Genetic Determinants of Antibiotic Resistance in Hospital and Community Isolates of Klebsiella pneumoniae and Escherichia coli

Author(s):
Farzaneh DehghanFarzaneh Dehghan1, Nader ZolghadriNader Zolghadri2, Afsaneh KarmostajiAfsaneh KarmostajiAfsaneh Karmostaji ORCID3,*
1Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran
2Department of Mathematics, Islamic Azad University, Sama Colledge, Bandar Abbas, Iran
3Infectious and Tropical Diseases Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Jundishapur Journal of Microbiology:Vol. 10, issue 5; e45678
Published online:May 04, 2017
Article type:Research Article
Received:Jan 14, 2017
Accepted:Apr 15, 2017
How to Cite:Dehghan F, Zolghadri N, Karmostaji A. Genetic Determinants of Antibiotic Resistance in Hospital and Community Isolates of Klebsiella pneumoniae and Escherichia coli. Jundishapur J Microbiol. 2017;10(5):e45678. doi: https://doi.org/10.5812/jjm.45678

Abstract

Background:

Multi-drug resistant Escherichia coli and Klebsiella pneumoniae with various resistance determinants are a major concern in hospital and community acquired infections around the world.

Objectives:

To describe the presence of blaCTX-M, blaTEM, blaPER, blaVEB, and integrons class 1, 2, 3 and extended spectrum β lactamase (ESBL) phenotype in E. coli and K. pneumoniae isolates from clinical samples of inpatients and outpatients.

Methods:

One hundred and eighty six E. coli and fifty-eight K. pneumoniae were collected. Antimicrobial susceptibility test was performed by disk diffusion method. Extended-spectrum beta-lactamase phenotype were screened by phenotypic confirmatory test. PCR assay was performed for blaTEM, blaCTX-M, blaPER and blaVEB and class 1, 2, 3 integrase genes. Statistical analysis was performed by chi-squared test.

Results:

Extended-spectrum beta-lactamase phenotype was detected in 49 (26.3%) E. coli and 19 (32.8%) K. pneumoniae isolates. BlaVEB gene in 32 (17.2%) E. coli and 5 (8.6%) K. pneumoniae isolates. BlaPER gene in 4 (2.1%) E. coli and 0 (0%) K. pneumoniae isolates. BlaCTX-M gene in 113 (60.7%) E. coli and 34 (58.6%) K. pneumoniae isolates. BlaTEM gene in 106 (57%) E. coli and 25 (43.1%) K. pneumoniae isolates. One hundred and nine (58.6%) of E. coli and 33 (56.9%) of K. pneumoniae were carrying Class 1 integron and 18 (9.7%) of E. coli and 3 (5.2%) of K. pneumoniae were carrying Class 2 integron. Class 3 integron was not detected.

Conclusions:

High prevalence of ESBLs in E. coli and K. pneumoniae isolated from the community and hospital acquired infections could lead to the wide spread of multi-drug resistance clones that also contain new mechanism of resistance.

1. Background

Klebsiella pneumoniae and Escherichia coli are Gram negative opportunistic pathogens from the family of Enterobacteriaceae. National Health Care safety Network in their report of between 2009 - 2010, described E. coli as 8% and K. pneumoniae as 11.5% of health care associated infections (1). From the early 1970s, K. pneumoniae was reported as one of the major causes of Hospital acquired infections, worldwide. Also K. pneumoniae is considered as a major cause of community-acquired infections including severe pneumonia in alcoholic and diabetic patients, urinary tract infections and liver abscess (2).
Resistance to extended-spectrum cephalosporins is a well-known problem among Enterobacteriaceae (3). Extended-spectrum beta-lactamase (ESBL) with the capability of hydrolysing oxyimino-cephalosporins, and monobactams, except cephamycins or carbapenems, first described in 1983 (4). The majority of Ambler class A bata- lactamases are TEM bata- lactamase responsible for resistance to ampicillin, penicillin and first-generation cephalosporins such as cephalothin. Occurrence of mutations in the blaTEM-1 gene, could lead to ESBL phenotype and increase the hydrolysis capabilities of particular extended-spectrum cephalosporins and aztreonam (5). Another class A bata- lactamases, Cefotaximases (CTX-M) have the capability of hydrolysing cefotaxime and aztreonam and worldwide distribution in community and hospitals is mediated by integrons and insertion sequences (6). The VEB-1 beta lactamase is responsible for a higher level of resistance to ceftazidime than to cefotaxime (7). PER-1 with the capability of hydrolyzing penicillins, oxyimino-cephalosporins and aztreonam, with high prevalence in non-fermentative Gram negative bacilli, such as Pseudomonas aeruginosa, Acinetobacter spp., and Alcaligenes faecalis, has also recently been detected in Enterobacteriaceae (8). Carbapenem resistance in Enterobacteriaceae is mediated by genes located on integrons, such as blaKPC, the gene encoding an Ambler molecular class A enzyme, or blaNDM the gene encoding New Delhi metallo-betalactamase, Which give them the potential of transmission in the community and hospital setting (3).
Four types of antibiotic integrons have been classified based on the intI sequence (9). Integrons are mobile genetic elements that consist of two conserved segments; the 5’conserved segment contains the intI gene, the attI site, and the common promoter Pant and; the 3’conserved segment which includes an antiseptic resistance gene (qacED1), a sulphonamide resistance gene (sul1) and an ORF (orf5) of unknown function. Class 2 integrons are similar to class 1 integrons (10). Most integrons from clinical isolates belong to class 1. The prevalence of the class 1 integron in clinical isolates of E. coli is reported between 33% to 49% and in commensal isolates between 11% - 42% (11).

2. Objectives

Since the existence of integrons in commensal opportunistic strains could serve as a reservoir for the spread of resistance genes in the community and hospital, the present study was conducted to describe the presence of four genetic variants of extended expectrum β lactamase including blaCTX-M, blaTEM, blaPER, blaVEB associated with Classes 1, 2, 3 integrons in E. coli and K. pneumoniae isolates from community-acquired and hospital acquired infections.

3. Methods

3.1. Subjects

Four groups of patient were included in the present study in May 2014 and February 2015. The four groups of patients included in the study, were as follows: Groups 1 and 2: Ninety-nine inpatients and Eighty-seven outpatients, infected with E. coli making a total of One hundred eighty six. Groups 3 and 4: Thirty-four inpatients and twenty-four outpatients (totaling 58); infected with K. pneumoniae.

3.2. Ethics and Consent

The study was approved by the Hormozgan University of Medical Sciences ethics committee according license number Hums.rec.1394.148.

3.3. Bacterial Isolates

Escherichia coli and K. pneumoniae were identified by biochemical tests (12). Bacterial isolates were collected from clinical specimens of affected patients, (e.g., urine, wound, sputum, ascites fluid, cerebrospinal fluid, peritoneum).

3.4. Antimicrobial Susceptibility Testing

Antimicrobial susceptibilities were determined by disk diffusion method in accordance with the clinical and laboratory standards institute (CLSI) guidelines. The following antibiotic disks (MAST Ltd, UK) were used: imipenem (10 µg), gentamicin(10 µg), ofloxacin(5 µg), ceftriaxone (30 µg), cefotaxime (30 µg), cefepime (30 µg), aztreonam (30 µg), ceftazidime (30 µg ), amikacin (30 µg), trimetoprim/ sulfametoxazol (1.25/23.75 µg), ciprofloxacin (5 µg), cefixime (5 µg). ESBL producing isolates were screened by phenotypic confirmatory test (PCT) using ceftazidime and clavulanic acid (13).

3.5. PCR for Identification of Antibiotic Resistance Determinants

DNA was extracted by boiling. The extracted DNA was used as a template for amplication of blaTEM, blaCTX-M, blaPER, blaVEB using 4 primer pairs (Gen Fanavaran Ldt). Table 1 shows the primer sequence, annealing temperature and product size of target genes (14-16). Multiplex PCR was performed for the identification of Class 1, 2, 3 integrons as described by Dillon et al., (17). The PCR amplification was performed in a total volume of 25 µL containing 3 μL of DNA template, 10 pmol of each primer and 1.5 U of Taq DNA polymerase, in 10× PCR buffer containing 1.5 mM MgCl2 and 200 µM of each deoxynucleoside triphosphate(Cinagen Ltd, Iran). The annealing temperatures are presented in Table 1. Expected amplified products, were separated by electrophoresis on 1% agarose gel containing 0.5 μg/mL ethidium bromide and photographed under UV illumination.
Table 1. Primer Pairs Used for Amplification in This Study
Primer NameSequence (5’-3’)Product Size, bpTargetAnnealing, °CReference
Veb-1-fCGA CTT CCA TTT CCC GAT GC643BlaVEB62(14)
Veb-1-rGGA CTC TGC AAC AAA TAC GC
Per-1-fATG AAT GTC ATT ATA AAA GC927BlaPER50(14, 16)
Per1-rTTAATTTGGGCTTAGGG
TEM- FGAGTATTCAACATTTCCGTGTC851BlaTEM63(14)
TEM -RTAATCAGTGAGGCACCTATCTC
CTX-m1 FGACGATGTCACTGGCTGAGC499BlaCTX-M55(15)
CTX-m1 RAGCCGCCGACGCTAATACA
Int-1FCAGTGGACATAAGCCTGTTC160Int 162(17)
Int-1RCCCGAGGCATAGACTGTA
Int-2FGTAGCAAACGAGTGACGAAATG788Int 262(17)
Int-2RCACGGATATGCGACAAAAAGGT
Int-3FGCCTCCGGCAGCGACTTTCAG979Int 362(17)
Int-3RACGGATCTGCCAAACCTGACT

3.6. Statistical Analyses

Statistical analyses were performed using the SPSS 21 and Excel (Microsoft Corp) software programs, employing the chi-square test, and P values less than 0.05 were considered statistically significant.

4. Results

4.1. Strain Identification

A total of 186 E. coli isolates, 125 isolates (67.2%) were from female and 61 (32.8%) were from males. This comprised of 167 isolates (89.8%) from urine, 7 from wound (3.8%), 6 from throat (3.2%), 3 from Ascites fluid (1.6%) and 1 from other samples such as cerebrospinal fluid, Peritoneum and sputum (0.5%). ninety-nine out of 186 E. coli isolates (53.2%) were obtained from inpatients. Samples from inpatients were obtained from any of the wards including, internal medicine 30 (30.3%), pediatrics 24 (24.2%), intensive care units 12 (12.1%), Gynecology 9 (9.1%) and 24 (24.2%) were from other different wards. Eighty-six isolates out of 87 (98.8%) outpatient E. coli isolates, obtained from urine samples.
A total of 58 K. pneumoniae isolates, 22 isolates (37.9%) were from female and 18 (31%) were from males. This comprised of 34 (58.6%) isolates from inpatients, which were obtained from intensive care unit 12 (20.7%), pediatrics7 (12.1%), emergency 7 (12.1%), internal medicine 4 (6.9%), burn 1 (1.7%), surgery 1 (1.7%), ear, nose, and throat department 1 (1.7%) and neurology department 1 (1.7%).

4.2. Antimicrobial Susceptibility Testing

Forty-nine (26.3%) E. coli and 19 (32.8%) K. pneumoniae isolates presented with ESBL phenotype. ESBL ratio between inpatient and outpatient in E. coli isolates was 31/18 (31.3/20.7%) and in K. pneumoniae isolates was 13/6 (38.2%/25%). Antibiotic susceptibility of E. coli and K. pneumoniae isolates are shown in Table 2. Imipenem, ceftazidime and cefepime were the most effective betalactams against E. coli (92.5% susceptible) and K. pneumoniae (65.5% susceptible). The most resistance rate in isolates was on tetracycline with 65.6% resistance in E. coli and 72.4% resistance in K. pneumoniae.
Table 2. Frequency (%) of Sensitivity Rate in E. Coli and K. Pneumoniae Isolates from Inpatient and Outpatienta
AntibioticsE. ColiK. Pneumoniae
Inpatient, N = 99Outpatient, N = 87Total, N = 186Inpatient, N = 34Outpatient, N = 24Total, N = 58
CAZ57 (57.6)64 (73.6)121 (65.1)13 (38.2)17 (70.8)30 (51.7)
CPM59 (59.6)63 (72.4)122 (65.6)16 (47.1)18 (75)34 (58.6)
CRO33 (33.3)54 (62.1)87 (46.8)11 (32.3)18 (75)29 (50)
AZT40 (40.4)57 (65.5)97 (52.2)13 (38.2)18 (75)31 (53.4)
IPM92 (92.9)80 (91.9)172 (92.5)21 (61.8)17 (70.8)38 (65.5)
AN96 (97)81 (93.1)177 (95.2)29 (85.3)21 (87.5)50 (86.2)
CP59 (54.5)55 (63.2)109 (58.6)25 (73.5)22 (91.7)47 (81.1)
SXT31 (31.3)46 (52.9)77 (41.4)18 (52.9)16 (66.7)34 (58.6)
TE28 (28.3)33 (37.9)61 (32.8)8 (23.5)3 (12.5)11 (19)
OFX53 (53.5)54 (62.1)107 (57.5)15 (44.1)18 (75)33 (56.9)
GM63 (63.6)68 (78.2)131 (70.4)23 (67.6)20 (83.3)43 (74.1)
CTX28 (28.3)50 (57.5)78 (41.9)10 (29.4)15 (62.5)25 (43.1)
CFM34 (34.3)56 (64.4)90 (48.4)12 (35.3)17 (70.8)29 (50)

Abbreviations: AN, Amikacin; AZT, Aztreonam; CAZ, Ceftazidime; CFM, Cefexime; CP, Ciprofloxacin; CPM, Cefepime; CRO, Ceftriaxone; CTX, Cefotaxime; GM, Gentamicin; IPM, Imipenem; OFX, Ofloxacin; SXT, Cotrimoxazole; TE, Tetracycline.

aValues are expressed as No. (%).

Resistance rate of ESBLs producing K. pneumoniae to advanced generation cephlosporins are as follows: nineteen (100%) resistant to ceftazidime, 17 (89.5%) resistant to ceftriaxone and cefotaxime, 11 (57.9%) resistant to cefixime and 6 (31.6%) resistant to fourth generation cephalosporin and cefepime. Resistance rate of ESBLs E. coli to cefotaxime, ceftriaxone and cefeximme, ceftazidime and cefepime consequently were 47 (95.9%), 46 (93.9%), 32 (65.3%), 30 (61.2%).

4.3. Detection of Beta-Lactamase Genes

The prevalence of β lactamase genes and integrons are shown in Tables 3 and 4. Class 1 integron in E. coli (58.6%) was higher than in K. pneumoniae (56.9%) and the same was for Class 2 at 9.7 vs 5.2%. Sixty-two isolates (33.3%) of E. coli and 23 isolates (39.6%) of K. pneumoniae were carriers of both blaTEM and blaCTX-M genes. Five E. coli isolates and one K. pneumonia, were carriers of both integron Class 1 and 2. One of the E. coli and 2 isolates of K. pneumoniae, were carriers of more than one of the beta- lactamase genes tested in our study. Characteristics of these isolates are shown in Table 5.
Table 3. Molecular Characteristics of E. Coli Isolates with ESBL Phenotypea
BacteriaNo.ESBLs GenesIntegrons
blaTEMblaCTX-MblaPERblaVEBClass 1Class 2
E. coli
Inpatient99 (53.2)57 (57.6)71 (71.7)3 (3)19 (19.2)66 (66.7)11 (11.1)
Outpatient87 (46.8)49 (56.3)42 (48.3)1 (1.1)13 (14.9)43 (49.4)7 (8.04)
Total186 (100)106 (57)113 (60.8)4 (2.2)32 (17.2)109 (58.6)18 (9.7)

aValues are expressed as No. (%).

Table 4. Molecular Characteristics of K. Pneumoniae Isolates with ESBL Phenotypea
BacteriaNo.ESBLs GenesIntegrons
blaTEMblaCTX-MblaPERblaVEBClass 1Class 2
K. pneumoniae
Inpatient34 (58.6)18 (52.9)22 (64.7)01 (2.9)21 (61.8)2 (5.9)
Outpatient24 (41.4)7 (29.2)12 (50)04 (16.7)12 (50)1 (4.2)
Total58 (100)25 (43.1)34 (58.6)05 (8.6)33 (56.9)3 (5.2)

aValues are expressed as No. (%).

Table 5. Characteristics of E. Coli and K. Pneumoniae Isolates That Contains Integrons and More Than One of the β Lactamase Genes
IsolateBacteriaeInpatient/OutpatientSexSite of IsolationBla Genes and IntegronesPattern of Resistance
174EE. coliInpatientmaleCSFBlaCTX-M, BlaPER, BlaVEB, BlaTEM, Class 2 integronCRO,CTX,CPM,AZT,CAZ,SXT,CP,CFM,
74KK. pneumoniaeOutpatientmaleurineBlaCTX-M, BlaVEB, BlaTEM, Class 1 integronGM,AN,CFM,CP,IPM,AZT,TE,CTX,CPM
43KK. pneumoniaeInpatientfemaleurineBlaCTX-M, BlaVEB, BlaTEM, Class 1 integronSXT,GM,CRO,OFX,CAZ,TE,CTX

4.4. Statistical Analyses

We found significant differences in ESBLs phenotype in E. coli isolated from inpatient compared to community acquired isolates (P = 0.050). Although these differences were not significant in K. pneumoniae (P = 0.145). A significant association of ESBL presentation in E. coli was observed with resistance to ceftazidime, cefepime, ceftriaxone, aztreonam, cefexime, cefotaxime and ofloxacin (P = 0.000) and gentamicin (P = 0.001). In K. pneumoniae isolates, significant association was found with resistance to ceftazidime (P = 0.000) and cefepime (P = 0.001), and ceftriaxone (P = 0.000), aztreonam (P = 0.009), cefexime (0.002), coterimoxazole (SXT) (P = 0.000) and cefotaxime (P = 0.001). There was not significant association between class 1 and class 2 integrons and ESBL presentation in E. coli (P = 0.44). A significant association of ESBL presentation in K. pneumoniae was observed with class 1 integron (P = 0.0018), but class 2 integron (P = 0.47).

5. Discussion

Multi-drug resistant isolates of E. coli and K. pneumoniae are increasingly reported in hospital and community settings around the word. We analyzed the level of antimicrobial resistance, the ESBL presentation and the presence of molecular determinants of resistance including integrons and beta-lactamases-encoding genes in the most prevalent species of Enterobacteriaceae isolated from different samples of inpatient and outpatient. The emergence of community acquired ESBL producing E. coli was first reported in 1988 and since then we have been faced with increasing reports from around the world (4), 7.1% in Brazil (18), 7% in Hong Kong (19) to 28.1% in France (20) and 67.3 in India (21) to higher level of 32% in Iran (22) which was more than the present study (20.7%).
In Iranian study, the frequency of ESBL phenotype in K. pneumoniae in community acquired infections respectively were 52% (23) which was more than our results (25%). We didn’t find significant differences in ESBLs phenotype in K. pneumoniae isolated from inpatient compared to community acquired isolates. However, the frequency of ESBL phenotype in K. pneumoniae in inpatient in the present study (38.2%), was similar to Kashan study (35%), (23). And less than Tehran study (64%) (24). Significant differences in ESBLs phenotype in E. coli isolated from inpatient compared to outpatient, in our study, may be due to the selective pressure of excessive consumption of antibiotics in hospital.
In the present study, the ESBLs producing isolates showed resistance to most antibiotics including advanced generation cephalosporins (31.6% to 100%), which was consistent with other studies in Italy that reported resistance rate of between 41.9 % to 87.0 % for K. pneumoniae to third generation cephlosporins from 2010 to 2012 (25). In Iran, the rate of resistance to third generation cephalosporins amongst ESBL producing K. pneumoniae was between (55%, ceftriaxone), to (67.4%, cefexime) (26). Although these enzymes are not effective on carbapenems, since the cephalosporin resistance results in the use of carbapenem in the treatment of infections, these isolates might be exposed to carbapenem and became resistance (27).
Furthermore, the presence of class 1 and class 2 integrons in these isolates might be mediated resistance to other non beta-lactam antibiotics such as cotrimoxazole, tetracycline, gentamicin and plasmid that carry ESBL genes and can transport resistance genes of other classes of antibiotics (28). Thus, ESBL-producing isolates may exhibit resistance to multiple class of antibiotics.
The most prevalent beta- lactamase genes in the studied isolates was blaCTX-M which is supported by previous studies in Iran and other countries. ESBL producing Klebsiella in Iranian studies were 35% in Kashan of which 80% carried the blactx-M genes (24). According to a French study, the prevalence of CTX-M-producing E. coli among the total number of E. coli isolates was 60.8%, and the occurrence of CTX-M-producing E. coli among ESBL-producing E. coli isolates was 39.8% (20). A polish study revealed that Most of the ESBL-producing isolates (75.7 %) had a blaCTX-M gene (29). Some studies have indicated that CTX-M-producing E. coli and K. pneumoniae have been imported from community acquired urinary tract infections into the hospital setting (27).
In spite of what was expected, in the present study, prevalence of blaVEB in outpatients was more than in inpatients (16.7% vs. 2.9%). The small number of samples harbored this gene, can result in this finding. Amongst 34 ESBL producing E. coli isolates from community acquired urinary tract infections in Cambodia, all were positive for blaCTX-M and negative for blaVEB and blaTEM in 26 (76.4%) of the ESBL-carrying strains was reported (29). One hundred and thirty seven E. coli (73.6%) were not ESBL producing according to PCT. 121 (88.3%) isolates harbored at least one of the studied genes and in K. pneumoniae 39 isolates were not ESBL producing whereas 24 (61.5%) harbored ESBL genes. Presence of beta- lactamase genes in isolates lacking ESBL phenotype, indicates the presence of resistance gene pools in studied isolates causing a risk of resistance gene expression and ESBL phenotype in case of uncontrolled consumption of antibiotics.
Only one E. coli showed ESBL phenotype, without having any of the studied beta- lactamase genes and integrons indicates that the presence of this phenotype in isolates could mainly be due to the presence of these genes. Compared with other studies in Iran (52% class I integron and 2.5% class 2 integron) (9) and Kenya (35% class I integron) (30), the prevalence of integrons in all isolates and even in inpatient isolates was higher. Integrons have the main role in the acquisition and dissemination of resistance genes amongst bacteria. We also found a significant association of ESBL presentation in K. pneumoniae with class 1 integron. This might predict the dissemination and presence of various resistance determinants in nosocomial and community acquired isolates.
One limitation of the current study is the lack of assessment of cassette arrangement in integrons that could provide useful information about resistance gene pools of these isolates. The present study provides evidence indicating the exposure of dissemination of clones with multiple resistance determinants in community and hospital setting in our region. These clones may also acquire other new resistance genes via integrons. Further investigation on surveillance of resistance and molecular typing is recommended to distinguish genetic relatedness and route of transmission of isolates.

Acknowledgments

Footnotes

References

  • 1.
    Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasan A, et al. Antimicrobial-resistant pathogens associated with healthcare-associated infections: summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009-2010. Infect Control Hosp Epidemiol. 2013;34(1):1-14. [PubMed ID: 23221186]. https://doi.org/10.1086/668770.
  • 2.
    Vuotto C, Longo F, Balice MP, Donelli G, Varaldo PE. Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae. Pathogens. 2014;3(3):743-58. [PubMed ID: 25438022]. https://doi.org/10.3390/pathogens3030743.
  • 3.
    Gupta N, Limbago BM, Patel JB, Kallen AJ. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin Infect Dis. 2011;53(1):60-7. [PubMed ID: 21653305]. https://doi.org/10.1093/cid/cir202.
  • 4.
    Pitout JD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing extended-spectrum beta-lactamases (ESBLs) in the community. J Antimicrob Chemother. 2005;56(1):52-9. [PubMed ID: 15917288]. https://doi.org/10.1093/jac/dki166.
  • 5.
    Rupp ME, Fey PD. Extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae: considerations for diagnosis, prevention and drug treatment. Drugs. 2003;63(4):353-65. [PubMed ID: 12558458]. https://doi.org/10.2165/00003495-200363040-00002.
  • 6.
    Mendonca N, Leitao J, Manageiro V, Ferreira E, Canica M. Spread of extended-spectrum beta-lactamase CTX-M-producing escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob Agents Chemother. 2007;51(6):1946-55. [PubMed ID: 17371815]. https://doi.org/10.1128/AAC.01412-06.
  • 7.
    Cao V, Lambert T, Nhu DQ, Loan HK, Hoang NK, Arlet G, et al. Distribution of extended-spectrum beta-lactamases in clinical isolates of Enterobacteriaceae in Vietnam. Antimicrob Agents Chemother. 2002;46(12):3739-43. [PubMed ID: 12435670]. https://doi.org/10.1128/AAC.46.12.3739-3743.2002.
  • 8.
    Bae IK, Jang SJ, Kim J, Jeong SH, Cho B, Lee K. Interspecies dissemination of the bla gene encoding PER-1 extended-spectrum beta-lactamase. Antimicrob Agents Chemother. 2011;55(3):1305-7. [PubMed ID: 21149630]. https://doi.org/10.1128/AAC.00994-10.
  • 9.
    Khoramrooz SS, Sharifi A, Yazdanpanah M, Malek Hosseini SA, Emaneini M, Gharibpour F, et al. High Frequency of Class 1 Integrons in Escherichia coli Isolated From Patients With Urinary Tract Infections in Yasuj, Iran. Iran Red Crescent Med J. 2016;18(1). ee26399. [PubMed ID: 26889395]. https://doi.org/10.5812/ircmj.26399.
  • 10.
    Cocchi S, Grasselli E, Gutacker M, Benagli C, Convert M, Piffaretti JC. Distribution and characterization of integrons in Escherichia coli strains of animal and human origin. FEMS Immunol Med Microbiol. 2007;50(1):126-32. [PubMed ID: 17456180]. https://doi.org/10.1111/j.1574-695X.2007.00242.x.
  • 11.
    Sepp E, Stsepetova J, Loivukene K, Truusalu K, Koljalg S, Naaber P, et al. The occurrence of antimicrobial resistance and class 1 integrons among commensal Escherichia coli isolates from infants and elderly persons. Ann Clin Microbiol Antimicrob. 2009;8:34. [PubMed ID: 19995422]. https://doi.org/10.1186/1476-0711-8-34.
  • 12.
    Winn WC, Koneman EW. Koneman's color atlas and textbook of diagnostic microbiology. Lippincott williams & wilkins; 2006.
  • 13.
    Clinical and Laboratory Standards Institute. Performance Standards for antimicrobial susceptibility testing; Twenty-Fourth Informational Supplement. January 2014.
  • 14.
    Lin SP, Liu MF, Lin CF, Shi ZY. Phenotypic detection and polymerase chain reaction screening of extended-spectrum beta-lactamases produced by Pseudomonas aeruginosa isolates. J Microbiol Immunol Infect. 2012;45(3):200-7. [PubMed ID: 22209695]. https://doi.org/10.1016/j.jmii.2011.11.015.
  • 15.
    Mohamudha Parveen R, Manivannan S, Harish BN, Parija SC. Study of CTX-M Type of Extended Spectrum beta-Lactamase among Nosocomial Isolates of Escherichia coli and Klebsiella pneumoniae in South India. Indian J Microbiol. 2012;52(1):35-40. [PubMed ID: 23449681]. https://doi.org/10.1007/s12088-011-0140-3.
  • 16.
    Mirsalehian A, Feizabadi M, Nakhjavani FA, Jabalameli F, Goli H, Kalantari N. Detection of VEB-1, OXA-10 and PER-1 genotypes in extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients. Burns. 2010;36(1):70-4. [PubMed ID: 19524369]. https://doi.org/10.1016/j.burns.2009.01.015.
  • 17.
    Dillon B, Thomas L, Mohmand G, Zelynski A, Iredell J. Multiplex PCR for screening of integrons in bacterial lysates. J Microbiol Methods. 2005;62(2):221-32. [PubMed ID: 16009279]. https://doi.org/10.1016/j.mimet.2005.02.007.
  • 18.
    Goncalves LF, de Oliveira Martins-Junior P, de Melo AB, da Silva RC, de Paulo Martins V, Pitondo-Silva A, et al. Multidrug resistance dissemination by extended-spectrum beta-lactamase-producing Escherichia coli causing community-acquired urinary tract infection in the Central-Western Region, Brazil. J Glob Antimicrob Resist. 2016;6:1-4. [PubMed ID: 27530830]. https://doi.org/10.1016/j.jgar.2016.02.003.
  • 19.
    Ho PL, Poon WW, Loke SL, Leung MS, Chow KH, Wong RC, et al. Community emergence of CTX-M type extended-spectrum beta-lactamases among urinary Escherichia coli from women. J Antimicrob Chemother. 2007;60(1):140-4. [PubMed ID: 17496058]. https://doi.org/10.1093/jac/dkm144.
  • 20.
    Lavigne JP, Marchandin H, Delmas J, Moreau J, Bouziges N, Lecaillon E, et al. CTX-M beta-lactamase-producing Escherichia coli in French hospitals: prevalence, molecular epidemiology, and risk factors. J Clin Microbiol. 2007;45(2):620-6. [PubMed ID: 17108071]. https://doi.org/10.1128/JCM.01917-06.
  • 21.
    Shanthi M, Sekar U. Extended spectrum beta lactamase producing Escherichia coli and Klebsiella pneumoniae: risk factors for infection and impact of resistance on outcomes. J Assoc Physicians India. 2010;58 Suppl:41-4. [PubMed ID: 21568008].
  • 22.
    Pourakbari B, Ferdosian F, Mahmoudi S, Teymuri M, Sabouni F, Heydari H, et al. Increase resistant rates and ESBL production between E. coli isolates causing urinary tract infection in young patients from Iran. Braz J Microbiol. 2012;43(2):766-9. [PubMed ID: 24031888]. https://doi.org/10.1590/S1517-83822012000200041.
  • 23.
    Latifpour M, Gholipour A, Damavandi MS. Prevalence of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates in Nosocomial and Community-Acquired Urinary Tract Infections. Jundishapur J Microbiol. 2016;9(3). ee31179. [PubMed ID: 27226874]. https://doi.org/10.5812/jjm.31179.
  • 24.
    Afzali H, Firoozeh F, Amiri A, Moniri R, Zibaei M. Characterization of CTX-M-Type Extend-Spectrum beta-Lactamase Producing Klebsiella spp. in Kashan, Iran. Jundishapur J Microbiol. 2015;8(10). ee27967. [PubMed ID: 26587221]. https://doi.org/10.5812/jjm.27967.
  • 25.
    Agodi A, Barchitta M, Quattrocchi A, Maugeri A, Aldisio E, Marchese AE, et al. Antibiotic trends of Klebsiella pneumoniae and Acinetobacter baumannii resistance indicators in an intensive care unit of Southern Italy, 2008-2013. Antimicrob Resist Infect Control. 2015;4:43. [PubMed ID: 26539294]. https://doi.org/10.1186/s13756-015-0087-y.
  • 26.
    Feizabadi MM, Delfani S, Raji N, Majnooni A, Aligholi M, Shahcheraghi F, et al. Distribution of bla(TEM), bla(SHV), bla(CTX-M) genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb Drug Resist. 2010;16(1):49-53. [PubMed ID: 19961397]. https://doi.org/10.1089/mdr.2009.0096.
  • 27.
    Barguigua A, El Otmani F, Talmi M, Bourjilat F, Haouzane F, Zerouali K, et al. Characterization of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates from the community in Morocco. J Med Microbiol. 2011;60(Pt 9):1344-52. [PubMed ID: 21546559]. https://doi.org/10.1099/jmm.0.032482-0.
  • 28.
    Baudry PJ, Nichol K, DeCorby M, Lagace-Wiens P, Olivier E, Boyd D, et al. Mechanisms of resistance and mobility among multidrug-resistant CTX-M-producing Escherichia coli from Canadian intensive care units: the 1st report of QepA in North America. Diagn Microbiol Infect Dis. 2009;63(3):319-26. [PubMed ID: 19216943]. https://doi.org/10.1016/j.diagmicrobio.2008.12.001.
  • 29.
    Ruppe E, Hem S, Lath S, Gautier V, Ariey F, Sarthou JL, et al. CTX-M beta-lactamases in Escherichia coli from community-acquired urinary tract infections, Cambodia. Emerg Infect Dis. 2009;15(5):741-8. [PubMed ID: 19402960]. https://doi.org/10.3201/eid1505.071299.
  • 30.
    Kiiru J, Butaye P, Goddeeris BM, Kariuki S. Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992-2011). BMC Microbiol. 2013;13:109. [PubMed ID: 23682924]. https://doi.org/10.1186/1471-2180-13-109.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles