Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Common Colonization Genes Profiling and BOX-PCR Based Genotyping of Streptococcus agalactiae from Pregnant Women in Tehran, Iran

Author(s):
Hanieh BanaeiHanieh BanaeiHanieh Banaei ORCID1, Akram Sadat Tabatabaee BafroeeAkram Sadat Tabatabaee BafroeeAkram Sadat Tabatabaee Bafroee ORCID1,*, Kumarss AminiKumarss AminiKumarss Amini ORCID2
1Department of Biology, East Tehran Branch, Islamic Azad University, Tehran, Iran
2Department of Microbiology, Faculty of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran
*Corresponding Author: Department of Biology, East Tehran Branch, Islamic Azad University, Tehran, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 15, issue 2; e122008
Published online:Apr 12, 2022
Article type:Research Article
Received:Dec 20, 2021
Accepted:Mar 07, 2022
How to Cite:Banaei H, Tabatabaee Bafroee AS, Amini K. Common Colonization Genes Profiling and BOX-PCR Based Genotyping of Streptococcus agalactiae from Pregnant Women in Tehran, Iran. Jundishapur J Microbiol. 2022;15(2):e122008. doi: https://doi.org/10.5812/jjm-122008

Abstract

Background:

Streptococcus agalactiae or group B Streptococcus (GBS) is a prominent cause of severe neonatal infections. Group B Streptococcus is a part of the intestinal and vaginal normal flora. Maternal colonization is recognized as the main path of GBS transmission. Group B Streptococcus is a pathobiont that changes from a non-symptomatic mucosal carriage state to a significant bacterial pathogen, causing major infections.

Objectives:

This study aimed to investigate the concomitant presence of major colonization genes, including ftsA, ftsB, lmb, and sfbA, and to determine the genetic relatedness of clinical GBS isolates.

Methods:

The GBS isolates were obtained from urinary and placental samples of pregnant women with a urinary tract infection, who were admitted to a hospital in Tehran, Iran. The presence of some major colonization factors was investigated via multiplex PCR assay. Genotyping of the isolates was performed using the BOX-PCR fingerprint technique with a BOX-A1R primer. Next, the data were analyzed using the UPGMA method and the coefficient of Jaccard in NTSYS software.

Results:

A total of 60 GBS isolates were examined in this study. The concomitant presence of target colonization genes was observed in all isolates. The BOX-PCR discriminated GBS isolates into six different genetic clusters at a 60% cutoff point. The majority of isolates (80%) from both clinical samples were clustered into genotypes 2, 6, and 4, while the rest (20%) were distributed equally into three different genotypes.

Conclusions:

Determining the colonization associated genes and genetic polymorphism in a different geographical area provides the epidemiological basis for the prevention of GBS infections in pregnant women and infants.

1. Background

Streptococcus agalactiae or group B Streptococcus (GBS) is serologically distinguished from other species in the genus Streptococcus. It is an encapsulated, facultative anaerobic, nutritionally fastidious diplococcus, with ß-hemolytic activity on blood agar plates. The unique characteristics of GBS include hydrolysis of sodium hippurate, resistance to bacitracin, positive results on the CAMP co-hemolytic test. In pregnant women, GBS causes bacteriuria and chorioamnionitis. It can also cause pneumonia, meningitis, endocarditis, sepsis, and bacteremia in infants. Infections sometimes begin inside the uterus (1, 2). Adhesion, as the first stage of GBS colonization, is mediated by adhesion factors present on the bacterial surface, allowing for the attachment of GBS to extracellular matrix proteins and epithelial cells of the intestinal and genital tracts. Moreover, adhesion factors can increase invasion either through destruction of the epithelial cell layer or disarrangement of the epithelial cytoskeleton, which facilitates paracellular transport.
Fibrinogen-binding proteins (FbsA and FbsB) and laminin-binding protein (Lmb) are major factors in adherence to the extracellular matrix. FbsA mediates the adhesion of GBS to host cells, while FbsB promotes the invasion of GBS. The Lmb adhesion appears to play a prominent role in bacterial attachment to the extracellular matrix by facilitating GBS translocation across the intestinal epithelium and the blood-brain barrier (3). A new, recently discovered GBS fibronectin-binding protein, called streptococcal fibronectin-binding protein A (SfbA), has been shown to be highly conserved in GBS, contributing to cellular invasion rather than adherence (4). The SfbA adhesion has been reported to be directly involved in fibronectin binding and human brain microvascular endothelial cell (HBMEC) invasion. Another study exhibited the significant role of SfbA in the invasion of astrocytes, which have a physical connection with the brain endothelial cells (5). Moreover, SfbA contributes to GBS invasion of vaginal and cervical epithelial cells, possibly promoting GBS colonization and niche settlement in the vagina (4).
Considering the GBS pathogenicity and the occurrence of antibiotic resistance, various strains of this bacterium are emerging, whose frequencies differ across geographical areas. Therefore, it is important to investigate genomic polymorphisms and determine the primary colonization genes of GBS isolates in various regions to prevent the occurrence of drug resistance and high-risk infections in pregnant women and infants. Specific molecular techniques can be effective in identifying the species diversity in epidemiological studies.

2. Objectives

Regarding the scarcity of national and regional data, the current study aimed to determine the genetic relatedness of GBS isolates collected from pregnant women using the BOX-PCR fingerprint technique and to determine the presence of three central colonization-related genes (fbsA, fbsB, and lmb), as well as a novel gene (sfbA), using a multiplex PCR assay.

3. Methods

3.1. Study Design

In this descriptive cross-sectional study (January 2021- July 2021), a total of sixty pregnant women with urinary tract infections (UTIs) admitted to a hospital in Tehran, Iran, were included. The infection of all participants had been confirmed by a specialist based on demonstrating a colony count of more than 105 CFU/mL in their urine sample. After describing and clarifying the project, oral consent obtained from participants.

3.2. Bacterial Isolates and Materials

Sixty bacterial strains from urine (16 isolates) and placenta (44 isolates) samples of target participants were isolated at the microbiology laboratory of the hospital and confirmed as GBS. Then GBS isolates were further examined by gram staining, colony morphology, ß-hemolytic activity, and conventional biochemical tests such as, sodium hippurate hydrolysis, CAMP test, and resistance to bacitracin. Furthermore, GBS isolates were molecularly confirmed by amplifying the dlts gene (6). Streptococcus agalactiae ATCC 12403 and Streptococcus pyogenes ATCC 1244 were applied as positive and negative controls, respectively. All GBS isolates were grown on a 5% sheep Blood agar at 37°C under the micro-aerobic atmosphere and then inoculated in BHI broth (Brain Heart Infusion broth) containing 25% glycerol and transferred to -20°C until the time of molecular examinations. All chemical materials and culture media were prepared from Merck (Darmstadt, Germany).

3.3. Genomic DNA Extraction

Genomic DNA was extracted via a commercial Genomic DNA extraction Kit (cat No: DM05050, Gene Transfer Pioneer, Pishgaman Co, Iran) based on the manufacturer’s procedure.

3.4. Molecular Detection of Colonization-Associated Genes

The colonization associated genes; ftsA, ftsB, lmb, and sfbA were simultaneously investigated using the multiplex PCR technique. The primers used for current search were extracted from related articles (4, 7) (Table 1) and their validity was checked using BlastN algorithm, available at NCBI. The primers were synthesized by Macrogen Inc; South Korea. A positive control, confirmed by sequencing, was considered for all target colonization genes. The multiplex PCR was performed with two μL of DNA (50 ng) in a final volume of 20 μL containing ten μL of 2X master mix with standard buffer and one μL of each four primer pairs. The cycling program was as follow: Primary denaturation at 94°C for 3 min (initial denaturation), followed by 30 cycles (30 s at 94°C, 30 s at 58°C, 60 s at 72°C) and a final extension at 72°C for 5 min, in a thermocycler (Bio-rad T100, Inc). The obtained multiplex PCR products were separated via 1.5% agarose gel (m/v) and an electrophoretic cell (at 110 V for 60 min) and subsequently, the bands were visualized by the ultraviolet (UV) transilluminator (PoteinSimple, Red imager SA-1000).
Table 1.Primers Used to Amplify Colonization-Associated Genes in Group B Streptococcus Strains
Gene CategoryFunction/AnnotationPrimer Sequence (5’-3’)aSize of Amplicon (bp)
fbsAFibrinogen-binding proteinF:TGTAGCTAATGGACCGATGTT156
R:TTTTCATTGCGTCTCAAACC
fbsBFibrinogen-binding proteinF:ACAACTGCGGAAATGACCTC186
R:ACGAGCGACGTTGAATTCTT
lmbLaminin-binding proteinF:AGTCAGCAAACCCCAAACAG397
R:GCTTCCTCACCAGCTAAAACG
sfbAFibronectin-binding proteinF: CTACTCCTATCTGCTCACCCTGTA288
R: GTTGAACCAGGAAGGATAGTACGG

3.5. BOX PCR Fingerprinting

To determine the genetic polymorphism of isolates, BOX-PCR fingerprinting using the primer BOXA1R (5′-CTACGGCAAGGCGACGCTGACG-3′) was applied (8). The 20 μL reaction mixture included ten μL of 2X master mix (Ampliqon manufacture, Danish) (containing; buffer, deoxy nucleoside triphosphate mix, and Taq DNA polymerase, and Mg+2), one μL of primer, and two μL of DNA template (50 ng). PCR condition comprised initial denaturation at 95°C for 3 min, followed by 60 cycles of denaturation at 94°C for 30 s, primer annealing at 45°C for 30 s, and extension at 72°C for 80 s, with a final extension at 72°C for 5 min. The PCR products were separated by electrophoresis using 1.5% agarose gel in a 1x TBE buffer. The ethidium bromide stain and a UV transilluminator were applied to visualize PCR products. A 100bp DNA ladder (Sinacolon Corporation, Iran) was considered as molecular weight marker.

3.6. Cluster Analysis

The banding patterns produced by BOX-PCR were analyzed via NTsys-pc version 2.02. Cluster analysis was done through an unweighted pair group method (UPGMA) and Jaccard's similarity coefficient (8). The dendrogram was cut in the similarity coefficient of 0.6, and the GBS isolates were classified.

4. Results

The demographic information of participants is shown in Table 2. The age of women was ranging from 19 to 46 years. Of the 60 women included in the study, 13 were first deliveries, 5 were second deliveries, and 42 were third deliveries. The gestational age of women was as follows; 43 women in the first trimester, 10 in the second trimester and 3 in the third trimester, three other in the fourth trimester, and 1 in the fifth trimester. Out of 60 women studied, only three who had diabetes mellitus type 2 were taking metformin and glibenclamide (hypoglycemic drugs). None of them had received antibiotics two weeks before study, and also, they did not experience previous spontaneous abortion.
Table 2.Demographic Data of Pregnant Women Admitted to the Hospital and Compilation of BOX- PCR Data for Clinical Group B Streptococcus Isolates
Patient No.AgeMonth of AbortionNumber of DeliverySource of Isolation (Urine/Placenta)BOX PCR GenotypePatient No.AgeMonth of AbortionNumber of PregnancySource of Isolation (Urine/Placenta)BOX PCR Genotype
13521U a6313312U2
23311P b6323913U2
32711P6333813P2
42911P6343813P2
51911P6354123P2
61913P6364021P2
72113P6373613P4
82643P6383313P4
92733P6393413U6
104222P6403213U6
114113U6412912P2
123913P6422813P1
133613P4432613P2
143623P5442913U6
153623P5452211P5
163513P4462113U5
173313P4471913P1
182233P4482633U4
192111P3492723P1
202741P4504543U4
212953U4514013U2
224421P3523612P2
234321P3533313P2
244621P3543113P2
251913P2553012P2
262013P2562911P2
272213P2572813P2
282413U1583213U2
292613U2593713P2
302913U2603913P2

a Urine.

b Placenta.

4.1. Distributional Characteristics of Colonization-Associated Genes

The BLAST search for sequences of each understudied colonization gene against sequences in the nucleotide database revealed that they belong to genus group B Streptococcus and showed maximum identity with S. agalactiae strain FDAARGOS 670. Based on results obtained from multiplex PCR and related primers, all isolates contained four target colonization genes, fbsA, fbsB, lmb, and sfbA, simultaneously.

4.2. BOX Fingerprinting of Clinical GBS Isolates

BOX-PCR fingerprinting using the BOXA1R primer produced 4 to 11 bands ranging from 300 - 3000 bp (Figure 1A- E). Most of the isolates were in common in four bands per pattern. The most specific PCR products of understudied GBS isolates were as follows: 300, 400, 700, and 1000 bp. According to the dendrogram, all clinical GBS isolates were divided into 6 clusters at 60% level as follow; three dominant genotypes including 10 to 23 isolates and three other distinctive patterns. (Figure 2)
A - E, agarose gel electrophoresis of BOX-PCR fingerprinting patterns from genomic DNA of 60 various clinical isolates of <i>Streptococcus agalactiae</i> (GBS) from pregnant women. The molecular size marker is a 100 bp ladder (SinaClon Co., Iran) and the sizes are indicated in base pairs.
Figure 1.

A - E, agarose gel electrophoresis of BOX-PCR fingerprinting patterns from genomic DNA of 60 various clinical isolates of Streptococcus agalactiae (GBS) from pregnant women. The molecular size marker is a 100 bp ladder (SinaClon Co., Iran) and the sizes are indicated in base pairs.

Dendrogram obtained by comparing BOX-PCR fingerprinting patterns (cutoff 60%) of 60 clinical group B <i>Streptococcus</i> isolates from pregnant women (UPGMA analysis, Jaccard coefficient). 60 group B <i>Streptococcus</i> isolates containing all studied colonization genes (<i>fbs</i>A, <i>fbs</i>B, <i>lmb</i>, and <i>sfb</i>A) were distinguished into 6 groups by using BOXA1R primer.
Figure 2.

Dendrogram obtained by comparing BOX-PCR fingerprinting patterns (cutoff 60%) of 60 clinical group B Streptococcus isolates from pregnant women (UPGMA analysis, Jaccard coefficient). 60 group B Streptococcus isolates containing all studied colonization genes (fbsA, fbsB, lmb, and sfbA) were distinguished into 6 groups by using BOXA1R primer.

5. Discussion

GBS is known as a part of the intestinal and vaginal microbiota in 15 - 30% of healthy women; nonetheless, it has an extreme capacity to cause invasive infections. This bacterium is a significant cause of infections in infants, pregnant women, and adults with underlying diseases. This pathobiont, which grows in healthy individuals, has maintained its potential virulence during coevolution with humans. It is well established that this bacterium is one of the most life-threatening pathogens in neonates and the elderly. Moreover, it has been reported that one in every 10 newborn infants acquires GBS vertically while passing through the birth canal or soon afterward (1, 2, 9, 10). In 1996, the Centers for Disease Control and Prevention (CDC) issued guidelines for the prevention of GBS before delivery, recommending screening for GBS colonization in prenatal women. Although previous studies reported that up to 50% of infants with GBS are born to carriers without clinical risk factors, the CDC guidelines were revised in 2002, and bacteriological screening became mandatory for all pregnant women at 35 - 37 weeks of gestation. Therefore, for improving public health, it is important to quickly identify and differentiate GBS strains (11).
The GBS adherence and colonization, as complex multifactorial functions, guarantee the maintenance of this pathobiont in human ecosystems. Over the last two decades, molecular adherence mechanisms have been further studied in GBS, leading to a significant increase in our understanding of disease progression. The GBS adhesion factors may present new targets for the emergence of novel treatments and preventive actions to control and prevent invasive GBS infections in newborns and adult patients, as the frequency of vaginal-rectal colonization of GBS changes significantly across geographical regions, even in a single country. Data regarding the source of infection and relatedness of isolates can be beneficial for preventive strategies and selection of the best treatment (12). In the current study, besides assessing the concomitant presence of central colonization genes through multiplex PCR assay, the amenability of BOX-PCR fingerprint technique was investigated to differentiate GBS isolates collected from urinary and placental samples of pregnant women, referred to one of the hospitals of Tehran, Iran.
Significant adhesions that mediate the colonization of GBS on host cells, including fibrinogen-binding proteins (Fbs A and B), laminin-binding protein (Lmb), and a recently identified fibronectin-binding protein (SfbA), were concomitantly studied in the GBS isolates using the multiplex PCR assay. The results revealed that all GBS isolates harbored the studied colonization genes. Therefore, colonization-related genes showed a similar distribution among isolates originating from two different types of clinical samples (urine and placenta). The positive rates of colonization genes, including fbsA and fbsB, were identical to those reported in previous studies, except for lmb; this result is consistent with the finding that most human isolates contain fbsA and fbsB genes (7, 13, 14). Additionally, previous studies have indicated the concomitant harboring of three or more than three colonization-related genes in the GBS isolates (15, 16). However, the distribution rate of genes for surface-localized proteins, such as fbsA and fbsB, was different, while lmb was found in all the isolates. Discrepancies in the distribution and abundance of colonization-related genes are probably related to regional differences; therefore, identification and survey of dominant colonization-associated genes in different geographical regions are suggested as an appropriate tool to design efficient vaccines for the prevention of GBS infections in pregnant women (17).
The sfbA gene was also harbored by all isolates in the current study. Similar studies have earlier reported that sfbA gene is present in GBS and highly conserved (4, 18). The present study is the first report of sfbA gene identification among GBS isolates collected from pregnant women in Iran. The BOX primer sequence was used in a PCR assay to determine differences in the number and distribution of this bacterial repeat sequence in the genomes of clinical GBS isolates. Although among different molecular techniques for typing bacterial strains, pulse-field gel electrophoresis (PFGE) is known as the superior technique for bacteria, it is both labor-intensive and costly (19). In contrast to PFGE, BOX-PCR is known as the most commonly applied method in biogeographic studies of bacterial isolates. Researchers have demonstrated that this technique is rapid, vastly discriminative, and reproducible (8). Therefore, BOX-PCR was identified as a selective typing method for GBS isolates in this study.
According to the current findings, the most frequent genotypes were genotypes 2, 4, and 6 found in 23 (38.33%), 10 (16.66%), and 15 (25%) isolates, respectively. The subsequent genotypes, including genotypes 1, 3, and 5, were each found in 4 (6.66%) isolates. The isolation source in most GBS isolates (73.33%) was the placenta of patients, while the remaining isolates (26.66%) were obtained from the urinary samples. Except for genotype 3, other genotypes were found in isolates from both samples; this finding revealed that isolates from the placental and urinary samples were highly heterogeneous.
To the best of our knowledge, there are no publications in Iran or other countries on the molecular typing of GBS using BOX-PCR. Nevertheless, genotyping of GBS using other fingerprint techniques has been reported (20, 21). Also, the effectiveness of BOX-PCR in determining genetic relatedness has been investigated for other bacterial species. For instance, the eligibility and reproducibility of BOX-PCR and ERIC-PCR were used as molecular typing tools for the genetic discrimination of Enterococcus faecalis.
Besides, other researchers have reported the potential of BOX-PCR to differentiate Proteus mirabilis strains from clinical Pseudomonas aeruginosa isolates (22-25). In other studies from other countries, BOX-PCR and ERIC-PCR were introduced as powerful surveillance techniques for studying the genetic relatedness of Leptospira, Fusarium oxysporum, and Salmonella enterica isolates from patients (8, 26, 27). Samples included in this research were collected from a hospital in Tehran, Iran during the six-month period from January to July 2021. Thus, the results of this study may not be generalized to other areas. More investigations are required on samples collected from different regions of Iran and during various seasons.

5.1. Conclusions

Based on the results of the present study, four important colonization-related genes, including fbsA, fbsB, lmb, and sfbA, were concomitantly detected in all 60 GBS isolates. The BOX-PCR fingerprint technique could discriminate GBS isolates, collected from placental and urinary samples of pregnant women, into six different groups. Since the analysis of phenotypic features does not present a classification system, this DNA fingerprint technique can be a rapid and useful tool for identifying GBS isolates.

Acknowledgments

Footnotes

  • Authors' Contribution: Kumars Amini and Akram Sadat Tabatabaee Bafroee planned and designed the research. Hanieh Banaee performed experiments. Akram Sadat Tabatabaee Bafroee analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.

  • Conflict of Interests: The authors declare that there is no conflict of interest.

  • Data Reproducibility: It was not declared by the authors.

  • Ethical Approval: This study was evaluated and approved by the Ethics Committee of East Tehran Branch, Islamic Azad University, Tehran, Iran (IR.IAU.ET.REC.1400.031).

  • Funding/Support: The authors declare that no funding or financial support has been received for the current research.

  • Informed Consent: I would like to inform you that in the current research we did not contact the patients and the confirmed plates of bacteria were received from the laboratory of the hospital.

References

  • 1.
    Matsubara K, Yamamoto G. Invasive group B streptococcal infections in a tertiary care hospital between 1998 and 2007 in Japan. Int J Infect Dis. 2009;13(6):679-84. [PubMed ID: 19131262]. https://doi.org/10.1016/j.ijid.2008.10.007.
  • 2.
    Stoll BJ, Hansen NI, Bell EF, Shankaran S, Laptook AR, Walsh MC, et al. Neonatal outcomes of extremely preterm infants from the NICHD Neonatal Research Network. Pediatrics. 2010;126(3):443-56. [PubMed ID: 20732945]. [PubMed Central ID: PMC2982806]. https://doi.org/10.1542/peds.2009-2959.
  • 3.
    Landwehr-Kenzel S, Henneke P. Interaction of Streptococcus agalactiae and cellular innate immunity in colonization and disease. Front Immunol. 2014;5:519. [PubMed ID: 25400631]. [PubMed Central ID: PMC4212683]. https://doi.org/10.3389/fimmu.2014.00519.
  • 4.
    Mu R, Kim BJ, Paco C, Del Rosario Y, Courtney HS, Doran KS. Identification of a group B streptococcal fibronectin binding protein, SfbA, that contributes to invasion of brain endothelium and development of meningitis. Infect Immun. 2014;82(6):2276-86. [PubMed ID: 24643538]. [PubMed Central ID: PMC4019170]. https://doi.org/10.1128/IAI.01559-13.
  • 5.
    Stoner TD, Weston TA, Trejo J, Doran KS. Group B streptococcal infection and activation of human astrocytes. PLoS One. 2015;10(6). e0128431. [PubMed ID: 26030618]. [PubMed Central ID: PMC4452173]. https://doi.org/10.1371/journal.pone.0128431.
  • 6.
    Takei T, Chiba N, Fujita H, Morozumi M, Kuwata Y, Kishii K, et al. Late-onset invasive group B Streptococcal infection with serotype VIII in a neonate having congenital biliary atresia. Pediatr Neonatol. 2013;54(1):63-6. [PubMed ID: 23445746]. https://doi.org/10.1016/j.pedneo.2012.11.007.
  • 7.
    Bobadilla FJ, Novosak MG, Cortese IJ, Delgado OD, Laczeski ME. Prevalence, serotypes and virulence genes of Streptococcus agalactiae isolated from pregnant women with 35-37 weeks of gestation. BMC Infect Dis. 2021;21(1):73. [PubMed ID: 33446117]. [PubMed Central ID: PMC7807883]. https://doi.org/10.1186/s12879-020-05603-5.
  • 8.
    Bilung LM, Pui CF, Su'ut L, Apun K. Evaluation of BOX-PCR and ERIC-PCR as molecular typing tools for pathogenic Leptospira. Dis Markers. 2018;2018:1351634. [PubMed ID: 30154937]. [PubMed Central ID: PMC6092967]. https://doi.org/10.1155/2018/1351634.
  • 9.
    Debes AK, Kohli A, Walker N, Edmond K, Mullany LC. Time to initiation of breastfeeding and neonatal mortality and morbidity: a systematic review. BMC Public Health. 2013;13(Suppl 3). S19. [PubMed ID: 24564770]. [PubMed Central ID: PMC3847227]. https://doi.org/10.1186/1471-2458-13-S3-S19.
  • 10.
    Skoff TH, Farley MM, Petit S, Craig AS, Schaffner W, Gershman K, et al. Increasing burden of invasive group B streptococcal disease in nonpregnant adults, 1990-2007. Clin Infect Dis. 2009;49(1):85-92. [PubMed ID: 19480572]. https://doi.org/10.1086/599369.
  • 11.
    Kannika K, Pisuttharachai D, Srisapoome P, Wongtavatchai J, Kondo H, Hirono I, et al. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. J Appl Microbiol. 2017;122(6):1497-507. [PubMed ID: 28295891]. https://doi.org/10.1111/jam.13447.
  • 12.
    Raeispour M, Ranjbar R. Antibiotic resistance, virulence factors and genotyping of Uropathogenic Escherichia coli strains. Antimicrob Resist Infect Control. 2018;7:118. [PubMed ID: 30305891]. [PubMed Central ID: PMC6171155]. https://doi.org/10.1186/s13756-018-0411-4.
  • 13.
    Lichvarikova A, Soltys K, Szemes T, Slobodnikova L, Bukovska G, Turna J, et al. Characterization of clinical and carrier Streptococcus agalactiae and prophage contribution to the strain variability. Viruses. 2020;12(11). [PubMed ID: 33217933]. [PubMed Central ID: PMC7698700]. https://doi.org/10.3390/v12111323.
  • 14.
    Al Safadi R, Amor S, Hery-Arnaud G, Spellerberg B, Lanotte P, Mereghetti L, et al. Enhanced expression of lmb gene encoding laminin-binding protein in Streptococcus agalactiae strains harboring IS1548 in scpB-lmb intergenic region. PLoS One. 2010;5(5). e10794. [PubMed ID: 20520730]. [PubMed Central ID: PMC2875397]. https://doi.org/10.1371/journal.pone.0010794.
  • 15.
    Udo EE, Boswihi SS, Al-Sweih N. Genotypes and virulence genes in group B streptococcus isolated in the maternity hospital, Kuwait. Med Princ Pract. 2013;22(5):453-7. [PubMed ID: 23571853]. [PubMed Central ID: PMC5586775]. https://doi.org/10.1159/000349932.
  • 16.
    Rosenau A, Martins K, Amor S, Gannier F, Lanotte P, van der Mee-Marquet N, et al. Evaluation of the ability of Streptococcus agalactiae strains isolated from genital and neonatal specimens to bind to human fibrinogen and correlation with characteristics of the fbsA and fbsB genes. Infect Immun. 2007;75(3):1310-7. [PubMed ID: 17158903]. [PubMed Central ID: PMC1828567]. https://doi.org/10.1128/IAI.00996-06.
  • 17.
    Huang J, Lin XZ, Zhu Y, Chen C. Epidemiology of group B streptococcal infection in pregnant women and diseased infants in mainland China. Pediatr Neonatol. 2019;60(5):487-95. [PubMed ID: 31445795]. https://doi.org/10.1016/j.pedneo.2019.07.001.
  • 18.
    Shabayek S, Spellerberg B. Group B streptococcal colonization, molecular characteristics, and epidemiology. Front Microbiol. 2018;9:437. [PubMed ID: 29593684]. [PubMed Central ID: PMC5861770]. https://doi.org/10.3389/fmicb.2018.00437.
  • 19.
    Wolska K, Kot B, Jakubczak A, Rymuza K. BOX-PCR is an adequate tool for typing of clinical Pseudomonas aeruginosa isolates. Folia Histochem Cytobiol. 2011;49(4):734-8. [PubMed ID: 22252771]. https://doi.org/10.5603/fhc.2011.0098.
  • 20.
    Shadbad MA, Kafil HS, Rezaee MA, Farzami MR, Dehkharghani AD, Sadeghi J, et al. Streptococcus agalactiae clinical isolates in Northwest Iran: antibiotic susceptibility, molecular typing, and biofilm formation. GMS Hyg Infect Control. 2020;15:Doc23. [PubMed ID: 33214988]. [PubMed Central ID: PMC7656979]. https://doi.org/10.3205/dgkh000358.
  • 21.
    Motallebirad T, Fazeli H, Ghahiri A, Shokri D, Jalalifar S, Moghim S, et al. Prevalence, population structure, distribution of serotypes, pilus islands and resistance genes among erythromycin-resistant colonizing and invasive Streptococcus agalactiae isolates recovered from pregnant and non-pregnant women in Isfahan, Iran. BMC Microbiol. 2021;21(1):139. [PubMed ID: 33947330]. [PubMed Central ID: PMC8096152]. https://doi.org/10.1186/s12866-021-02186-2.
  • 22.
    Ahmadi F, Siasi E, Amini K. Genomic polymorphism of enterococcus faecalis isolated from clinical cases using two methods of ERIC-PCR and BOX-PCR. Med J Tabriz Univ Med Sci Health Serv. 2019;41(5):16-24. https://doi.org/10.34172/mj.2019.054.
  • 23.
    Rezvan S, Amini K. [Genetic diversity of Proteus mirabilis isolated from urine specimens PCR]. J Ilam Univ Med Sci. 2019;27(3):64-73. Persian.
  • 24.
    Rouhi S, Ramazanzadeh R, Nouri B. Genotyping, pandrug resistance, extensively drug-resistant, and multi drug-resistance detection of pseudomonas aeruginosa isolated from patients in the west of Iran. Cres J Med Biol Sci. 2019;6(2):170-7.
  • 25.
    Savari M, Rostami S, Ekrami A, Bahador A. Characterization of Toxin-Antitoxin (TA) Systems in Pseudomonas aeruginosa Clinical Isolates in Iran. Jundishapur J Microbiol. 2016;9(1). e26627. [PubMed ID: 27099681]. [PubMed Central ID: PMC4834025]. https://doi.org/10.5812/jjm.26627.
  • 26.
    Abu-Khalaf N, Rumaila BA. Electronic tongue and box-PCR for categorization of different Fusarium strains. Plant Cell Biotechnol Mol Biol. 2020;21(45-46):121-8.
  • 27.
    Poonchareon K, Pulsrikarn C, Nuanmuang N, Khamai P. Effectiveness of BOX-PCR in differentiating genetic relatedness among Salmonella enterica serotype 4,[5],12:i:- isolates from hospitalized patients and minced pork samples in Northern Thailand. Int J Microbiol. 2019;2019:5086240. [PubMed ID: 31316564]. [PubMed Central ID: PMC6604291]. https://doi.org/10.1155/2019/5086240.

Copyright

Copyright © 2022, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

15
Feb
2016

Molecular Characterization of Streptococcus agalactiae Isolates From Pregnant and Non-Pregnant Women at Yazd University Hospital, Iran

Maryam Sadeh,
Roya Firouzi,
Abdollah Derakhshandeh,
Mohammad Bagher Khalili,
Fanrong Kong,
Timothy Kudinha

Sadeh M, Firouzi R, Derakhshandeh A, Bagher Khalili M, Kong F, et al. Molecular Characterization of Streptococcus agalactiae Isolates From Pregnant and Non-Pregnant Women at Yazd University Hospital, Iran. Jundishapur J Microbiol. 2016;9(2):e30412. doi: https://doi.org/10.5812/jjm.30412

22
Sep
2025
Jundishapur J Microbiol

Frequency of Antibiotic Resistance and Virulence Factors in Streptococcus agalactiae Isolated from Vaginal and Urine Samples of Pregnant Women in Yazd, Iran: A Cross-sectional Study

Nastaran Azartoos,
Maryam Sadeh,
Mahmoud Vakili

Azartoos N, Sadeh M, Vakili M. Frequency of Antibiotic Resistance and Virulence Factors in Streptococcus agalactiae Isolated from Vaginal and Urine Samples of Pregnant Women in Yazd, Iran: A Cross-sectional Study. Jundishapur J Microbiol. 2025;18(10):e162606. doi: https://doi.org/10.5812/jjm-162606

10
Dec
2014

Direct Identification of Streptococcus agalactiae in Vaginal Colonization in Pregnant Women Using Polymerase Chain Reaction

Rasoul Yousefi Mashouf,
Seyed Masoud Mousavi,
Soghra Rabiee,
Mohammad Yousef Alikhani,
Mohammad Reza Arabestani

Yousefi Mashouf R, Mousavi SM, Rabiee S, Alikhani MY, Arabestani MR. Direct Identification of Streptococcus agalactiae in Vaginal Colonization in Pregnant Women Using Polymerase Chain Reaction. J Compr Ped. 2014;5(4):e23339. doi: https://doi.org/10.17795/compreped-23339

31
Jul
2017

The Prevalence of Group B streptococcus Rectovaginal Colonization and Antimicrobial Susceptibility Pattern Among Pregnant Women: A Descriptive-Analytical Study

Nahid Ghanbarzadeh,
Mahdokht Mehramiz,
Maleknaz Gannadkafi,
Mohammad Hasan Namaei

Ghanbarzadeh N, Mehramiz M, Gannadkafi M, Namaei MH. The Prevalence of Group B streptococcus Rectovaginal Colonization and Antimicrobial Susceptibility Pattern Among Pregnant Women: A Descriptive-Analytical Study. Mod Care J. 2017;14(3):e66391. doi: https://doi.org/10.5812/modernc.66391

16
Oct
2016

Genotyping of Clinical Streptococcus agalactiae Strains Based on Molecular Serotype of Capsular (cps) Gene Cluster Sequences Using Polymerase Chain Reaction

Mohammad Reza Arabestani,
Seyed Masoud Mousavi,
Mona Nasaj

Arabestani MR, Mousavi SM, Nasaj M. Genotyping of Clinical Streptococcus agalactiae Strains Based on Molecular Serotype of Capsular (cps) Gene Cluster Sequences Using Polymerase Chain Reaction. Arch Clin Infect Dis. 2017;12(1):e36787. doi: https://doi.org/10.5812/archcid.36787

Download PDF1.74 MB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles