Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Extraction, Cloning and Bioinformatics Analysis of Mycoplasma genitalium MG428 Protein

Author(s):
Qian ZhouQian Zhou1,*
1Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College, Nanjing, China

Jundishapur Journal of Microbiology:Vol. 15, issue 2; e121644
Published online:Mar 15, 2022
Article type:Research Article
Received:Dec 08, 2021
Accepted:Mar 07, 2022
How to Cite:Zhou Q. Extraction, Cloning and Bioinformatics Analysis of Mycoplasma genitalium MG428 Protein. Jundishapur J Microbiol. 2022;15(2):e121644. doi: https://doi.org/10.5812/jjm.121644

Abstract

Background:

Mycoplasma genitalium is a sexually transmitted human pathogen, causing numerous reproductive tract diseases in both genders. MG428 is a positive regulator of surface exposure protein gene recombination and an alternative sigma factor of M. genitalium.

Objectives:

We extracted and cloned the MG428 gene and bioinformatics analyzed its protein structure in this study.

Methods:

We designed specific primers based on the MG428 gene sequence of M. genitalium. The MG428 gene was amplified using PCR techniques and ligated into the pGEM-T easy vector. The positive clones were verified by DNA sequencing. The MG428 protein biological characteristics and structure was analysed by biological characteristics.

Results:

The MG428 gene of M. genitalium has a length of 513 bp and encodes 171 amino acids. No coiled-coil conformation, possible transmembrane helices, or signal peptide was found in the MG428 protein. The MG428 protein was located in the nucleoid of bacteria, and its 3D structure was similar to that of the sigma-H factor of Pseudomonas aeruginosa. A total of 14 B cell epitopes in MG428 were predicted.

Conclusions:

We successfully cloned the MG428 protein of M. genitalium and predicted its structure and function. The results of this study could provide a research direction for medicine screening against M. genitalium.

1. Background

Mycoplasma genitalium is a sexually transmitted human pathogen, causing numerous reproductive tract diseases in both genders, including urethritis, cervicitis, and adverse pregnancy outcomes (1). Mycoplasma genitalium infection has become a serious public health issue. A meta-analysis indicated that the prevalence in developed and developing countries was 1.3% and 3.9% respectively (2). In China, the infection rate of M. genitalium in the genitourinary tract was 0.94% of the healthy population and 11.58% among patients from sexually transmitted disease (STD) clinics or hospitals (3). Mycoplasma genitalium uses terminal organelles to adhere, move and participate in cell division. After M. genitalium adheres to host epithelial cells, the innate immune sensors, which are highly expressed in the host, bind to M. genitalium and its lipoproteins, leading to the activation of NF-κB and the production of chemokines, and eventually recruiting leukocytes to the infection site (4).
Surface exposure proteins (MgpB and MgpC) at the top of organelles mediate adhesion to eukaryotic cells (5). The immune escape and persistent infection of M. genitalium are linked to the mutation and recombination of MgpBC. Burgos and Totten (6) concluded that MG428 has positive regulation on the recombination of MgpB and MgpC and an alternative sigma factor. MG428 coordinates the expression of recA, ruvA, ruvB and other proteins involved in recombination. Through a pig-tailed macaque model, academics have discovered that mutations in MgpBC/MgPar are linked with immune escape and persistent infection of M. genitalium (7).

2. Objectives

We extracted, cloned, and bioinformatically analyzed the MG428 protein in this study. We subsequently calculated its structure and function using bioinformatics tools to provide a research direction for drug screening against M. genitalium.

3. Methods

3.1. Bacterial Strains and Plasmids

Mycoplasma genitalium G37 (ATCC33530) was procured from the American Type Culture Collection (Manassas, Virginia). The clone vector pGEM-T easy vector and Escherichia coli DH5α were purchased from Vazyme Biotech (China).

3.2. Extraction of MG Genomic DNA

Lyophilized powder (0.05 g) of M. genitalium G37 standard strain (ATCC33530) was weighed and dissolved in 1ml distilled water to prepare the M. genitalium bacterial solution. It was then divided into two tubes on average. A QIAamp DNA minikit (Qiagen, Germany) extracted M. genitalium genomic DNA. Nucleic acids were labeled and stored at -20°C until use.

3.3. Amplification of MG428 Gene

The PCR mixture consisted of 10 μL 2 × GoldStar Best MasterMix, 2 μL primers MG428-F (5'- CCAAGTAGCTCATGAAAAATAATATTAGTG -3') and MG428-R (5'- TTAATATCCATATCTTTCTGTTAGCAATTT -3'), 1 μL DNA sample and 7 μL ddH2O. PCR was conducted in a Gene Amp PCR system 9700 in the following conditions: 94°C 5 min; 94°C 30 s, 8°C 30 s, 72°C 1 min, 32 cycles; and 72°C 5 min. DNA samples were obtained after agarose gel electrophoresis and gel extraction. The amplified DNA was ligated to the pGEM-T easy vector. Escherichia coli DH5α was used to propagate plasmids. Escherichia coli cells were cultured in a Luria-Bertani solid medium containing ampicillin at 37°C. The positive clones were subsequently chosen for sequencing.

3.4. Bioinformatics Analysis

We used Clustal Omega (8) to compare the MG428 protein of Mycoplasma pneumoniae (ATCC 29342), and Sigma factor-like protein of Acholeplasma sp. (CAG:878), Mycoplasma gallisepticum (strain R (low/passage 15/clone 2)) and Clostridium leptum (CAG:27). We then utilized Protparamand ProtScale to predict the physical and chemical properties of the MG428 protein (9). We used SignalP 5.0 to predict the signal peptide of MG428 (10), and we used the Sopma (11) and COILS (12) programs to analyze the secondary structure of the MG428 protein. The subcellular location of the MG428 protein was predicted by the PSORT tool, and the 3D structure of the MG428 protein was predicted by SWISS-MODEL (13, 14). ABCpred servers were used for the B cell epitope forecast of MG428 protein (15).

4. Results

4.1. Extraction and Cloning of the MG428 Gene

We obtained 513 bp DNA fragments by PCR and electrophoresis. The target fragment was ligated with the pGEM-T easy vector and further verified by PCR. The positive clones identified by PCR were sequenced and compared with the MG428 gene sequence in NCBI GenBank (Accession No. NC_000908.2) (16). The final results were presented as identical sequences of the genes, proving the successful cloning of the MG428 gene.

4.2. Multiple Sequence Alignment Between MG428 Protein and Other Organisms

We used Clustal Omega to compare the MG428 protein with other organisms. By using the basic local alignment search tool (BLAST) in UniProt, we found that the homology between the MG428 protein of genitalium and M. pneumoniae was approximately 67.4% (Figure 1A). The sequence homology between the MG428 and Sigma factor-like protein of M. gallisepticum was 30.5%, indicating that MG428 may have a similar function to the Sigma factor (Table 1).
A, Multiple sequence alignment between MG428 protein and other organism (* a single, fully conserved residue, possible active center of the protein. Two dots mean strongly similar properties between groups. One dot means weakly similar properties between groups); B, The hydrophobicity and hydrophilicity of the amino acid sequence of MG428. Score greater than 0 indicate hydrophobic amino acids whereas less than 0 indicate hydrophilic amino acids; C, The signal peptide of MG428 protein; D, The secondary structure of MG428 protein, h: α-helix, e: extended strand, t: β-turn, c: random coil; E, Prediction of coiled coil regions in MG428 proteins; F, Tertiary structure of MG428 protein, which was similar with the RNA polymerase sigma-H factor of <i>Pseudomonas aeruginosa</i>.
Figure 1.

A, Multiple sequence alignment between MG428 protein and other organism (* a single, fully conserved residue, possible active center of the protein. Two dots mean strongly similar properties between groups. One dot means weakly similar properties between groups); B, The hydrophobicity and hydrophilicity of the amino acid sequence of MG428. Score greater than 0 indicate hydrophobic amino acids whereas less than 0 indicate hydrophilic amino acids; C, The signal peptide of MG428 protein; D, The secondary structure of MG428 protein, h: α-helix, e: extended strand, t: β-turn, c: random coil; E, Prediction of coiled coil regions in MG428 proteins; F, Tertiary structure of MG428 protein, which was similar with the RNA polymerase sigma-H factor of Pseudomonas aeruginosa.

Table 1.BLAST Results of MG428 Protein Sequence Homology Alignment
Accession IDProtein NamesOrganismIdentity (%)
AAC72449Uncharacterized protein MG428Mycoplasma genitalium100
AAB95864Sigma-70 family RNA polymerase sigma factorMycoplasma pneumoniae67.4
AAP56431Sigma factor-like proteinMycoplasma gallisepticum30.5
CCY28672RNA polymerase sigma factor SigSAcholeplasma sp. 29.8
CDC05912RNA polymerase sigma factor SigSClostridium leptum26.8

4.3. The Properties and Secondary Structure of MG428 Protein

Through the calculation of the Protparam server, we noticed that the MG428 gene of MG encodes 171 amino acids. The MG428 molecular weight, theoretical isoelectric point, and instability coefficient were 20.3 kDa, 9.72, and 36.27, respectively. The results indicated that MG428 protein remained stable under normal conditions. We used the ProtScale to predict the hydrophobicity and hydrophilicity of the amino acid sequence of MG428 (Figure 1B). The highest value was 1.544, which was Ala at position 14, representing the strongest hydrophobicity. Conversely, the lowest value was -3.156, which was Asp at position 122, representing the strongest hydrophilicity. The MG428 Grand average of hydropathicity (GRAVY) was -0.521. The hydrophilic amino acid residues of the whole peptide chain outnumbered the hydrophobic amino acid residues, indicating that it was a hydrophilic protein. The results of SignalP 5.0 which was used to predict the signal peptide showed that the probability of a signal peptide between 1 - 70 amino acids tended towards 0 (Figure 1C), which meant that MG428 was not a secretory protein.
In the prediction of MG428 secondary structure, the predicted results of the Sopma tool showed that the MG428 protein contained 64.33% α-helix, 5.26% extended strand, 6.43% β-turn and 23.98% random coil (Figure 1D). We used the COILS and TMpred programs to calculate the probability of coiled-coil conformation and possible transmembrane helices. The results demonstrated that MG428 protein is devoid of these two structures (Figure 1E). PSORT predicted that the MG428 protein was located in the bacterial nucleoid.

4.4. The 3D Structure Analysis of MG428 Protein

The SWISS-MODEL tool was used to simulate the 3D structure of the MG428 protein (Figure 1F). We used the template of 6in7.1.B, which was the RNA polymerase sigma-H factor of Pseudomonas aeruginosa (17). The GMQE was 0.47 (GMQE between 0 and 1 proves the credibility of the result), and the QMEAN was -1.43 (QMEAN range from -4 – 0; the closer to 0, the matching degree between the tested protein and the template protein (18, 19)). The structural similarity between the MG428 protein and the RNA polymerase sigma-H factor indicates functional similarity.

4.5. Prediction of Immunogenicity of MG428 Protein

The ABCpred software was used to predict the B cell epitopes of the MG428 protein. The scores of 14 sequences exceeded 0.51, indicating that these epitopes can stimulate the humoral immune response. A total of 14 peptides were predicted to exceed the threshold value indicating that the MG428 protein had good immunogenicity (Table 2). Nogueira et al. also used bioinformatics methods such as reverse vaccinology to predict putative vaccine candidates (20).
Table 2.Prediction of B Cell Epitopes of MG428 Protein (Threshold: 0.51)
RankSequenceStart PositionScore
1AAKIYWKSWRFLELTE140.93
2HAEQDSKKRFNPEFGL380.88
2FKEIITKAFNKAKNDQ1080.88
3RFNPEFGLSFDNYLKL460.84
4NGANFIRSSFRSMVNK620.82
5YVKGYKNFEIAKKLNI1310.8
6PENYLRSLEFKEIITK990.79
7KKLNISPRRVRYLLDL1420.74
8KSKYSLEKQNTVLNTP840.71
9VELLDSKSKYSLEKQN780.7
10DQERKVFSLYVKGYKN1220.67
11QNTVLNTPENYLRSLE920.64
12RRVRYLLDLFKSYIKL1490.6
13KAFNKAKNDQERKVFS1140.56
14KSWRFLELTEDDIISI200.53

5. Discussion

In previous studies, M. genitalium was thought to be unable to control gene expression. In other organisms, it has been found that the sigma factor regulates gene expression by binding RNA polymerase to the promoter sequence of the gene targeted by the sigma factor under external stimulation (21). In 2014, Burgos and Totten revealed that MG428 is an alternative sigma factor from the perspective of function (6), as MG428 coordinates the expression of recA, ruvA, ruvB and other novel proteins required for recombination. However, the protein structure of MG428 has not been subjected to any academic attention.
Our research showed that the MG428 gene of MG has a length of 513 bp and encodes 171 amino acids. The MG428 protein has homology with the Sigma factor-like protein of Acholeplasma sp., M. gallisepticum and C. leptum. High homology protein was also found in M. pneumoniae. This finding suggests that the MG428 protein may play the same role in gene regulation as the sigma factor-like protein. We also predicted the three-dimensional structure of MG428 and found that it possesses a similar structure to the sigma-H factor of P. aeruginosa. Moreover, we predicted the B cell epitopes of the MG428 protein, which is essential in designing important to design vaccines and drugs (22). In the next study, a functional experiment of the MG428 protein will identify whether the protein affects the adhesion of M. genitalium in host epithelial cells. According to the structure and B cell epitope predicted in this study, effective drug design and vaccine development for M. genitalium can be executed.

5.1. Conclusions

We successfully cloned the MG428 protein of M. genitalium and predicted its structure and function. The results of this study could provide a research direction for medicine screening against M. genitalium.

Footnotes

References

  • 1.
    Lis R, Rowhani-Rahbar A, Manhart LE. Mycoplasma genitalium infection and female reproductive tract disease: a meta-analysis. Clin Infect Dis. 2015;61(3):418-26. [PubMed ID: 25900174]. https://doi.org/10.1093/cid/civ312.
  • 2.
    Baumann L, Cina M, Egli-Gany D, Goutaki M, Halbeisen FS, Lohrer GR, et al. Prevalence of Mycoplasma genitalium in different population groups: systematic review andmeta-analysis. Sex Transm Infect. 2018;94(4):255-62. [PubMed ID: 29440466]. [PubMed Central ID: PMC5969327]. https://doi.org/10.1136/sextrans-2017-053384.
  • 3.
    Xuan Y, Wei LX, Hong X, Zhu XY, Dong SH, Yan QY, et al. [A Meta-analysis on the infection rates on Mycoplasma genitalium in the genitourinary tract of different populations in China]. Zhonghua Liu Xing Bing Xue Za Zhi. 2021;42(2):335-42. Chinese. [PubMed ID: 33626625]. https://doi.org/10.3760/cma.j.cn112338-20200530-00791.
  • 4.
    Dehon PM, McGowin CL. Mycoplasma genitalium infection is associated with microscopic signs of cervical inflammation in liquid cytology specimens. J Clin Microbiol. 2014;52(7):2398-405. [PubMed ID: 24759719]. [PubMed Central ID: PMC4097708]. https://doi.org/10.1128/JCM.00159-14.
  • 5.
    Garcia-Morales L, Gonzalez-Gonzalez L, Querol E, Pinol J. A minimized motile machinery for Mycoplasma genitalium. Mol Microbiol. 2016;100(1):125-38. [PubMed ID: 26712501]. https://doi.org/10.1111/mmi.13305.
  • 6.
    Burgos R, Totten PA. MG428 is a novel positive regulator of recombination that triggers mgpB and mgpC gene variation in Mycoplasma genitalium. Mol Microbiol. 2014;94(2):290-306. [PubMed ID: 25138908]. [PubMed Central ID: PMC4203379]. https://doi.org/10.1111/mmi.12760.
  • 7.
    Wood GE, Iverson-Cabral SL, Patton DL, Cummings PK, Cosgrove Sweeney YT, Totten PA. Persistence, immune response, and antigenic variation of Mycoplasma genitalium in an experimentally infected pig-tailed macaque (Macaca nemestrina). Infect Immun. 2013;81(8):2938-51. [PubMed ID: 23732170]. [PubMed Central ID: PMC3719596]. https://doi.org/10.1128/IAI.01322-12.
  • 8.
    Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019;47(W1):W636-41. [PubMed ID: 30976793]. [PubMed Central ID: PMC6602479]. https://doi.org/10.1093/nar/gkz268.
  • 9.
    Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, et al. Protein identification and analysis tools in the ExPASy server. Methods Mol Biol. 1999;112:531-52. [PubMed ID: 10027275]. https://doi.org/10.1385/1-59259-584-7:531.
  • 10.
    Almagro Armenteros JJ, Tsirigos KD, Sonderby CK, Petersen TN, Winther O, Brunak S, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019;37(4):420-3. [PubMed ID: 30778233]. https://doi.org/10.1038/s41587-019-0036-z.
  • 11.
    Geourjon C, Deleage G. SOPMA: significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Comput Appl Biosci. 1995;11(6):681-4. [PubMed ID: 8808585]. https://doi.org/10.1093/bioinformatics/11.6.681.
  • 12.
    Lupas A, Van Dyke M, Stock J. Predicting coiled coils from protein sequences. Science. 1991;252(5009):1162-4. [PubMed ID: 2031185]. https://doi.org/10.1126/science.252.5009.1162.
  • 13.
    Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, et al. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018;46(W1):W296-303. [PubMed ID: 29788355]. [PubMed Central ID: PMC6030848]. https://doi.org/10.1093/nar/gky427.
  • 14.
    Bienert S, Waterhouse A, de Beer TA, Tauriello G, Studer G, Bordoli L, et al. The SWISS-MODEL Repository-new features and functionality. Nucleic Acids Res. 2017;45(D1):D313-9. [PubMed ID: 27899672]. [PubMed Central ID: PMC5210589]. https://doi.org/10.1093/nar/gkw1132.
  • 15.
    Saha S, Raghava GP. Prediction of continuous B-cell epitopes in an antigen using recurrent neural network. Proteins. 2006;65(1):40-8. [PubMed ID: 16894596]. https://doi.org/10.1002/prot.21078.
  • 16.
    Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, et al. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A. 2006;103(2):425-30. [PubMed ID: 16407165]. [PubMed Central ID: PMC1324956]. https://doi.org/10.1073/pnas.0510013103.
  • 17.
    Li S, Lou X, Xu Y, Teng X, Liu R, Zhang Q, et al. Structural basis for the recognition of MucA by MucB and AlgU in Pseudomonas aeruginosa. FEBS J. 2019;286(24):4982-94. [PubMed ID: 31297938]. https://doi.org/10.1111/febs.14995.
  • 18.
    Studer G, Rempfer C, Waterhouse AM, Gumienny R, Haas J, Schwede T. QMEANDisCo-distance constraints applied on model quality estimation. Bioinformatics. 2020;36(6):1765-71. [PubMed ID: 31697312]. [PubMed Central ID: PMC7075525]. https://doi.org/10.1093/bioinformatics/btz828.
  • 19.
    Benkert P, Biasini M, Schwede T. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics. 2011;27(3):343-50. [PubMed ID: 21134891]. [PubMed Central ID: PMC3031035]. https://doi.org/10.1093/bioinformatics/btq662.
  • 20.
    Nogueira WG, Jaiswal AK, Tiwari S, Ramos RTJ, Ghosh P, Barh D, et al. Computational identification of putative common genomic drug and vaccine targets in Mycoplasma genitalium. Genomics. 2021;113(4):2730-43. [PubMed ID: 34118385]. https://doi.org/10.1016/j.ygeno.2021.06.011.
  • 21.
    Torres-Puig S, Broto A, Querol E, Pinol J, Pich OQ. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium. Nucleic Acids Res. 2015;43(10):4923-36. [PubMed ID: 25925568]. [PubMed Central ID: PMC4446450]. https://doi.org/10.1093/nar/gkv422.
  • 22.
    Duan H, Li X, Mei A, Li P, Liu Y, Li X, et al. The diagnostic value of metagenomic next rectanglegeneration sequencing in infectious diseases. BMC Infect Dis. 2021;21(1):62. [PubMed ID: 33435894]. [PubMed Central ID: PMC7805029]. https://doi.org/10.1186/s12879-020-05746-5.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.