Jundishapur Journal of Microbiology

Image Credit:Jundishapur Journal of Microbiology

Molecular and Virulence Characteristics of Methicillin-Resistant Staphylococcus aureus Bacteria Recovered From Hospital Cockroaches

Author(s):
Zohreh AbdolmalekiZohreh Abdolmaleki1,*, Zohreh MashakZohreh MashakZohreh Mashak ORCID2, Farhad Safarpoor DehkordiFarhad Safarpoor DehkordiFarhad Safarpoor Dehkordi ORCID3
1Department of Pharmacology, Karaj Branch, Islamic Azad University, Karaj, Iran
2Department of Food Hygiene, Karaj Branch, Islamic Azad University, Karaj, Iran
3Halal Research Center of IRI, FDA, Tehran, Iran

Jundishapur Journal of Microbiology:Vol. 12, issue 12; e98564
Published online:Feb 17, 2020
Article type:Research Article
Received:Oct 01, 2019
Accepted:Jan 11, 2020
How to Cite:Abdolmaleki Z, Mashak Z, Safarpoor Dehkordi F. Molecular and Virulence Characteristics of Methicillin-Resistant Staphylococcus aureus Bacteria Recovered From Hospital Cockroaches. Jundishapur J Microbiol. 2019;12(12):e98564. doi: https://doi.org/10.5812/jjm.98564

Abstract

Background:

Methicillin-resistant Staphylococcus aureus (MRSA) is the most imperative cause of nosocomial infections. Cockroaches are the routine insects accountable for the spread of resistant bacterial strains, exclusively MRSA.

Objectives:

The current survey aimed to appraise the frequency of Panton-Valentine leucocidin (PVL) and Staphylococcal cassette chromosome mec (SCCmec) in MRSA bacteria recovered from hospital cockroaches.

Methods:

Thirty-six MRSA isolates were recovered from the external washing samples of American and German hospital cockroaches. Bacteria were subjected to the PCR amplification of SCCmec types and the PVL gene.

Results:

The SCCmec types III (44.44%), I (27.77%), and II (16.66%) were the most frequent types among MRSA bacteria. The frequency of SCCmec types IVa, IVd, and V was 2.77%, 2.77%, and 5.55%, respectively. The SCCmec types IVb and IVc were not detected in the assessed samples. Twelve out of 36 (33.33%) MRSA isolates harbored the PVL gene. The frequency of the PVL gene was 35.71% and 25%, respectively, among MRSA bacteria recovered from Periplaneta americana and Blattella germanica hospital cockroaches.

Conclusions:

The current research is an initial description of SCCmec types and the PVL gene among MRSA bacteria recovered from hospital cockroaches. High frequency of SCCmec types I, II, and III and moderate-to-low frequency of the PVL gene signify the occurrence of health care associated-MRSA.

1. Background

Cockroaches are one of the predominant insects in residential environments including health care settings and hospitals. They have been tremendously fruitful in misusing the spaces within human habitation. Cockroaches are recognized for survival, transmission, and spread of hazardous microbial pathogens (1, 2). Two of the most imperative and mutual cockroach species originated in Iranian hospitals are American (Periplaneta americana) and German cockroaches (Blattella germanica). Periplaneta americana is larger and typically has a glossy reddish-brown color (1, 2). Both of them are acknowledged as the reservoirs of pathogenic bacteria, predominantly Staphylococcus aureus (3, 4).

Staphylococcus aureus usually exists in the nose, respiratory tract, and the skin (5). It is accountable for the outbreaks of nosocomial and community-acquired infections including wound and burn infections, urinary tract infections (UTIs), respiratory tract infections (RTIs), blood and soft tissues infections, food-borne diseases, and food poisoning (5). Staphylococcus aureus is habitually resistant toward numerous types of antibiotic agents (6-9). Some of them are resistant toward methicillin antibiotics, which are named as methicillin-resistant S. aureus (MRSA). Methicillin-resistant S. aureus bacteria have a boosted irrefutable standing owing to their substantial resistance toward various types of antibiotics, leading to their higher pathogenicity (6-9).

Staphylococcal chromosomal cassette mec (SCCmec) is a genetic division of the MRSA bacteria accompanying with the mecA gene and is responsible for virulent characteristics (10). It is predominantly originated in MRSA bacteria of the hospital environment. It is characteristically grouped into types I, II, III, IV, and V rendering to ccr and mec alleles (10). The SCCmec type IV is further grouped into a, b, c, and d types (10). The pathogenicity of MRSA bacteria correspondingly relies on abundant surface antigens and extracellular proteins. MRSA strains are mainly produce leukocidal toxins, which suggests that Panton-Valentine leucocidin (PVL) is one of the most imperative virulence factors with substantial contribution to the pathogenicity of diseases caused by MRSA bacteria (11).

2. Objectives

The current survey was performed to measure the frequency of SCCmec types and the PVL gene among MRSA bacteria recovered from external washing samples of P. americana and B. germanica hospital cockroaches.

3. Methods

3.1. Bacteria and Further Identification

We recovered 36 MRSA isolates from external washing samples of hospital cockroaches (12). Cockroaches were obtained from private hospitals of Tehran Province, Iran, using standard traps (13). After immobilization by freezing (0°C for 5 min), the species of cockroaches were identified under a dissecting microscope according to the method by Harwood and James (14). Methicillin-resistant S. aureus bacteria were recovered from P. americana and B. germanica hospital cockroaches based on a previously described procedure (13). Methicillin-resistant S. aureus bacteria were confirmed using cefoxitin (30 µg) and oxacillin (1 µg) susceptibility tests. Examinations were done based on the guidelines of the Clinical and Laboratory Standards Institute (CLSI) (15).

3.2. DNA Extraction

Methicillin-resistant S. aureus bacteria cultured on the tryptic soy broth (Merck, Germany) medium were analyzed by the DNA extraction kit (Thermo Fisher Scientific, Germany) following the manufacturer’s guidelines. Purity, quality, and quantity of DNA were assessed using the previously described procedures (6, 12).

3.3. PCR-Based Detection of SCCmec Types and PVL Gene

Table 1 exemplifies the PCR circumstances applied for the identification of SCCmec types and the PVL gene (16, 17). A programmable DNA thermo-cycler (Eppendorf Mastercycler 5330, Germany) was used for this purpose. Amplified samples were apprised by electrophoresis based on a previously described technique (16, 17).

Table 1.Target Genes and Oligonucleotide Primers Used for Detection of SCCmec Types and PVL Gene in MRSA Bacteria Recovered From Hospital Cockroaches (17, 18)
Target GenePrimer Sequence (5’ - 3’)PCR Product, bpPCR Program, sPCR Volume (50 µL)
SCCmec IF: GCTTTAAAGAGTGTCGTTACAGG6131 cycle: 93°C, 7 min. 10 cycles: 93°C C, 55 s; 64 °C, 50 s; 72°C, 2 min. 25 cycles: 94°C, 45 s; 55°C C, 45 s; °C, 2 min. 1 cycle: 72°C, 10 min5 µL PCR buffer 10×; 2 mM MgCl2; 150 µM dNTP (fermentas); 0.75 µM of each primers F & R; 1.5 U Taq DNA polymerase (fermentas) ; 3 µL DNA template
R: GTTCTCTCATAGTATGACGTCC
SCCmec IIF: CGTTGAAGATGATGAAGCG398
R: CGAAATCAATGGTTAATGGACC
SCCmec IIIF: CCATATTGTGTACGATGCG280
R: CCTTAGTTGTCGTAACAGATCG
SCCmec IVaF: GCCTTATTCGAAGAAACCG776
R: CTACTCTTCTGAAAAGCGTCG
SCCmec IVbF: TCTGGAATTACTTCAGCTGC493
R: AAACAATATTGCTCTCCCTC
SCCmec IVcF: ACAATATTTGTATTATCGGAGAGC200
R: TTGGTATGAGGTATTGCTGG
SCCmec IVdF: CTCAAAATACGGACCCCAATACA881
R: TGCTCCAGTAATTGCTAAAG
SCCmec VF: GAACATTGTTACTTAAATGAGCG325
R: TGAAAGTTGTACCCTTGACACC
PVLF: ATCATTAGGTAAAATGTCTGGACATGATCCA4331 cycle: 94°C, 5 min. 30 cycle: 94°C, 30 s; 55 °C, 30 s; 72°C, 30 s. 1 cycle: 72°C, 5 min5 µL PCR buffer 10×; 2 mM MgCl2; 150 µM dNTP (fermentas); 0.75 µM of each primers F & R; 1.5 U Taq DNA polymerase (fermentas) ; 3 µL DNA template
R: GCATCAASTGTATTGGACATGATCCA

3.4. Statistical Analysis

Statistical analysis was done using SPSS 21.0 Numerical software (SPSS Inc., Chicago, IL, USA). The chi-square test and Fisher’s exact two-tailed test were applied to assess any significant relationship between the frequency of SCCmec types and the PVL gene among MRSA bacteria. A P value of < 0.05 was considered the significance level.

4. Results

4.1. SCCmec Types

Figure 1 signifies the results of the gel electrophoresis of the SCCmec types found in MRSA bacteria. Table 2 shows the frequency of SCCmec types and the PVL gene among MRSA bacteria. We observed that SCCmec III (44.44%), I (27.77%), and II (16.66%) were the most frequent types among MRSA bacteria. There were no SCCmec types IVb and IVc among MRSA bacteria. The frequency of SCCmec type I was 28.57% and 25%, type II was 17.85% and 12.50%, and type IIIs was 42.85% and 50% among P. americana and B. germanica hospital cockroaches, respectively. Statistical significant difference was found between kind of samples and frequency of SCCmec types (P < 0.05).

Outcomes of the gel electrophoresis of the <i>SCCmec</i> kinds perceived in the MRSA bacteria
Figure 1.

Outcomes of the gel electrophoresis of the SCCmec kinds perceived in the MRSA bacteria

Table 2.Frequency of SCCmec Types and PVL Gene Among MRSA Bacteria Recovered From External Washing Samples of Hospital Cockroachesa
Samples (Number of Positive for MRSA)Number of Positive Samples for Each SCCmec Type (%)Number of Positive Samples for PVL Gene (%)
IIIIIIIVV
abcd
P. americana (n = 28)8 (28.57)5 (17.85)12 (42.85)1 (3.57)--1 (3.57)1 (3.57)10 (35.71)
B. germanica (n = 8)2 (25)1 (12.50)4 (50)----1 (12.50)2 (25)
Total (n = 36)10 (27.77)6 (16.66)16 (44.44)1 (2.77)--1 (2.77)2 (5.55)12 (33.33)

aValues are expressed as No. (%).

4.2. PVL Gene Frequency

Figure 2 signifies the results of the gel electrophoresis of the PVL gene in MRSA bacteria. Twelve out of 36 (33.33%) MRSA bacteria harbored the PVL gene. The frequency of the PVL gene was 35.71% and 25% among MRSA bacteria isolated from P. americana and B. germanica hospital cockroaches, respectively. Statistical significant difference was found between d of samples and frequency of the PVL gene (P < 0.05).

Outcomes of the gel electrophoresis of the <i>PVL</i> gene perceived in the MRSA bacteria
Figure 2.

Outcomes of the gel electrophoresis of the PVL gene perceived in the MRSA bacteria

5. Discussion

Cockroaches are regarded as the sources of diverse types of antibiotic-resistant bacteria. They correspondingly can be the vectors for the transmission of numerous diseases into human inhabitants, predominantly in public places such as hospitals (18). The results of the current survey signified that MRSA bacteria recovered from hospital cockroach samples harbored the PVL gene and various types of SCCmec units. Methicillin-resistant S. aureus bacteria harbored a high frequency of SCCmec types III, I, and II. Methicillin-resistant S. aureus is usually sub-categorized into healthcare-associated MRSA (HA-MRSA) and community-associated MRSA (CA-MRSA). Epidemiological surveys show that HA-MRSA bacteria harbor SCCmec I, II, or III while CA-MRSA bacteria harbor SCCmec types IV or V (19). Furthermore, HA-MRSA bacteria have a lower frequency of the PVL gene than CA-MRSA bacteria (19). Consequently, the majority of MRSA bacteria recovered from external washing samples of hospital cockroaches were HA-MRSA.

The possible reason for the higher frequency of HA-MRSA bacteria in the examined samples is that external washing samples of hospital cockroaches contained MRSA bacteria of the hospital environment, which were carried owing to the contact of the exterior parts of the cockroach’s bodies with the sources of infections existed in the hospitals. The previously available data convey that the majority of PVL-positive S. aureus bacteria are related to soft tissue and skin infections (20). Consequently, PVL-positive MRSA bacteria recovered from hospital cockroaches may originate from the cases of soft tissue infections in hospitals. Methicillin-resistant S. aureus has been presented as one of the most predominant pathogenic bacteria recovered from B. germanica and P. americana cockroaches (3, 4, 21-23). Nevertheless, the isolation of the SCCmec types and the PVL gene among MRSA bacteria recovered from hospital cockroaches was not scrutinized beforehand.

Borbon-Esquer et al. (24) conveyed that of 102 MRSA bacteria recovered from hospitalized children in Mexico, 97 (95%) harbored SCCmec type II, 5 (5%) harbored SCCmec type Iva, and all (100%) of them were PVL-negative. Momtaz and Hafezi (25) conveyed that SCCmec type III (24.52%) had the highest frequency among MRSA bacteria recovered from clinical infections. They signified that the frequency of the PVL gene was 40.90%. Higher frequency of SCCmec types I, II, and III was also reported from India (26), Saudi Arabia (27), and Brazil (28). Goudarzi et al. (29) indicated that diverse SCCmec types including SCCmec type III (38.9%), II (31.1%), IV (28.9%), and I (1.1%) were obtained from MRSA bacteria recovered from the cases of UTIs in Iran.

We showed that only 33.33% of the MRSA bacteria harbored the PVL gene. The PVL gene is one of the main exotoxins of MRSA. The occurrence of the PVL gene in MRSA bacteria recovered from clinical infections was also reported beforehand (30, 31). The occurrence of the PVL gene among SCCmec types I, II, and III bacteria was also conveyed by Lima et al. (32) and Glikman et al. (33). Nevertheless, PVL-positive isolates were not discovered in SCCmec types I, II, and III bacteria in previous research (34, 35). Consequently, it can be concluded that the existence of the PVL gene is not an explanatory factor for CA-MRSA, as it may be existed in HA-MRSA or maybe absent from CA-MRSA.

It is known that SCCmec types I, II, and III are present in HA-MRSA strains and SCCmec types IV and V are present in CA-MRSA strains. The studied cockroaches could move freely inside and outside the hospital environment. Thus, they could carry both HA-MRSA (from the hospital environment) and CA-MRSA (from outside the hospital environment) strains as reported in our survey. Thus, it is not surprising that both CA-MRSA and HA-MRSA strains were found in the studied samples. Additionally, MRSA bacteria isolated from B. germanica and P. americana cockroaches harbored various SCCmec types. This may be probably because of differences in the type of feeding, lifestyle, and crossing paths and diverse living locations of the two cockroach species inside or outside the hospital environment.

5.1. Conclusions

The current survey is an initial description of the identification of SCCmec types and the PVL gene among MRSA bacteria recovered from external washing samples of hospital cockroaches. High frequency of SCCmec types I, II, and III and comparatively low frequency of the PVL gene characterize the occurrence of HA-MRSA bacteria in B. germanica and P. americana hospital cockroaches. This finding discloses an imperative public health hazard concerning the attendance of HA-MRSA bacteria in hospital cockroaches. The results showed that B. germanica and P. americana hospital cockroaches are the reservoirs of MRSA bacteria in the hospital environment. Further surveys are mandatory to gain supplementary information about the epidemiological share of hospital cockroaches in the survival and transmission of MRSA bacteria.

Footnotes

References

  • 1.
    Moges F, Eshetie S, Endris M, Huruy K, Muluye D, Feleke T, et al. Cockroaches as a source of high bacterial pathogens with multidrug resistant strains in Gondar Town, Ethiopia. Biomed Res Int. 2016;2016:2825056. [PubMed ID: 27340653]. [PubMed Central ID: PMC4909895]. https://doi.org/10.1155/2016/2825056.
  • 2.
    Fakoorziba MR, Eghbal F, Hassanzadeh J, Moemenbellah-Fard MD. Cockroaches (Periplaneta americana and Blattella germanica) as potential vectors of the pathogenic bacteria found in nosocomial infections. Ann Trop Med Parasitol. 2010;104(6):521-8. [PubMed ID: 20863441]. https://doi.org/10.1179/136485910X12786389891326.
  • 3.
    Akinjogunla OJ, Odeyemi AT, Udoinyang EP. Cockroaches (periplaneta americana and blattella germanica): Reservoirs of multi drug resistant (MDR) bacteria in Uyo, Akwa Ibom State. Sci J Biol Sci. 2012;1(2):19-30.
  • 4.
    Menasria T, Moussa F, El-Hamza S, Tine S, Megri R, Chenchouni H. Bacterial load of German cockroach (Blattella germanica) found in hospital environment. Pathog Glob Health. 2014;108(3):141-7. [PubMed ID: 24766338]. [PubMed Central ID: PMC4083176]. https://doi.org/10.1179/2047773214Y.0000000136.
  • 5.
    Wang L, Ruan S. Modeling nosocomial infections of methicillin-resistant Staphylococcus aureus with environment contamination. Sci Rep. 2017;7(1):580. [PubMed ID: 28373644]. [PubMed Central ID: PMC5428062]. https://doi.org/10.1038/s41598-017-00261-1.
  • 6.
    Safarpoor Dehkordi F, Gandomi H, Basti AA, Misaghi A, Rahimi E. Phenotypic and genotypic characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital food. Antimicrob Resist Infect Control. 2017;6:104. [PubMed ID: 29034091]. [PubMed Central ID: PMC5628482]. https://doi.org/10.1186/s13756-017-0257-1.
  • 7.
    Safarpoor Dehkordi F, Basti AA, Gandomi H, Misaghi A, Rahimi E. Pathogenic Staphylococcus aureus in hospital food samples; prevalence and antimicrobial resistance properties. J Food Safe. 2018;38(6). e12501. https://doi.org/10.1111/jfs.12501.
  • 8.
    Momtaz H, Safarpoor Dehkordi F, Rahimi E, Asgarifar A, Momeni M. Virulence genes and antimicrobial resistance profiles of Staphylococcus aureus isolated from chicken meat in Isfahan Province, Iran. J App Poult Res. 2013;22(4):913-21. https://doi.org/10.3382/japr.2012-00673.
  • 9.
    Hasanpour Dehkordi A, Khaji L, Sakhaei Shahreza MH, Mashak Z, Safarpoor Dehkordi F, Safaee Y, et al. One-year prevalence of antimicrobial susceptibility pattern of methicillin-resistant Staphylococcus aureus recovered from raw meat. Trop Biomed. 2017;34(2):396-404.
  • 10.
    Liu J, Chen D, Peters BM, Li L, Li B, Xu Z, et al. Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus. Microb Pathog. 2016;101:56-67. [PubMed ID: 27836760]. https://doi.org/10.1016/j.micpath.2016.10.028.
  • 11.
    Shahini Shams Abadi M, Nikokar I, Hoseini Alfatemi SM, Malekzadegan Y, Azizi A, Sedigh Ebrahim-Saraie H. Epidemiology of Panton-Valentine Leukocidin harbouring Staphylococcus aureus in cutaneous infections from Iran: A systematic review and meta-analysis. Infez Med. 2017;25(3):217-223. [PubMed ID: 28956538].
  • 12.
    Abdolmaleki Z, Mashak Z, Safarpoor Dehkordi F. Phenotypic and genotypic characterization of antibiotic resistance in the methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches. Antimicrob Resist Infect Control. 2019;8:54. [PubMed ID: 30911380]. [PubMed Central ID: PMC6416839]. https://doi.org/10.1186/s13756-019-0505-7.
  • 13.
    Reierson DA, Rust MK. Trapping, flushing, counting German roaches [Blatella germanica]. Pest Control (USA). 1977;40:42-4.
  • 14.
    Harwood RF, James MT. Entomology in human and animal health. 7th ed. New York: Macmillan Publishing Co. Inc; 1979.
  • 15.
    CLSI. Performance standards for antimicrobial susceptibility testing; 17th informational supplement. Clinical and Laboratory Standards Institute; 2007. Report No.: M100-S17.
  • 16.
    Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43(10):5026-33. [PubMed ID: 16207957]. [PubMed Central ID: PMC1248471]. https://doi.org/10.1128/JCM.43.10.5026-5033.2005.
  • 17.
    Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999;29(5):1128-32. [PubMed ID: 10524952]. https://doi.org/10.1086/313461.
  • 18.
    Pai HH, Chen WC, Peng CF. Isolation of bacteria with antibiotic resistance from household cockroaches (Periplaneta americana and Blattella germanica). Acta Trop. 2005;93(3):259-65. [PubMed ID: 15716054]. https://doi.org/10.1016/j.actatropica.2004.11.006.
  • 19.
    Asghar AH. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals. Pak J Med Sci. 2014;30(4):698-702. [PubMed ID: 25097499]. [PubMed Central ID: PMC4121680]. https://doi.org/10.12669/pjms.304.4946.
  • 20.
    Bhatta DR, Cavaco LM, Nath G, Kumar K, Gaur A, Gokhale S, et al. Association of Panton Valentine Leukocidin (PVL) genes with methicillin resistant Staphylococcus aureus (MRSA) in Western Nepal: A matter of concern for community infections (a hospital based prospective study). BMC Infect Dis. 2016;16:199. [PubMed ID: 27179682]. [PubMed Central ID: PMC4867903]. https://doi.org/10.1186/s12879-016-1531-1.
  • 21.
    Islam A, Nath AD, Islam K, Islam S, Chakma S, Hossain MB, et al. Isolation, identification and antimicrobial resistance profile of Staphylococcus aureus in Cockroaches (Periplaneta americana). J Adv Vet Anim Res. 2016;3(3):221-8. https://doi.org/10.5455/javar.2016.c153.
  • 22.
    Feizhaddad MH, Kassiri H, Sepand MR, Ghasemi F. Bacteriological survey of American cockroaches in hospitals. Middle East J Sci Res. 2012;12(7):985-9.
  • 23.
    Kassiri H, Kazemi S. Cockroaches [periplaneta Americana (L.), dictyoptera; blattidae] as carriers of bacterial pathogens, Khorramshahr County, Iran. Jundishapur J Microbiol. 2012;5(1):320-2. https://doi.org/10.5812/kowsar.20083645.2434.
  • 24.
    Borbon-Esquer EM, Villasenor-Sierra A, Martinez-Lopez E, Jauregui-Lomeli JJ, Villasenor-Martinez R, Ruiz-Briseno Mdel R. SCCmec types and pvl gene in methicillin-resistant Staphylococcus aureus strains from children hospitalized in a tertiary care hospital in Mexico. Scand J Infect Dis. 2014;46(7):523-7. [PubMed ID: 24832853]. https://doi.org/10.3109/00365548.2014.912349.
  • 25.
    Momtaz H, Hafezi L. Meticillin-resistant Staphylococcus aureus isolated from Iranian hospitals: Virulence factors and antibiotic resistance properties. Bosn J Basic Med Sci. 2014;14(4):219-26. [PubMed ID: 25428674]. [PubMed Central ID: PMC4333963]. https://doi.org/10.17305/bjbms.2014.4.34.
  • 26.
    D'Souza N, Rodrigues C, Mehta A. Molecular characterization of methicillin-resistant Staphylococcus aureus with emergence of epidemic clones of sequence type (ST) 22 and ST 772 in Mumbai, India. J Clin Microbiol. 2010;48(5):1806-11. [PubMed ID: 20351212]. [PubMed Central ID: PMC2863868]. https://doi.org/10.1128/JCM.01867-09.
  • 27.
    Moussa I, Kabli SA, Hemeg HA, Al-Garni SM, Shibl AM. A novel multiplex PCR for molecular characterization of methicillin resistant Staphylococcus aureus recovered from Jeddah, Kingdom of Saudi Arabia. Indian J Med Microbiol. 2012;30(3):296-301. [PubMed ID: 22885195]. https://doi.org/10.4103/0255-0857.99490.
  • 28.
    Cavalcante FS, Abad ED, Lyra YC, Saintive SB, Ribeiro M, Ferreira DC, et al. High prevalence of methicillin resistance and PVL genes among Staphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis. Braz J Med Biol Res. 2015;48(7):588-94. [PubMed ID: 25992644]. [PubMed Central ID: PMC4512096]. https://doi.org/10.1590/1414-431X20154221.
  • 29.
    Goudarzi M, Abiri P, Nasirian S, Ghaderi Afshari S. SCCmec and spa typing of Staphylococcus aureus strains isolated from patients with urinary tract infection: Emergence of spa types t426 and t021 in Iran. Jundishapur J Microbiol. 2018;11(5). e62169. https://doi.org/10.5812/jjm.62169.
  • 30.
    Shrestha B, Singh W, Raj VS, Pokhrel BM, Mohapatra TM. High prevalence of Panton-Valentine leukocidin (PVL) genes in nosocomial-acquired Staphylococcus aureus isolated from tertiary care hospitals in Nepal. Biomed Res Int. 2014;2014:790350. [PubMed ID: 25045702]. [PubMed Central ID: PMC4087282]. https://doi.org/10.1155/2014/790350.
  • 31.
    Kong H, Fang L, Jiang R, Tong J. Distribution of sasX, pvl, and qacA/B genes in epidemic methicillin-resistant Staphylococcus aureus strains isolated from East China. Infect Drug Resist. 2018;11:55-9. [PubMed ID: 29386909]. [PubMed Central ID: PMC5765971]. https://doi.org/10.2147/IDR.S153399.
  • 32.
    Lima DF, Brazao NB, Folescu TW, Neves FP, Ferreira AG, Santos EA, et al. Panton-Valentine leukocidin (PVL) gene carriage among Staphylococcus aureus strains with SCCmec types I, III, IV, and V recovered from cystic fibrosis pediatric patients in Brazil. Diagn Microbiol Infect Dis. 2014;78(1):59-62. [PubMed ID: 24211217]. https://doi.org/10.1016/j.diagmicrobio.2013.10.004.
  • 33.
    Glikman D, Siegel JD, David MZ, Okoro NM, Boyle-Vavra S, Dowell ML, et al. Complex molecular epidemiology of methicillin-resistant staphylococcus aureus isolates from children with cystic fibrosis in the era of epidemic community-associated methicillin-resistant S aureus. Chest. 2008;133(6):1381-7. [PubMed ID: 18347206]. https://doi.org/10.1378/chest.07-2437.
  • 34.
    Mimica MJ, Berezin EN, Damaceno N, Carvalho RB. SCCmec type IV, PVL-negative, methicillin-resistant Staphylococcus aureus in cystic fibrosis patients from Brazil. Curr Microbiol. 2011;62(2):388-90. https://doi.org/10.1007/s00284-010-9718-y.
  • 35.
    Reiter KC, Machado AB, Freitas AL, Barth AL. High prevalence of methicillin-resistant Staphylococcus aureus with SCCmec type III in cystic fibrosis patients in southern, Brazil. Rev Soc Bras Med Trop. 2010;43(4):377-81. [PubMed ID: 20802934]. https://doi.org/10.1590/s0037-86822010000400008.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles