of variance, identifying a significant association between the CT genotype of rs12826786 and higher BMI (P = 0.028) compared to the CC and TT genotypes. However, other parameters did not show significant associations, suggesting that while trends may exist, limitations in sample size and variation constrain the strength of the conclusions (Table 4).

Table 4.Association of the rs1899663 and rs1800896 HOTAIR Gene Polymorphisms with Biochemical Parameters in Diabetes Mellitus Type 2 Patients
VariablesReference ValueGenesGenotypeNMean ± SDP-Value a
BMI18.5 - 24.9rs1899663GG928.9 ± 4.90.093
GT1133.2 ± 5.7
TT827.9 ± 4.8
rs12826786CC928.4 ± 4.70.028
CT834.81 ± 6.5
TT1128.72 ± 4.9
HbA1c (%)4 - 5.6rs1899663GG98.24 ± 1.70.149
GT119.55 ± 3.6
TT88.08 ± 4.4
rs12826786CC98.27 ± 1.30.6
CT89.2 ± 4.7
TT118.72 ± 4.7
Total Cholesterol (mg/dL)Less than 200rs1899663GG9181.88 ± 22.20.78
GT11190.54 ± 32.3
TT8172 ± 42.4
rs12826786CC9172.88 ± 23.80.82
CT8186.5 ± 25.7
TT11187 ± 44.54
HDL (mg/dL)Men: Less than 40; women: Less than 50rs1899663GG935.1 ± 4.10.647
GT1138.36 ± 6.2
TT837.75 ± 5.9
rs12826786CC937.55 ± 7.70.62
CT839.04 ± 9.9
TT1135.45 ± 6.4
Triglycerides (mg/dL)Less than 150rs1899663GG9181.88 ± 42.70.969
GT11174.27 ± 41.5
TT8180.5 ± 34.8
rs12826786CC9181.88 ± 45.90.93
CT8170.75 ± 43.6
TT11181.36 ± 37.6
FBS (mg)70 - 100rs1899663GG9224.33 ± 39.10.994
GT11219.81 ± 69.4
TT8225.37 ± 80.6
rs12826786CC9194.66 ± 43.30.68
CT8228.51 ± 84.2
TT11241.81 ± 95.1

Abbreviations: BMI, Body Mass Index; HbA1c, glycated hemoglobin; HDL, high-density lipoprotein; FBS, fasting blood sugar.

a P-value was statistically significant at ≤ 0.05.

5. Discussion

Recent research has highlighted the role of genetic factors in understanding T2DM, with particular focus on the long non-coding RNA HOTAIR. One mechanism by which HOTAIR exerts its effects is through the inhibition of sirtuin 1 (SIRT1), a protein essential for regulating metabolism, inflammation, and aging. This inhibition disrupts beneficial metabolic processes and contributes to increased insulin resistance, emphasizing SIRT1 as a potential therapeutic target for enhancing insulin sensitivity. Additionally, HOTAIR suppresses the Akt/GSK-3β signaling pathway, resulting in diminished insulin sensitivity and impaired glycogen synthesis, thereby exacerbating hyperglycemia (18, 19).

Our study found that HOTAIR expression levels were approximately 6.6 times higher in individuals with T2DM compared to healthy controls, raising questions about its role in diabetes. Elevated HOTAIR expression is significantly stimulated by tumor necrosis factor-alpha (TNFA), which is implicated in various inflammatory diseases, including type 1 diabetes mellitus (T1DM) (20, 21). Increased HOTAIR levels further contribute to hepatic insulin resistance by activating the Akt and GSK pathways (22). Moreover, HOTAIR upregulates genes related to the cell cycle, such as PLK4 and CCNA2, which are associated with T2DM development.

Studies have demonstrated that HOTAIR acts as a molecular sponge for miR-34a, targeting SIRT1, suggesting that its overexpression may offer protective effects against diabetic cardiomyopathy (DCM) (23). Furthermore, HOTAIR has been implicated in enhancing cardiomyocyte survival through activation of the PI3K/Akt pathway (24). However, some researchers, such as Majumder et al., propose that HOTAIR's role in diabetic kidney disease may be passive (25). HOTAIR's involvement also extends to facilitating angiogenesis in diabetic retinopathy (26) and is implicated in various diabetes-related pathways, such as TNF signaling and FoxO signaling (27). These findings collectively underscore HOTAIR's critical role in glucose metabolism and its potential as a biomarker for chronic diabetes complications.

HOTAIR polymorphisms have been linked to increased risks for various conditions, including cancer and coronary artery disease, by influencing HOTAIR expression (28). Wang et al. reported associations between HOTAIR polymorphisms and lung cancer susceptibility, with environmental factors playing a significant role (28). Li et al. demonstrated that the rs4759314 A/G polymorphism affects HOTAIR promoter activity, disrupting critical pathways involved in congenital heart disease (19). However, Bayram et al. found no significant association between the HOTAIR rs920778 C/T polymorphism and gastric cancer risk in a Turkish population, highlighting that genetic impacts can vary by ethnicity or cancer type (29).

Despite extensive studies on HOTAIR in cancer, research on its polymorphisms in relation to diabetes remains limited. This gap emphasizes the need for further investigations into how HOTAIR genetic variations may influence diabetes risk and pathophysiology. In a study by Majidpour et al., the impact of polymorphisms in the HOTAIR lncRNA on chronic kidney disease (CKD) susceptibility was examined. The rs4759314 variant provided significant protection against CKD, while rs3816153 reduced risk by up to 78% in certain genotypes. Conversely, the CC+CT genotype and T allele of rs12826786 increased CKD risk. Notably, the specific haplotype (Crs12826786Trs920778Grs1899663Grs4759314G) was associated with an 86% reduced risk (16).

The study by Chuang et al. assessed the correlation between HOTAIR SNPs and diabetic retinopathy (DR) characteristics. They genotyped four SNPs in 276 DR patients and 452 controls, identifying significant associations between rs12427129 CT and rs1899663 TT variants and increased DR risk. In the proliferative diabetic retinopathy (PDR) subgroup, these SNPs were more prevalent, particularly among females. Additionally, patients with rs1899663 GT+TT had a shorter duration of diabetes. Overall, HOTAIR SNPs rs12427129 and rs1899663 are closely linked to DR presence, particularly in females with PDR (30).

Sargazi et al. investigated the association between four polymorphisms—rs920778 (C/T), rs4759314 (A/G), rs12826786 (C/T), and rs1899663 (G/T)—in the HOTAIR gene and T2DM risk in a southeast Iranian population. They found significant positive associations between the first three polymorphisms and T2DM susceptibility, while rs1899663 showed a negative association, suggesting a protective effect. Additionally, links were noted between rs920778 and HDL-C, and rs4759314 with fasting blood sugar and LDL-C levels. Haplotype analysis revealed that specific haplotypes significantly increased T2DM risk, indicating the potential of HOTAIR polymorphisms as prognostic markers influencing disease susceptibility through various pathways (31).

Our analysis of blood parameters showed a significant association between rs12826786 and BMI, suggesting that this genotype may contribute to increased body weight, although other metabolic parameters, such as HbA1c, showed no significant associations.

5.1. Conclusions

This study underscores the significant role of lncRNA HOTAIR in the pathophysiology of T2DM. The elevated levels of HOTAIR observed in T2DM patients compared to healthy controls highlight its potential as a biomarker for the disease. Furthermore, the protective effect of the rs12826786 C allele against T2DM emphasizes the contribution of genetic factors to diabetes risk. The observed association between the rs12826786 genotype and BMI suggests a potential link to metabolic health, though further research is required to investigate the broader implications of HOTAIR polymorphisms in diverse populations. These findings advocate for more extensive studies to validate HOTAIR as a diagnostic marker and to deepen our understanding of its role in T2DM.

Footnotes

References

  • 1.
    Sun H, Saeedi P, Karuranga S, Pinkepank M, Ogurtsova K, Duncan BB, et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pract. 2022;183:109119. [PubMed ID: 34879977]. [PubMed Central ID: PMC11057359]. https://doi.org/10.1016/j.diabres.2021.109119.
  • 2.
    GBD Diabetes Collaborators. Global, regional, and national burden of diabetes from 1990 to 2021, with projections of prevalence to 2050: a systematic analysis for the Global Burden of Disease Study 2021. Lancet. 2023;402(10397):203-34. [PubMed ID: 37356446]. [PubMed Central ID: PMC10364581]. https://doi.org/10.1016/S0140-6736(23)01301-6.
  • 3.
    Hu FB. Globalization of diabetes: the role of diet, lifestyle, and genes. Diabetes Care. 2011;34(6):1249-57. [PubMed ID: 21617109]. [PubMed Central ID: PMC3114340]. https://doi.org/10.2337/dc11-0442.
  • 4.
    Abusaib M, Ahmed M, Nwayyir HA, Alidrisi HA, Al-Abbood M, Al-Bayati A, et al. Iraqi Experts Consensus on the Management of Type 2 Diabetes/Prediabetes in Adults. Clin Med Insights Endocrinol Diabetes. 2020;13:1179551420942230. [PubMed ID: 32884389]. [PubMed Central ID: PMC7440731]. https://doi.org/10.1177/1179551420942232.
  • 5.
    Witka BZ, Oktaviani DJ, Marcellino M, Barliana MI, Abdulah R. Type 2 Diabetes-Associated Genetic Polymorphisms as Potential Disease Predictors. Diabetes Metab Syndr Obes. 2019;12:2689-706. [PubMed ID: 31908510]. [PubMed Central ID: PMC6927489]. https://doi.org/10.2147/DMSO.S230061.
  • 6.
    Hussein RM. Long non-coding RNAs: The hidden players in diabetes mellitus-related complications. Diabetes Metab Syndr. 2023;17(10):102872. [PubMed ID: 37797393]. https://doi.org/10.1016/j.dsx.2023.102872.
  • 7.
    Statello L, Guo CJ, Chen LL, Huarte M. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021;22(2):96-118. [PubMed ID: 33353982]. [PubMed Central ID: PMC7754182]. https://doi.org/10.1038/s41580-020-00315-9.
  • 8.
    Hajjari M, Salavaty A. HOTAIR: an oncogenic long non-coding RNA in different cancers. Cancer Biol Med. 2015;12(1):1-9. [PubMed ID: 25859406]. [PubMed Central ID: PMC4383848]. https://doi.org/10.7497/j.issn.2095-3941.2015.0006.
  • 9.
    Su R, Wu X, Ke F. Long Non-Coding RNA HOTAIR Expression and Clinical Significance in Patients with Gestational Diabetes. Int J Gen Med. 2021;14:9945-50. [PubMed ID: 34938112]. [PubMed Central ID: PMC8687518]. https://doi.org/10.2147/IJGM.S341106.
  • 10.
    Yang W, Lyu Y, Xiang R, Yang J. Long Noncoding RNAs in the Pathogenesis of Insulin Resistance. Int J Mol Sci. 2022;23(24). [PubMed ID: 36555704]. [PubMed Central ID: PMC9785789]. https://doi.org/10.3390/ijms232416054.
  • 11.
    Niknam N, Nikooei S, Ghasemi H, Zadian SS, Goudarzi K, Ahmadi SM, et al. Circulating Levels of HOTAIR- lncRNA Are Associated with Disease Progression and Clinical Parameters in Type 2 Diabetes Patients. Rep Biochem Mol Biol. 2023;12(3):448-57. [PubMed ID: 38618258]. [PubMed Central ID: PMC11015925]. https://doi.org/10.61186/rbmb.12.3.448.
  • 12.
    Cornwell A, Ziolkowski H, Badiei A. Glucose Transporter Glut1-Dependent Metabolic Reprogramming Regulates Lipopolysaccharide-Induced Inflammation in RAW264.7 Macrophages. Biomolecules. 2023;13(5). [PubMed ID: 37238640]. [PubMed Central ID: PMC10216519]. https://doi.org/10.3390/biom13050770.
  • 13.
    Obaid M, Udden SMN, Alluri P, Mandal SS. LncRNA HOTAIR regulates glucose transporter Glut1 expression and glucose uptake in macrophages during inflammation. Sci Rep. 2021;11(1):232. [PubMed ID: 33420270]. [PubMed Central ID: PMC7794310]. https://doi.org/10.1038/s41598-020-80291-4.
  • 14.
    Kim JO, Jun HH, Kim EJ, Lee JY, Park HS, Ryu CS, et al. Genetic Variants of HOTAIR Associated With Colorectal Cancer Susceptibility and Mortality. Front Oncol. 2020;10:72. [PubMed ID: 32117729]. [PubMed Central ID: PMC7020018]. https://doi.org/10.3389/fonc.2020.00072.
  • 15.
    Ahmad F, Sudesh R, Ahmed AT, Haque S. Roles of HOTAIR Long Non-coding RNA in Gliomas and Other CNS Disorders. Cell Mol Neurobiol. 2024;44(1):23. [PubMed ID: 38366205]. [PubMed Central ID: PMC10873238]. https://doi.org/10.1007/s10571-024-01455-8.
  • 16.
    Majidpour M, Saravani R, Sargazi S, Sargazi S, Harati-Sadegh M, Khorrami S, et al. A Study on Associations of Long Noncoding RNA HOTAIR Polymorphisms With Genetic Susceptibility to Chronic Kidney Disease. J Clin Lab Anal. 2024;38(11-12). e25086. [PubMed ID: 38958113]. [PubMed Central ID: PMC11252834]. https://doi.org/10.1002/jcla.25086.
  • 17.
    Musafer KNJ, Rava M, Chobok AS, Shamsuddin S, Al-Mousawi MRR, Hayup F. A meta-analysis and review on genetic mapping of type 2 diabetes mellitus in Iraq. Egypt J Med Hum Genet. 2023;24(1):66. https://doi.org/10.1186/s43042-023-00448-4.
  • 18.
    Zhou B, Li C, Qi W, Zhang Y, Zhang F, Wu JX, et al. Downregulation of miR-181a upregulates sirtuin-1 (SIRT1) and improves hepatic insulin sensitivity. Diabetologia. 2012;55(7):2032-43. https://doi.org/10.1007/s00125-012-2539-8.
  • 19.
    Li Y, Zhao W, Shi R, Jia J, Li X, Cheng J. Rs4759314 polymorphism located in HOTAIR is associated with the risk of congenital heart disease by alternating downstream signaling via reducing its expression. J Cell Biochem. 2018;119(10):8112-22. [PubMed ID: 29932240]. https://doi.org/10.1002/jcb.26736.
  • 20.
    Bradley JR. TNF-mediated inflammatory disease. J Pathol. 2008;214(2):149-60. [PubMed ID: 18161752]. https://doi.org/10.1002/path.2287.
  • 21.
    Szabo CE, Man OI, Istrate A, Kiss E, Catana A, Cret V, et al. Role of Adiponectin and Tumor Necrosis Factor-Alpha in the Pathogenesis and Evolution of Type 1 Diabetes Mellitus in Children and Adolescents. Diagnostics (Basel). 2020;10(11). [PubMed ID: 33202729]. [PubMed Central ID: PMC7697906]. https://doi.org/10.3390/diagnostics10110945.
  • 22.
    Liu SX, Zheng F, Xie KL, Xie MR, Jiang LJ, Cai Y. Exercise Reduces Insulin Resistance in Type 2 Diabetes Mellitus via Mediating the lncRNA MALAT1/MicroRNA-382-3p/Resistin Axis. Mol Ther Nucleic Acids. 2019;18:34-44. [PubMed ID: 31479923]. [PubMed Central ID: PMC6726922]. https://doi.org/10.1016/j.omtn.2019.08.002.
  • 23.
    Gao L, Wang X, Guo S, Xiao L, Liang C, Wang Z, et al. LncRNA HOTAIR functions as a competing endogenous RNA to upregulate SIRT1 by sponging miR-34a in diabetic cardiomyopathy. J Cell Physiol. 2019;234(4):4944-58. [PubMed ID: 30216438]. https://doi.org/10.1002/jcp.27296.
  • 24.
    Qi K, Zhong J. LncRNA HOTAIR improves diabetic cardiomyopathy by increasing viability of cardiomyocytes through activation of the PI3K/Akt pathway. Exp Ther Med. 2018;16(6):4817-23. https://doi.org/10.3892/etm.2018.6755.
  • 25.
    Majumder S, Hadden MJ, Thieme K, Batchu SN, Niveditha D, Chowdhury S, et al. Dysregulated expression but redundant function of the long non-coding RNA HOTAIR in diabetic kidney disease. Diabetologia. 2019;62(11):2129-42. [PubMed ID: 31399844]. https://doi.org/10.1007/s00125-019-4967-1.
  • 26.
    Biswas S, Feng B, Chen S, Liu J, Aref-Eshghi E, Gonder J, et al. The Long Non-Coding RNA HOTAIR Is a Critical Epigenetic Mediator of Angiogenesis in Diabetic Retinopathy. Invest Ophthalmol Vis Sci. 2021;62(3):20. [PubMed ID: 33724292]. [PubMed Central ID: PMC7980040]. https://doi.org/10.1167/iovs.62.3.20.
  • 27.
    Dieter C, Lemos NE, Correa NRF, Assmann TS, Crispim D. The Impact of lncRNAs in Diabetes Mellitus: A Systematic Review and In Silico Analyses. Front Endocrinol (Lausanne). 2021;12:602597. [PubMed ID: 33815273]. [PubMed Central ID: PMC8018579]. https://doi.org/10.3389/fendo.2021.602597.
  • 28.
    Wang C, Li Y, Li YW, Zhang HB, Gong H, Yuan Y, et al. HOTAIR lncRNA SNPs rs920778 and rs1899663 are associated with smoking, male gender, and squamous cell carcinoma in a Chinese lung cancer population. Acta Pharmacol Sin. 2018;39(11):1797-803. [PubMed ID: 30154526]. [PubMed Central ID: PMC6289398]. https://doi.org/10.1038/s41401-018-0083-x.
  • 29.
    Bayram S, Ulger Y, Sumbul AT, Kaya BY, Rencuzogullari A, Genc A, et al. A functional HOTAIR rs920778 polymorphism does not contributes to gastric cancer in a Turkish population: a case-control study. Fam Cancer. 2015;14(4):561-7. [PubMed ID: 25980897]. https://doi.org/10.1007/s10689-015-9813-0.
  • 30.
    Chuang CC, Wang K, Yang YS, Kornelius E, Tang CH, Lee CY, et al. Association of Long Noncoding RNA HOTAIR Polymorphism and the Clinical Manifestations of Diabetic Retinopathy. Int J Environ Res Public Health. 2022;19(21). [PubMed ID: 36361470]. [PubMed Central ID: PMC9658836]. https://doi.org/10.3390/ijerph192114592.
  • 31.
    Sargazi S, Ravanbakhsh M, Nia MH, Mirinejad S, Sheervalilou R, Majidpour M, et al. Association of Polymorphisms within HOX Transcript Antisense RNA (HOTAIR) with Type 2 Diabetes Mellitus and Laboratory Characteristics: A Preliminary Case-Control Study. Dis Markers. 2022;2022:4327342. [PubMed ID: 35359879]. [PubMed Central ID: PMC8964191]. https://doi.org/10.1155/2022/4327342.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles