The Prevalence of Helicobacter pylori Virulence Related Genes (hpa and babA2) in Iranian Patients with Gastrointestinal Disorders

Author(s):
Khatoon HeidariKhatoon Heidari1, Vahideh Kazem NezhadVahideh Kazem Nezhad2, Alireza NorooziAlireza Noroozi3, Fatemeh MehravarFatemeh MehravarFatemeh Mehravar ORCID4,*
1Clinical Research Development Unit (CRDU), 5Azar Hospital, Golestan University of Medical Sciences, Gorgan, IR Iran
2Department of Pathology, Golestan University of Medical Siences, Gorgan, IR Iran
3Department of Gastroenterology, Golestan University of Medical Siences, Gorgan, IR Iran
4Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, Tehran, IR Iran
*Corresponding Author: Corresponding author: Fatemeh Mehravar, Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran. Tel: +98-1732354936, E-mail: Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 10, issue 12; e60947
Published online:Nov 18, 2017
Article type:Research Article
Received:Aug 27, 2017
Accepted:Oct 21, 2017
How to Cite:Heidari K, Kazem Nezhad V, Noroozi A, Mehravar F. The Prevalence of Helicobacter pylori Virulence Related Genes (hpa and babA2) in Iranian Patients with Gastrointestinal Disorders. Jundishapur J Microbiol. 2017;10(12):e60947. doi: https://doi.org/10.5812/jjm.60947

Abstract

Background:

The clinical result severity of Helicobacter pylori infection is determined by a combination of environmental factors, host genetic background, and H. pylori virulence factors. A number of genes containing vacA, iceA, babA2, cagA, cagE, hsp60-70, and hpa have been identified to enhance H. pylori pathogenicity by encoding virulent proteins. The babA and hpa proteins are considered 2 major adhesion molecules, and thus they are key agents in the initial step of H. pylori invasion.

Objectives:

This study aimed at investigating the existence of babA2 and hpa virulence factors of H. pylori in Iranian patients with gastrointestinal complications. The relationship between these agents and clinical results was also investigated.

Methods:

A total of 80 positive biopsies out of 156 samples were studied to determine babA2 and hpa gene frequency by PCR. The positive biopsies were collected from patients suffering from gastric cancer (n =18), peptic ulcer (n = 26), and gastritis (n =36).

Results:

The babA2+ strains were found in 51 (64%) patients and the hpa+ strains in 57 (71%) patients were associated with sex (P = 0.02). However, the frequency of these factors was not significant between gastric disease groups (P > 0.05).

Conclusions:

Our results revealed different frequency of these virulence factors in Iran, which emphasized the effects of geographical influences. Also, it was found that male patients had higher rate of hpa than females, highlighting the gender specific factors.

1. Background

Helicobacter pylori is a Gram-negative bacterium in the digestive tract, which is mainly found in human gastric mucosa (1). Helicobacter pylori is an important etiological factor in multiple gastraduodenal disorders including functional peptic ulcers, dyspepsia, gastric cancer, and mucosa-related lymphoid tissue lymphoma (2). Some of these virulence effects of H. pylori are encoded by babA2, VacA, iceA, cagA, cagE, Hsp60-70, and Hpa genes, which act differently and have meager functions in pathogenesis (3). Helicobacter pylori reaches the gastric mucosa and it makes use of several adhesions such as hpa and baba; baba is one of the most studied adhesions and is encoded by the gene babA2 and binds to Lewis-b blood group antigens (4). Based on the serological document, the frequency of this agent is approximately 60% to 80% in Iran (5).
BabA is the blood group antigen-binding adhesion, which is encoded by the babA2 gene and binds to Lewis-b blood-group antigen that exists in gastric epithelial cells. There are 3 bab alleles (babA1, babA2, and babB) of H. pylori, but only the babA2 gene indicates Lewis-b binding function (6). The BabA adhesion of H. pylori is an external membrane protein that is attached to the fucosylated histo-blood group antigens on the outer surface of gastric epithelial receptors (6, 7). Duodenal users and adenocarcinoma H. pylori agglutinin (hpa) is a binding protein of H. pylori that is coded by the hpa gene and binds H. pylori to gastric mucosal cells. Weighting 29 Kda, hpa is the main flagellar sheath protein and is considered an H. pylori adhesion (8, 9); hpa is a colonization factor for H. pylori and it only gives rise to low immune responses after infection (8). Hpa was originally defined as a haemagglutinin found on the surface of the bacteria and not noticeable on the flagella (10).

2. Objectives

The present study aimed at identifying the frequency of babA2 and hpa virulence genes of H. pylori isolates in gastric biopsy samples, establishing their associations with clinical disease, and correlating these data to the presence of gastritis, peptic ulcer, gastric adenocarcinoma, and mucosa-associated lymphoid tissue (MALT) lymphoma.

3. Methods

3.1. Ethics Statement

This study was approved by the ethical committee of Golestan University of Medical Sciences (ethic code: 35619112278).

3.2. Sampling

A total of 156 antral biopsy samples were obtained from patients who referred to endoscopy section of Shahid Sayad Shriazi hospital and 5 Azar hospital (Gorgan, Iran) from January 2014 to April 2015. Patients underwent endoscopy because of gastritis, peptic ulcer, gastric adenocarcinoma, and MALT lymphoma. Gorgan is located in the middle of Golestan province in north of republic of Iran and southeast of the Caspian Sea (11). We excluded those patients who received antibiotics. All patients were asked to sign a written informed consent. The present study was conducted based on the codes of the Helsinki’s Declaration.

3.3. Identification Methods

Rapid urease test (RUT) was performed by RUT kit (Bahar Afshan, Iran) according to manufacturer’s instruction. Further hematoxylin-eosin staining and Giemsa staining were used for histologic diagnosis. The histological slides were examined by 2 independent experts in histopathology to confirm the diagnosis. DNA was extracted from H. pylori positive biopsy samples using the Genomic DNA filtration Kit (Fermentas, Germany) based on the manufacture’s protocol. Purified DNA was kept at -20°C until used. The sequence of babA and hpa genes were amplified by PCR using the correspond primers (Table 1). The amplification reaction (50 µL) contained 5 µL 10X PCR buffer, 2.5 mM Mgcl2, 0.2 mM of each dNTP, 1 µL forward and reverse primer, 5 µL DNA template, and 2U Taq-Pol (Genetbio, South Korea). The PCR cycling situations were as follow: original denaturation stage at 95 for 5 minute, 35 cycles of 95°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, and last extension phase at 72°C for 5 minutes. PCR outcomes were analyzed by 1.5% agarose gel electrophoresis premixed with ethidium bromide and visualized under a UV transilluminator.

3.4. Statistical Analysis

Statistical analysis was performed by statistical software package SPSS for Windows Version 18.00 (SPSS Inc. Illinois, USA). Chi-square test or Fisher’s exact test were used to measure the relationship between H. pylori virulence indicators and clinical effects. P values less than 0.05 were considered statistically significant.

4. Results

The infection of H. pylori was confirmed by histologic analysis and RUT. From 156 samples, a total of 80 samples were infected by H. pylori (51.28%). We identified 80 gastric cancer patients and 36 patients with gastritis, moreover, 26 peptic ulcer patients were infected by the microorganism. The babA2 + strains were found in 51 (64%) patients and hpa + strains in 57 (71%) patients, which were associated with sex (P = 0.02). From 80 samples infected with H. pylori, 36 (45%) were female and 55% were male. The primers used in this study are demonstrated in Table 1, and the frequencies of babA2 and hpa gene in the biopsies in different gastric disease are summarized in Table 2. From 51 babA2+ strains, 21 (41.1%) were peptic ulcers, 19 (37.2%) gastritis, and 11 (21.7%) gastric cancer. BabA2 and hpa genes were common in peptic ulcer participants. Moreover, there were no statistically significant differences among the groups (P > 0.05). The frequencies of babA2 and hpa genes were higher in males than in females (Table 3), and only the hpa frequency was statistically significant (P = 0.02, OR = 3.21, 95% CI: 1.16 - 8.85).
Table 1.The Primers Used in This Study
Gene NameSequence (5' - 3')Product Reference
Length
bab A2Forward: AATCCAAAAAGGAGAAAAAGTATGAAA832
Reverse: TGTTAGTGTGATTTCGGTGTAGGACA
hpaForward: ATAAAGCTTTCGGTGGTGGTGGAACGATG850
Reverse: TATCTCGAGTTGTCGGTTTCTTTGC
Table 2.Frequency of babA2 and hpa Genes in Different Studied Groupsa
Gene NameGasteric CancerGasteritisPeptic UlcerP Value
babA211 (61.1)21 (58.3)19 (73.3)0.47
hpa10 (55.5)25 (69.4)22 (84.6)0.10

aValues are expressed as No. (%).

Table 3.Frequency of babA2 and hpa Genes in Different Gender Groups (44 Males and 36 Females)
Gene NameMaleFemaleP Valuea
babA228 (63.6)23 (63.8)0.58
hpa36 (81.8)21 (58.3)0.02

aFisher’s Exact Test was applied. Bold interface indicate significant value.

5. Discussion

The clinical progress of H. pylori infection is determined by several virulence factors that might forecast the risk for symptomatic clinical results. The attachment of H. pylori to epithelial cells is an appropriate step in explicit tropism and in developing gastraduodenal pathologies and persistency of infection (12). BabA2 protein attaches H. pylori to the blood group antigen Lewis-b existing on the surface of human gastric epithelial cells (3). In the present study, we determined the frequency of babA2 and hpa in 80 H. pylori isolates from selected patients with functional dyspepsia. In the current study, the babA2 gene was found in 40% of gastric biopsies; this frequency was higher than babA2 reported by Paniagua et al. (21.7%) and lower than Boria et al. (82.3%) and Safaei et al. (71.6%) (13, 14).
Numerous documents revealed that H. pylori expression babA are related to more severe mucosal cellular inflammation and increased risk of clinical outcome diseases like active gastritis, peptic ulcer, and gastric cancer (15). The study of Cadamuro et al. revealed that occurrence of babA was significantly associated with duodenal ulcer and adenocarcinoma and would be a useful marker to identify patients who are at higher risk for H. pylori-related diseases (15). Mizushima et al. found that babA prevalence in Japan is higher than the Western countries. They detected the babA gene in 85% of their local isolates, while the rate is about 66% to 72% for the Western countries. No significant relationship was found between the babA2 genotype and the clinical outcomes (16). However, in our study, babA gene was detected in 51% of the isolates, and no association was found between the babA gene and gastraduodenal disease.
Helicobacter pylori adhesion A (hpaA), which is a conserved surface lipoprotein and is essential for colonization of H. pylori, can induce immune responses and produce anti-bodies against HpaA in humans. Furthermore, this protein is a promising vaccine candidate against H. pylori infection (17). Hpa is a strong colonization factor for H. pylori. In this study, we determined the frequency of the hpa genotype in 80 H. pylori isolates from patients with peptic ulcer or gastric adenocarcinoma. Therefore, it is difficult to explain different clinical outcomes only from virulence factors such as babA2, hpa of H. pylori. The hpa gene was found to be present in 27.5% of babA2-negative strains. In our study, the prevalence of hpa genotype was 71.2%, it was 31.2% in gastritis, 27.5% in peptic ulcer, and 12.5% in gastric cancer. Furthermore, in this study, no relationship was found between presence of babA and hpa genes and gastric disease. However, other studies have found a strong association between the occurrence of babA2 gene and DU disease.

6. Conclusions

The results of this study provided information about the prevalence of 2 virulent factors of H. pylori. However, our data did not support the hypothesis that the virulence factors of H. pylori, BabA and Hpa are powerfully related to gastric adenocarcinoma, peptic ulcer disease, and chronic active gastritis in Western countries. Moreover, we did not identify a statistically significant relationship between babA and hpa virulence factors.

Acknowledgments

Footnotes

  • Authors’ Contribution:All authors contributed to the conception and design of the study, collecting data, and analyzing and interpreting the data. Fatemeh Mehravar drafted the manuscript. All authors were involved in critically revising the article for important intellectual content and gave final approval of the version to be published. All authors read and approved the final manuscript.

  • Financial Disclosure:Heidari, Kazem Nezhad, Noroozi and Mehravar report no biomedical financial interests or potential conflicts of interest.

References

  • 1.
    Figueiredo C. Helicobacter pylori Infection. Pathology of the Gastrointestinal Tract. 2017. p. 336-41.
  • 2.
    Hassan A, Ahad A, Rahman H, Bhuiyan SH, Khan AH. Is There Any Association between Helicobacter pylori CagA Status and Patient's Habits with Gastric Carcinoma. Faridpur Med College J. 2016;10(1):9. https://doi.org/10.3329/fmcj.v10i1.27916.
  • 3.
    Kao CY, Sheu BS, Wu JJ. Helicobacter pylori infection: An overview of bacterial virulence factors and pathogenesis. Biomed J. 2016;39(1):14-23. [PubMed ID: 27105595]. https://doi.org/10.1016/j.bj.2015.06.002.
  • 4.
    Cervantes-García E. Helicobacter pylori: mecanismos de patogenicidad. Revista Latinoamericana de Patología Clínica y Medicina de Laboratorio. 2016;63(2):100-9.
  • 5.
    Eshraghian A. Epidemiology of Helicobacter pylori infection among the healthy population in Iran and countries of the Eastern Mediterranean Region: a systematic review of prevalence and risk factors. World J Gastroenterol. 2014;20(46):17618-25. [PubMed ID: 25516677]. https://doi.org/10.3748/wjg.v20.i46.17618.
  • 6.
    Hage N, Howard T, Phillips C, Brassington C, Overman R, Debreczeni J, et al. Structural basis of Lewis(b) antigen binding by the Helicobacter pylori adhesin BabA. Sci Adv. 2015;1(7). e1500315. [PubMed ID: 26601230]. https://doi.org/10.1126/sciadv.1500315.
  • 7.
    Moonens K, Gideonsson P, Subedi S, Bugaytsova J, Romao E, Mendez M, et al. Structural Insights into Polymorphic ABO Glycan Binding by Helicobacter pylori. Cell Host Microbe. 2016;19(1):55-66. [PubMed ID: 26764597]. https://doi.org/10.1016/j.chom.2015.12.004.
  • 8.
    Ahmed EAN. Determination of ABO Blood Groups and Rh phenotypes Among Sudanese Patients Infected with Helicobacter pylori–Khartoum State. Sudan University of Science & Technology; 2014.
  • 9.
    Owen RJ. Helicobacter. Topley and Wilson's Microbiology and Microbial Infections. 2005.
  • 10.
    Cesbron S, Briand M, Essakhi S, Gironde S, Boureau T, Manceau C, et al. Comparative Genomics of Pathogenic and Nonpathogenic Strains of Xanthomonas arboricola Unveil Molecular and Evolutionary Events Linked to Pathoadaptation. Front Plant Sci. 2015;6:1126. [PubMed ID: 26734033]. https://doi.org/10.3389/fpls.2015.01126.
  • 11.
    Mehravar F, Rafiee S, Bazrafshan B, Khodadost M. Prevalence of asthma symptoms in Golestan schoolchildren aged 6-7 and 13-14 years in Northeast Iran. Front Med. 2016;10(3):345-50. [PubMed ID: 27527365]. https://doi.org/10.1007/s11684-016-0462-y.
  • 12.
    Alzahrani S, Lina TT, Gonzalez J, Pinchuk IV, Beswick EJ, Reyes VE. Effect of Helicobacter pylori on gastric epithelial cells. World J Gastroenterol. 2014;20(36):12767-80. [PubMed ID: 25278677]. https://doi.org/10.3748/wjg.v20.i36.12767.
  • 13.
    Paniagua GL, Monroy E, Rodriguez R, Arroniz S, Rodriguez C, Cortes JL, et al. Frequency of vacA, cagA and babA2 virulence markers in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis. Ann Clin Microbiol Antimicrob. 2009;8:14. [PubMed ID: 19405980]. https://doi.org/10.1186/1476-0711-8-14.
  • 14.
    Ghasemian Safaei H, Havaei SA, Tavakkoli H, Eshaghei M, Navabakbar F, Salehei R. Relation of bab A2 genotype of Helicobacter pylori infection with chronic active gastritis, duodenal ulcer and non-cardia active gastritis in Alzahra hospital Isfahan, Iran. Jundishapur J Microbiol. 2010;3(3):93-8.
  • 15.
    Cadamuro AC, Rossi AF, Maniezzo NM, Silva AE. Helicobacter pylori infection: host immune response, implications on gene expression and microRNAs. World J Gastroenterol. 2014;20(6):1424-37. [PubMed ID: 24587619]. https://doi.org/10.3748/wjg.v20.i6.1424.
  • 16.
    Sedaghat H, Moniri R, Jamali R, Arj A, Razavi Zadeh M, Moosavi SG, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2, and oipA genotypes in patients with upper gastrointestinal diseases. Iran J Microbiol. 2014;6(1):14-21. [PubMed ID: 25954486].
  • 17.
    Vasquez AE, Manzo RA, Soto DA, Barrientos MJ, Maldonado AE, Mosqueira M, et al. Oral administration of recombinant Neisseria meningitidis PorA genetically fused to H. pylori HpaA antigen increases antibody levels in mouse serum, suggesting that PorA behaves as a putative adjuvant. Hum Vaccin Immunother. 2015;11(3):776-88. [PubMed ID: 25750999]. https://doi.org/10.1080/21645515.2015.1011011.

Copyright

Copyright © 2017, Jundishapur Journal of Microbiology. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

31
Jul
2010

Relation of bab A2 genotype of Helicobacter pylori infection with chronic active gastritis, duodenal ulcer and non-cardia active gastritis in Alzahra hospital Isfahan, Iran

Hajieh Ghasemian Safaei,
Seyed Asghare Havaei,
Hamid Tavakkoli,
Morteza Eshaghei,
Farahtaj Navabakbar,
Rasoul Salehei
,et al.

Ghasemian Safaei H, Havaei SA, Tavakkoli H, Eshaghei M, Navabakbar F, et al. Relation of bab A2 genotype of Helicobacter pylori infection with chronic active gastritis, duodenal ulcer and non-cardia active gastritis in Alzahra hospital Isfahan, Iran. Jundishapur J Microbiol. 2010;3(3):. doi:

20
Sep
2025
J Inflamm Dis

Studying the Prevalence of Helicobacter pylori Genotypes vacA, cagA, babA, sabA, and oipA in Patients with Gastrointestinal Problems

Rasoul Samimi,
Ali Samimi,
Ayda Ahmadi,
Hamid Hadadzadeh,
Mohadeseh Khakpour,
Fatemeh Fardsanei
,et al.

Samimi R, Samimi A, Ahmadi A, Hadadzadeh H, Khakpour M, et al. Studying the Prevalence of Helicobacter pylori Genotypes vacA, cagA, babA, sabA, and oipA in Patients with Gastrointestinal Problems. J Inflamm Dis. 2025;29(3):e161491. doi: https://doi.org/10.69107/jid-161491

10
Jun
2013

The Prevalence of Helicobacter pylori babA2, iceA1 and iceA2 Genes and Their Association with Clinical Outcomes in Patients with Chronic Gastritis, Ulcerative Diseases and Non-Ulcer Dyspepsia in South East of Iran

Hamid Abdollahi,
Mostafa shokoohi,
Mohammad Savari

Abdollahi H, shokoohi M, Savari M. The Prevalence of Helicobacter pylori babA2, iceA1 and iceA2 Genes and Their Association with Clinical Outcomes in Patients with Chronic Gastritis, Ulcerative Diseases and Non-Ulcer Dyspepsia in South East of Iran. Jundishapur J Microbiol. 2013;6(4):e4739. doi: https://doi.org/10.5812/jjm.4739

29
Sep
2020
Jundishapur Journal of Microbiology

Association of cagA, cagC, virB2, and vacA Subtypes of Helicobacter pylori with Adenocarcinoma Development in Iranian Patients

Pouya Khodadadi,
Mohammad Kargar,
Mahdi Bijanzadeh,
Abbas Doosti,
Shapoor Aghaei

Khodadadi P, Kargar M, Bijanzadeh M, Doosti A, Aghaei S. Association of cagA, cagC, virB2, and vacA Subtypes of Helicobacter pylori with Adenocarcinoma Development in Iranian Patients. Jundishapur J Microbiol. 2020;13(7):e101275. doi: https://doi.org/10.5812/jjm.101275

22
Nov
2015

High Frequency of vacA s1m2 Genotypes Among Helicobacter pylori Isolates From Patients With Gastroduodenal Disorders in Kermanshah, Iran

Hamid Pajavand,
Amirhooshang Alvandi,
Parviz Mohajeri,
Somaye Bakhtyari,
Homayoon Bashiri,
Behnam Kalali
,et al.

Pajavand H, Alvandi A, Mohajeri P, Bakhtyari S, Bashiri H, et al. High Frequency of vacA s1m2 Genotypes Among Helicobacter pylori Isolates From Patients With Gastroduodenal Disorders in Kermanshah, Iran. Jundishapur J Microbiol. 2015;8(11):e25425. doi: https://doi.org/10.5812/jjm.25425

Download PDF111.51 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles