Effects of Different Environmental Factors and Virulence Factors, dupA and iceA Genes, of Helicobacter pylori on Peptic Ulcer

Author(s):
Vahid BabaeiVahid Babaei1, Yassaman SaghaeiYassaman Saghaei2, Hamidreza Zeraatgar GohardaniHamidreza Zeraatgar Gohardani3, Farzaneh ValiFarzaneh Vali1, Shahram TeimourianShahram TeimourianShahram Teimourian ORCID1, 4,*
1Department of Medical Genetics, Iran University of Medical Sciences, Tehran, Iran
2Iranian Blood Transfusion Organization (IBTO), Tehran, Iran
3Baharloo Hospital, Tehran University of Medical Sciences (TUMS), Tehran, Iran
4Department of Infectious Diseases, Pediatrics Infectious Diseases Research Center, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Jundishapur Journal of Microbiology:Vol. 10, issue 5; e40161
Published online:May 01, 2017
Article type:Research Article
Received:Jun 22, 2016
Accepted:Apr 09, 2017
How to Cite:Babaei V, Saghaei Y, Zeraatgar Gohardani H, Vali F, Teimourian S. Effects of Different Environmental Factors and Virulence Factors, dupA and iceA Genes, of Helicobacter pylori on Peptic Ulcer. Jundishapur J Microbiol. 2017;10(5):e40161. doi: https://doi.org/10.5812/jjm.40161

Abstract

Background:

Helicobacter pylori is colonized in stomach and has a significant etiological role in different kinds of digestive diseases. Helicobacter pylori has the ability to devastate duodenal mucus causing peptic ulcer. Breakage of stomach lining is also seen more often among people who accustomed to consume tobacco, spicy (or sour) foods, alcohol, coffee, and tranquilizers as well as those who are exposed to heavy meals and stressful-life events (stress ulcer). Also, it seems dup A and ice A genes are involved in H. pylori etiology.

Objectives:

This study aimed to determine the relation of jhp0917 and jhp0918 genes, ABO blood type, and some environmental factors with peptic ulcer.

Methods:

In our study, 500 gastric mucosal biopsy samples from digestive tract were examined by rapid urease test (RUT) and 16s rDNA PCR test for H. pylori infection followed by histopathological examinations. The dup A and ice A genes were also evaluated by PCR.

Results:

In H. pylori colonized peptic ulcers, dup A gene showed no significant relation with peptic ulcer. On the other hand, iceA 1 (+)/ iceA 2 (-) genotype of H. pylori showed a strong association with peptic ulcer (P < 0.05).

Conclusions:

ABO blood group showed no association with H. pylori infection. Peptic ulcer had a significant relationship with consumption of tobacco (P < 0.05), consumption of tranquilizers (P < 0.05), and meteorism (P < 0.05).

1. Background

Helicobacter pylori is a spiral, filamentous, Gram-negative bacillus with about 3.5 micron length and 0.5 micron width (1, 2). It colonizes in human stomach and is of high etiological importance in digestive diseases such as gastritis, stomach ulcer, stomach cancer, and peptic ulcer (1, 3, 4). Colonization of H. pylori in gastric mucosa has a prevalence of 5 to 10% up to the tenth year of life (5). Peptic Ulcer (PU) is an open sore that develops in lining of stomach or the upper part of the small intestine (6). It often causes single, and sometimes, multiple ulcers in stomach called Zollinger-Ellison syndrome (a severe Peptic Ulcer with hyper pH in stomach) (7). The most important risk factors are potable water, tobacco, alcohol, meteorism, tranquilizers, age (more than 50), family history, tiredness, long hours of work, unbalanced diet, and NSAIDs e.g. aspirin (7).
Jhp0917 and jhp0918 genes of H. pylori are important in its virulence. There are three classes of virulence genes in H. pylori: lineage specific genes, phase-variable genes, and genes with variable structures/genotypes. Among lineage specific genes, the cag pathogenic Island is the most identified one (4, 8). Jhp0947 and dupA (duodenal ulcer promoting) genes belong to this class of genes. However, they reside outside of the cag pathogenic island involved in the severity (9). The second group, genes with transitive phase, includes six genes namely oipA, sabA, sabB, babB, babC, hopz that code for bacterial outer membrane proteins (9, 10). The last group of pathogenic genes includes genes with variable structures/genotypes (e.g. vac A) (1, 4). In 2005 (11), Lu and colleagues studied dupA gene, jhPO917, and jhpo918 in different types of H. pylori and introduced them as superior candidate markers of peptic ulcer in Japan, Korea, and Colombia. It seems that dupA is more prevalent among patients suffer from peptic ulcer and it is less prevalent among patients affected by stomach cancer (11, 12). There are many reports indicating the relation of this gene with digestive diseases (12-15).
A lately described putative virulence factor of H. pylori is iceA. This gene exists in at least two allelic forms, iceA1 and iceA2. IceA1 is up-regulated upon contact of H. pylori with the gastric epithelium (16, 17). The next plausible risk factor for peptic ulcer is host blood type. There are reports that individuals with O blood type are more susceptible to peptic ulcer in comparison with those with other blood types (6). Other eventual risk factors are environmental. We mention some as following: coffee (18), alcohol consumption (19), smoking (20), stress (21), spices (22), and nutrition (23).

2. Objectives

Because of scarce studies and controversial results in this subject, this study aimed to determine the relation of peptic ulcer with jhp0917 and jhp0918 genes, ABO blood type, and some environmental factors.

3. Methods

3.1. Sample Preparation

500 gastric mucosal biopsy samples were gathered from patients with digestive diseases in spring 2014. The general characteristics of patients such as gender, age, job, and history of drug consumption were obtained by their physicians. Because of inhibitory effects of antibiotics, non-steroidal anti-inflammatory drugs, H+ pump inhibitors, and bismuth compounds on rapid urease test leading to false negative results, the patients who had taken one of those drugs 14 days before biopsy were excluded from the study.

3.2. Rapid Urease Test

Biopsy samples were prepared from the antrum within 2 cm of the pylorus. Helicobacter releases urease which can hydrolyze urea in urea cristiyance solution (Dako Corporation SL029) by incubating at 37°C for 1 hour. The ammonia product changes the color of the solution from yellow to red.

3.3. Histopathological Examinations

Morphological features and aggregation of H. pylori in the tissue of each sample were carefully examined after treating each sample by formaldehyde solution (fixation) and staining by hematoxineosin (Dako Corporation SL029) according to the manufacturer’s protocol. Histopathological test made it possible to specify the chronic inflammation of the gastric mucosa by H. pylori infection according to the modified Sydney system. In peptic ulcers, the loss of substance was circular or elliptical, having 2 - 4 cm diameter and slightly elevated borders. The base was clean and finely granular. The histopathology of duodenal cancer was similar to that of adenocarcinoma.

3.4. Microscopic Test

Rod spiral organisms surrounded by epithelial cell were seen by a conventional microscope.

3.5. DNA Extraction and PCR

DNA was extracted from tissue samples using Fermentas DNA extraction kit (CAT: 00039826). The samples were either used immediately or frozen at -80°C until use in PCR. The PCR amplification was performed with 20 pM of specific primers (Cinaclone, Tehran, Iran) in a total volume of 25 μL. The 16srRNA forward primer was 5’- TAGCCACTGGAAACGGTGAT-3’ and the reverse primer was 5’- GTGTACTAGGCCCGGGAACGTATTC-3’ (24). The iceA1 forward primer was 5’- GTGTTTTTAACCAAAGTATC-3’ and the reverse primer was 5’- CTATAGCCATTATCTTTGCA-3’. The iceA2 forward primer was 5’- GTTGGGTATATCACAATTTAT -3’ and the reverse primer was 5’- TTTCCCTATTTTCTAGTAGGT -3’ (25). The Jhp0917 forward primer was 5’- TGGTTTCTACTGACAGAGCGC-3’ and the reverse primer was 5’- AACACGCTGACAGGACAATCTCCC -3’. For Jhp0918, the forward primer was 5’- CCTATATCGCTAACGCGCGCTC -3’ and the reverse primer was 5’-AAGCTGAAGCGTTTGTAACG -3’. The last two primers were designed by primer 3 software available at http://primer3.ut.ee. PCR products were confirmed by DNA sequencing.
PCR amplification program was: 94°C, 1 minute; 60°C, 1 minute; 72°C, 1 minute, for 35 cycles.
PCR products were then visualized under ultraviolet light on 2% agarose gel after ethidium bromide staining. To avoid false-negative results on PCR as a result of variations in the primer annealing sites, a dot blot was performed in all cases. For each single dot, 100 ng of sample DNA was mixed with 100 μL of denaturing buffer (0.8 M NaOH, 1.5 M NaCl) and spotted onto a Hybond N+ membrane (Amersham biosciences, Little Chalfont, UK) via 96-well Bio-Dot apparatus (Bio-Rad, Ivry-sur-Seine, France). DNA from the reference strain 26695, J99, SS1 (GenBank accession number AE001439) and human DNA extracted from peripheral blood cells were used as positive and negative controls, respectively.

3.6. Statistical Analysis

Chi square test was performed in SPSS 16.0 software. The data were considered to be significant at the level of P < 0.05.

4. Results

500 biopsy samples were gathered from patients with digestive diseases. 200 patients were positive for peptic ulcer disease (PUD). 152 samples from these patients were positive by rapid unease test and 16srDNA PCR test. The remaining 300 patients who were negative for peptic ulcer manifested other diseases, non-ulcer dyspepsia (NUD). Non-ulcer dyspepsia patients were classified into two categories: gastritis (80%) and duodenitis (20%). The patients’ information is summarized in Tables 1 and 2.
Table 1. Information of Patients’ with PUD (N = 200)
SymptomNumber of PatientsPersonal HabitsNumber of PatientsRisk FactorsNumber of Patients
Stomach Pain186Alcohola64Positive RUT and 16srDNA PCR test152
Meteorism164Coffeeb70Blood groupA+:50, A-:24B+:28, B-:24O+:48, O-:26
Puke150Teab120
Distaste70Tranquilizersc166
Tobacco170

aConsumption of more than 75 g of ethanol a week.

bMore than one cup a day.

cUsing the drugs for 2 years, 3 times a day (mostly Aspirin).

Table 2. Information of Patients’ with NUD (N = 300)
SymptomNumber of PatientsPersonal HabitsNumber of PatientsRisk FactorsNumber of Patients
Stomach pain80Alcohol50Positive RUT and 16srDNA PCR test18
Meteorism50Coffee54Blood groupA+:80, A-:36B+:42, B-:30O+:72, O-:40
Puke10Tea126
Distaste30Tranquilizers22
Tobacco42
From 152 PUD patients, who were positive by rapid urease test and 16S DNA, 72 were men and 80 were women. The average age was 50 years in men and 45 years in women. 89% of H. pylori positive patients, by RUT and 16S DNA, suffered from PUD and the others had NUD (11%). Peptic ulcer disease patients were classified into three categories: stomach ulcer (61%), duodenal ulcer (38%), and gastric cancer (1%). From 500 biopsy samples, 170 samples were H. pylori positive. 170 out of 170 H. pylori positive samples were positive for 16srDNA gene by PCR. All of the 170 samples were examined by PCR for dupA genes, and 50 of them were positive. PCR product size was 307bp for jhp0917 and 276bp for jhp0918 (Figure 1). The PCR products also were confirmed by sequencing. 170 H. pylori positive samples also were genotyped for iceA1 and iceA2 (Figure 2) 96 samples showed iceA1 (+)/ iceA2 (-) genotype.
A, Amplification of jhp0917 gene of <i>H. pylori</i> (307 bp), M: 100 bp ladder, size marker, C+positive: 26695, J99,SS,01 to 04: positive samples and C-negative control; B, Amplification of jhp0918 gene of <i>H. pylori</i> (276 bp). M: 100 bp Ladder, size marker, C+positive: 26695,J99,SS,01 to 03: positive samples and C- negative control.
Figure 1.

A, Amplification of jhp0917 gene of H. pylori (307 bp), M: 100 bp ladder, size marker, C+positive: 26695, J99,SS,01 to 04: positive samples and C-negative control; B, Amplification of jhp0918 gene of H. pylori (276 bp). M: 100 bp Ladder, size marker, C+positive: 26695,J99,SS,01 to 03: positive samples and C- negative control.

Electrophoresis of <i>iceA</i> Gene PCR Products on 12% Acrylamide Gel: Lane 1; Marker, Lane 2; Negative Control, Lane 3, 4, 5; <i>iceA1</i> Positive (247 bp) and, Lane 6; <i>iceA2</i> Positive (229 bp)
Figure 2.

Electrophoresis of iceA Gene PCR Products on 12% Acrylamide Gel: Lane 1; Marker, Lane 2; Negative Control, Lane 3, 4, 5; iceA1 Positive (247 bp) and, Lane 6; iceA2 Positive (229 bp)

5. Discussion

Peptic ulcer ultimately develops as a result of defective balance between invasive and defensive factors in the mucous of stomach and duodenum. The clinical signs are dyspepsia with pain in upper central part of abdomen, puke, emphysema, and epigastric pain 45 - 60 minutes after eating or during night, which is relieved with anti-acid drug or vomiting. The signs are chronic weight and appetite loss, iron storage deficiency anemia, blood in stool, bloody vomiting reflux, and back and abdominal pain (6). This disease is curable by drugs or surgery. According to our data, H. pylori infection is one of the strongest predisposing risk factors for duodenal ulcer disease. The rate of H. pylori infection was 76% among PUD patients and 6% in gastritis non-PUD patients [Odds ratio: 49.6, 95% CI = 27.8 to 88.2 (P < 0.05)].
Studies in Scotland (6), Turkey (26), and Kurdistan (27) found a meaningful relationship between peptic ulcer and ABO blood group, which was not in agreement with the similar studies in Netherlands (7) and Taiwan (28). In our study, no meaningful relationship between peptic ulcer and ABO blood group was detected.
According to our Investigation, tobacco is a potent risk factor for duodenal ulcer disease. Smoking habit was greater among PUD patients (85%) than gastritis non-PUD patients (14%) [Odds ratio: 21.3, 95% CI = 12.7 to 35.7, (P < 0.05)]. It is not in line with other surveys in USA and Japan (29) in which patients with functional dyspepsia had not shown any association with smoking. This finding is in agreement with the study in Germany (18). This study in agreement with other studies in Germany (18), USA (19) and Denmark (26) showed no significant association between alcohol consumption and duodenal ulcer. Coffee due to its caffeine content instigates the secretion of acid, reducing the compression of the bottom sphincter (18). This finding is similar to those of similar studies in Germany (18) and Japan (29) that showed no association between coffee consumption and duodenal ulcer.
Excessive consumption of tranquilizer drugs such as aspirin can damage the coating of the stomach making it bleed (30-32). Our study in line with another study from china (30) showed non-steroidal anti-inflammatory drugs (NSAIDs) cause the vast majority of peptic ulcers and their complications, which was not in accordance with a similar study from Spain (32) [Odds ratio: 61.6, 95% CI = 34.9 to 109, (P < 0.05)].
In Japan, Korea, and Colombia, dupA has been reported to be associated with an increased risk of duodenal ulcer disease and reduced risk of gastric atrophy and cancer (33). However, in Western countries this association was not detected (33). Within our patients, there was no relation between this gene and duodenal ulcer. Dup A had a frequency of 27% among H. pylori infected PUD patients and 44% among H. pylori infected non-PUD patients [Odds ratio: 0.47, 95% CI = 0.17 to 1.29].
There are some studies indicating the relationship between H. pyloriiceA1 and peptic ulcer (34, 35). In our patients, there was a strong association between iceA1 (+)/ iceA2 (-) genotype and duodenal ulcer. The rate of iceA1 (+)/ iceA2 (-) genotype was 61% among H. pylori infected PUD patients and 17.6% among H. pylori infected non-PUD patients [Odds ratio: 7.63, 95% CI = 3.95 to 14.75]. Finally, we found a significant relationship between meteorism and peptic ulcer among our patients (P < 0.05).

Footnotes

References

  • 1.
    Momtaz H, Souod N, Dabiri H, Sarshar M. Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J Gastroenterol. 2012;18(17):2105-11. [PubMed ID: 22563199]. https://doi.org/10.3748/wjg.v18.i17.2105.
  • 2.
    Kusters JG, Gerrits MM, VanStrijp JAG. Coccoid forms of Helicobacter pylori are the morphologic manifestation of cell death. Infect Immun. 1997 Sep;65(9):3672-9. [PubMed ID: 9284136].
  • 3.
    Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev. 1997;10(4):720-41. [PubMed ID: 9336670].
  • 4.
    Ramezani H, Bozorgi SH, Nooranipour M, Mostajeri A, Kargar-Fard H, Molaverdikhani S, et al. Prevalence and risk factors of hepatitis A among blood donors in Qazvin, central Iran. Singapore Med J. 2011;52(2):107-12. [PubMed ID: 21373737].
  • 5.
    Kawakami E, Machado RS, Fonseca JA, Patricio FR. [Clinical and histological features of duodenal ulcer in children and adolescents]. J Pediatr (Rio J). 2004;80(4):321-5. [PubMed ID: 15309235].
  • 6.
    Gerhard M, Lehn N, Neumayer N, Boren T, Rad R, Schepp W, et al. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc Natl Acad Sci U S A. 1999;96(22):12778-83. [PubMed ID: 10535999].
  • 7.
    Loffeld RJ, Stobberingh E. Helicobacter pylori and ABO blood groups. J Clin Pathol. 1991;44(6):516-7. [PubMed ID: 2066433].
  • 8.
    Momtaz H, Souod N, Dabiri H. Comparison of the virulence factors of Helicobacter pylori isolated in stomach and saliva in Iran. Am J Med Sci. 2010;340(5):345-9. [PubMed ID: 21048436]. https://doi.org/10.1097/MAJ.0b013e3181d94fbc.
  • 9.
    Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J Med Microbiol. 2008;57(Pt 5):545-53. [PubMed ID: 18436586]. https://doi.org/10.1099/jmm.0.2008/000570-0.
  • 10.
    Matteo MJ, Armitano RI, Granados G, Wonaga AD, Sanches C. Helicobacter pylori oipA, vacA and dupA genetic diversity in individual hosts. J Med Microbiol. 2010 Jan;59(Pt 1):89-95. https://doi.org/10.1099/jmm.0.011684-0.
  • 11.
    Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology. 2005;128(4):833-48. [PubMed ID: 15825067].
  • 12.
    Gomes LI, Rocha GA, Rocha AMC, Soares TF, Oliveira CA. Lack of association between Helicobacter pylori infection with dupA-positive strains and gastroduodenal diseases in Brazilian patients. Int J Med Microbiol. 2008 Apr;298(3-4):223-30. [PubMed ID: 17897881]. https://doi.org/10.1016/j.ijmm.2007.05.006.
  • 13.
    Argent RH, Burette A, Miendje Deyi VY, Atherton JC. The presence of dupA in Helicobacter pylori is not significantly associated with duodenal ulceration in Belgium, South Africa, China, or North America. Clin Infect Dis. 2007;45(9):1204-6. [PubMed ID: 17918084]. https://doi.org/10.1086/522177.
  • 14.
    Arachchi HS, Kalra V, Lal B, Bhatia V, Baba CS, Chakravarthy S, et al. Prevalence of duodenal ulcer-promoting gene (dupA) of Helicobacter pylori in patients with duodenal ulcer in North Indian population. Helicobacter. 2007;12(6):591-7. [PubMed ID: 18001398]. https://doi.org/10.1111/j.1523-5378.2007.00557.x.
  • 15.
    Douraghi M, Mohammadi M, Oghalaie A, Abdirad A, Mohagheghi MA, Hosseini ME, et al. dupA as a risk determinant in Helicobacter pylori infection. J Med Microbiol. 2008;57(Pt 5):554-62. [PubMed ID: 18436587]. https://doi.org/10.1099/jmm.0.47776-0.
  • 16.
    Peek RJ, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, et al. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians. 1998;110(6):531-44. [PubMed ID: 9824536].
  • 17.
    van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, et al. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology. 1998;115(1):58-66. [PubMed ID: 9649459].
  • 18.
    Holstege A. [Effects of nicotine, alcohol and caffeine on the incidence, healing and recurrence rate of peptic ulcer]. Z Gastroenterol. 1987;25 Suppl 3:33-40. [PubMed ID: 3310431].
  • 19.
    Aldoori WH, Giovannucci EL, Stampfer MJ, Rimm EB, Wing AL, Willett WC. A prospective study of alcohol, smoking, caffeine, and the risk of duodenal ulcer in men. Epidemiology. 1997;8(4):420-4. [PubMed ID: 9209857].
  • 20.
    Rosenstock S, Jorgensen T, Bonnevie O, Andersen L. Risk factors for peptic ulcer disease: a population based prospective cohort study comprising 2416 Danish adults. Gut. 2003;52(2):186-93. [PubMed ID: 12524398].
  • 21.
    Wachirawat W, Hanucharurnkul S, Suriyawongpaisal P, Boonyapisit S, Levenstein S, Jearanaisilavong J, et al. Stress, but not Helicobacter pylori, is associated with peptic ulcer disease in a Thai population. J Med Assoc Thai. 2003;86(7):672-85. [PubMed ID: 12948263].
  • 22.
    Al Mofleh IA. Spices, herbal xenobiotics and the stomach: friends or foes? World J Gastroenterol. 2010;16(22):2710-9. [PubMed ID: 20533590].
  • 23.
    Herrera AG. Helicobacter pylori and food products: a public health problem. Methods Mol Biol. 2004;268:297-301. [PubMed ID: 15156039]. https://doi.org/10.1385/1-59259-766-1:297.
  • 24.
    Grahn N, Hmani-Aifa M, Fransen K, Soderkvist P, Monstein HJ. Molecular identification of Helicobacter DNA present in human colorectal adenocarcinomas by 16S rDNA PCR amplification and pyrosequencing analysis. J Med Microbiol. 2005;54(Pt 11):1031-5. [PubMed ID: 16192433]. https://doi.org/10.1099/jmm.0.46122-0.
  • 25.
    Erzin Y, Koksal V, Altun S, Dobrucali A, Aslan M, Erdamar S, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2 genotypes and correlation with clinical outcome in Turkish patients with dyspepsia. Helicobacter. 2006;11(6):574-80. [PubMed ID: 17083380]. https://doi.org/10.1111/j.1523-5378.2006.00461.x.
  • 26.
    Seyda T, Derya C, Fusun A, Meliha K. The relationship of Helicobacter pylori positivity with age, sex, and ABO/Rhesus blood groups in patients with gastrointestinal complaints in Turkey. Helicobacter. 2007;12(3):244-50. [PubMed ID: 17493005]. https://doi.org/10.1111/j.1523-5378.2007.00500.x.
  • 27.
    Jaff MS. Relation between ABO blood groups and Helicobacter pylori infection in symptomatic patients. Clin Exp Gastroenterol. 2011;4:221-6. [PubMed ID: 22016583]. https://doi.org/10.2147/CEG.S23019.
  • 28.
    Yei CJ, Chang JG, Shih MC, Lin SF, Chang CS, Ko FT, et al. Lewis blood genotypes of peptic ulcer and gastric cancer patients in Taiwan. World J Gastroenterol. 2005;11(31):4891-4. [PubMed ID: 16097066].
  • 29.
    Shimamoto T, Yamamichi N, Kodashima S, Takahashi Y, Fujishiro M. No association of coffee consumption with gastric ulcer, duodenal ulcer, reflux esophagitis, and non-erosive reflux disease: A cross-sectional study of 8,013 healthy subjects in Japan. Plos One. 2013;8(6).
  • 30.
    Schmassmann A. Aspirin injury and H pylori. Gut. 2002;50(5):589-90. [PubMed ID: 11950798].
  • 31.
    Ji KY, Hu FL. Interaction or relationship between Helicobacter pylori and non-steroidal anti-inflammatory drugs in upper gastrointestinal diseases. World J Gastroenterol. 2006;12(24):3789-92. [PubMed ID: 16804960].
  • 32.
    Fletcher EH, Johnston DE, Fisher CR, Koerner RJ, Newton JL, Gray CS. Systematic review: Helicobacter pylori and the risk of upper gastrointestinal bleeding risk in patients taking aspirin. Aliment Pharmacol Ther. 2010;32(7):831-9. [PubMed ID: 20659284]. https://doi.org/10.1111/j.1365-2036.2010.04415.x.
  • 33.
    Shiota S, Matsunari O, Watada M, Hanada K, Yamaoka Y. Systematic review and meta-analysis: the relationship between the Helicobacter pylori dupA gene and clinical outcomes. Gut Pathog. 2010;2(1):13. [PubMed ID: 21040520]. https://doi.org/10.1186/1757-4749-2-13.
  • 34.
    Momenah AM, Tayeb MT. Helicobacter pylori cagA and iceA genotypes status and risk of peptic ulcer in Saudi patients. Saudi Med J. 2007;28(3):382-5. [PubMed ID: 17334464].
  • 35.
    Ciftci IH, Uslan I, Dilek FH, Asik G, Ozgur MA, Dilek ON. [Investigation of Helicobacter pylori iceA1 and iceA2 genes in patients with chronic gastritis and gastric cancer]. Mikrobiyol Bul. 2011;45(2):228-33. [PubMed ID: 21644065].

Similar Articles

10
Jun
2013

The Prevalence of Helicobacter pylori babA2, iceA1 and iceA2 Genes and Their Association with Clinical Outcomes in Patients with Chronic Gastritis, Ulcerative Diseases and Non-Ulcer Dyspepsia in South East of Iran

Hamid Abdollahi,
Mostafa shokoohi,
Mohammad Savari

Abdollahi H, shokoohi M, Savari M. The Prevalence of Helicobacter pylori babA2, iceA1 and iceA2 Genes and Their Association with Clinical Outcomes in Patients with Chronic Gastritis, Ulcerative Diseases and Non-Ulcer Dyspepsia in South East of Iran. Jundishapur J Microbiol. 2013;6(4):e4739. doi: https://doi.org/10.5812/jjm.4739

18
Oct
2021
Zahedan J Res Med Sci

Prevalence of Idiopathic Peptic Ulcer in Southeastern Iran

Alireza Bakhshipour,
Raheleh Rafaiee

Bakhshipour A, Rafaiee R. Prevalence of Idiopathic Peptic Ulcer in Southeastern Iran. Zahedan J Res Med Sci. 2021;23(4):e119598. doi: https://doi.org/10.5812/zjrms.119598

18
Nov
2017

The Prevalence of Helicobacter pylori Virulence Related Genes (hpa and babA2) in Iranian Patients with Gastrointestinal Disorders

Khatoon Heidari,
Vahideh Kazem Nezhad,
Alireza Noroozi,
Fatemeh Mehravar

Heidari K, Kazem Nezhad V, Noroozi A, Mehravar F. The Prevalence of Helicobacter pylori Virulence Related Genes (hpa and babA2) in Iranian Patients with Gastrointestinal Disorders. Jundishapur J Microbiol. 2017;10(12):e60947. doi: https://doi.org/10.5812/jjm.60947

21
Dec
2016

Identification of Gastric Cancer-Related Strains of Helicobacter pylori: Findings from Single Biopsy Specimens for PCR and Campylobacter-Like Organism Test

Zeinab Basiri,
Reza Safaralizadeh,
Morteza Jabbarpour Bonyadi,
Reza Abdolmohammadi,
Mohammad Hossein Somi

Basiri Z, Safaralizadeh R, Jabbarpour Bonyadi M, Abdolmohammadi R, Somi MH. Identification of Gastric Cancer-Related Strains of Helicobacter pylori: Findings from Single Biopsy Specimens for PCR and Campylobacter-Like Organism Test. Jundishapur J Microbiol. 2017;10(2):e37006. doi: https://doi.org/10.5812/jjm.37006

31
Oct
2023
J Clin Res Paramed Sci

Evaluation of PCR Methods and Urease in Diagnosis of Patients with Helicobacter pylori Infection in Qazvin, Iran

Maedeh Pourali,
Ali Bastani,
Amir Tavassolian,
Javane Jafarshad,
Muaadh Saif Othman Al-Haddad,
Kourosh Sahebnazar
,et al.

Pourali M, Bastani A, Tavassolian A, Jafarshad J, Saif Othman Al-Haddad M, et al. Evaluation of PCR Methods and Urease in Diagnosis of Patients with Helicobacter pylori Infection in Qazvin, Iran. J Clin Res Paramed Sci. 2023;12(2):e139671. doi: https://doi.org/10.5812/jcrps-139671


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles