84157

Image Credit:84157

Could the “Stiff Rim Sign” Be an Indicator of Lysyl Oxidase Activity in Breast Cancer?

Author(s):
Yasemin KayadibiYasemin KayadibiYasemin Kayadibi ORCID1,*, Fahrettin KılıçFahrettin KılıçFahrettin Kılıç ORCID2, Omer Faruk KaratasOmer Faruk Karatas3, Sennur IlvanSennur IlvanSennur Ilvan ORCID4, Emel Ure EsmererEmel Ure EsmererEmel Ure Esmerer ORCID5, Turgut KayadibiTurgut KayadibiTurgut Kayadibi ORCID6, Mehmet Halit YılmazMehmet Halit Yılmaz2
1Department of Radiology, Van Training and Research Hospital, Van, Turkey
2Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey
3Department of Molecular Biology and Genetics, Erzurum Technical University, Erzurum, Turkey
4Department of Pathology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey
5Department of Radiology, Hakkari Hospital, Hakkari, Turkey
6Department of Plastic Surgery, Van Training and Research Hospital, Van, Turkey

IJ Radiology:Vol. 16, issue 3; e84157
Published online:Jun 03, 2019
Article type:Research Article
Received:Sep 10, 2018
Accepted:Apr 13, 2019
How to Cite:Kayadibi Y, Kılıç F, Karatas OF, Ilvan S, Esmerer EU, et al. Could the “Stiff Rim Sign” Be an Indicator of Lysyl Oxidase Activity in Breast Cancer?. I J Radiol. 2019;16(3):e84157. doi: https://doi.org/10.5812/iranjradiol.84157

Abstract

Background:

Shear wave elastography (SWE) is a non-invasive and easily applicable imaging modality, which can provide quantitative information of tissue stiffness. Peritumoral high SWE elasticity values (stiff rim sign) has been reported in many studies. Lysyl oxidase (LOX) enzyme is implicated in the formation of peri-tumoral stiffness.

Objectives:

The aim of the study was to investigate the correlation between SWE measures with LOX gene expression levels in breast cancer patients.

Patients and Methods:

Forty seven women were included in the study. The lesions evaluated by SWE and ultrasound guided tru-cut biopsies were performed from both of the central and peripheral parts. SWE values, LOX family gene expression levels, histopathological features of the lesions, as well as axillary and distant metastasis statuses were evaluated statistically.

Results:

Thirty of the patients had breast cancer (BC) (the patient group) and 17 of them had fibroadenoma (the control group). Lysyl oxidase like1 (LOXL1) expression level in BC samples (central parts) were found to be significantly higher than the control group (P = 0.022). Stiff rim sign was present in all BC lesions and none of the control group. The elastography values of the patient group were significantly higher than the control group statistically (P < 0.05). There was no statistically significant relationship between LOX, LOXL1, LOXL2 expressions and SWE parameters (P > 0.05) both for patient and control groups.

Conclusion:

Although there were no significant correlations between LOX expressions and SWE parameters in our study, axillary and distant metastasis were found to be correlated with SWE features, which emphasized the prognostic potential of SWE.

1. Background

The characteristic stiffness of tumors is attributable to collagen crosslinking in the extracellular matrix (ECM) (1, 2). Lysyl oxidase (LOX) is a copper-dependent enzyme catalyzing lysine-dependent crosslink formation in collagen fibers, which is an essential step in collagen fiber formation in ECM (3, 4). The LOX enzyme family consists of LOX enzyme per se and four LOX-like (LOXL1-2-3-4) proteins. Lysyl oxidase, lysyl oxidase like1 (LOXL1), and lysyl oxidase like2 (LOXL2) were found to be associated with breast cancer (BC). LOX was attained maximal levels in front of the area of tumor infiltration and the peripheral fibrotic stroma as pre-metastatic niche formation in the study of Peyrol et al. Increased metastasis and poor prognosis have been shown to be associated with increased LOX expression (5, 6). Patient-specific anti-tumoral biological agents like LOX inhibitors (magnolol and beta-aminopropionitrile) hold promise in the treatment of BC with evolving technology (7).
Shear wave elastography (SWE) is an imaging modality that both reveals and quantifies tissue stiffness (8). It has been reported that elastographic examination shows peritumoral increased stiffness in BC lesions and the “stiff rim sign” is usually used to express these high SWE values measured from peritumoral stroma rather than the tumor itself (8, 9). This phenomenon can be explained by different mechanisms. First, the development of a desmoplastic reaction against tumor cells may serve as the initial defense against tumor cell infiltration (10, 11). Second, low amplitude (or “noisy”) shear waves are attributable to attenuation of sound waves passing through peritumoral tissue (9, 12). Third, peritumoral stiffness may indicate the presence of abnormal tumor-associated collagen fibers and pathological storage thereof in peritumoral tissue (13, 14).
A positive correlation between total fiber collagen area and maximum elasticity determined by SWE has been recently reported in a study of Wang et al. (14). However, up to the present, there was no study about the relationship between SWE and LOX expression levels, which could interpret the SWE values in routine practice.

2. Objectives

Is the peritumoral stiff rim sign that we have detected with SWE an indirect indicator of LOX enzyme activity? If so, SWE could be used in the evaluation of LOX enzyme activity indirectly. In this study, we sought the possible correlation between peritumoral stiff rim sign and LOX enzyme.

3. Patients and Methods

3.1. Patients

This prospective study was approved by the ethics committee of Istanbul University, Cerrahpasa Medical Faculty, and was designed in accordance with the Declaration of Helsinki. Patients’ written informed consent forms were obtained before the study. Following the ethical approval, the study was conducted between October 2014 and March 2015. Forty seven women with single breast lesion according to previous sonographic imaging features, who were referred to the radiology department for ultrasound (US) guided core biopsies were included in this study. Patients were divided into two groups according to their histopathological diagnosis. The patients with BC were considered as “patient group”. On the other hand, the patients with benign tumoral lesion such as fibroadenoma were considered as the “control group”. The current clinical data of the patients including age, lymph node, and distant metastasis were collected from hospital information system after the pathologic diagnoses. Previous breast surgery history, previous diagnosis of breast cancer, chemo or radiotherapy history for any other malignancy and being under age of 18 were our exclusion criteria.

3.2. Imaging Technique

Grayscale ultrasonography (US) and SWE were performed using Aixplorer system (SuperSonic Imagine, Aix-en-Provence, France) equipped with 4 - 15 MHz linear-array transducer. Shear wave velocity colormap was placed over the lesion and while avoiding artifacts, at least one stabilized SWE image for each lesion was acquired by the same single radiologist (YK). A 2 mm circular region of interest (ROI), Q-box, was placed over the stiffest part of the lesion as recommended before (15, 16). Another ROI was placed to the adjacent adipose tissue in the same distance to skin for comparison. Maximum stiffness (Emax), mean stiffness (Emean), SWE-standard deviation (SWE-SD) and lesion-to-fat elasticity ratio (E-ratio) parameters of the lesion were automatically calculated by the system. The presence of a stiff rim sign (higher elasticity from peritumoral tissue than the lesion itself in the range of SWE which was set up at 180 kpa) in the lesions was agreed according to the criteria previously defined by Zhou et al. (9) Final decisions of the SWE features were made with consensus agreement between two radiologists (YK and FK).

3.3. US-Guided Core Biopsy Procedure

After SWE examination, US-guided core biopsy was performed by 14-G biopsy needle (Max-Core®, Bard Biopsy Systems, AZ, USA). The biopsies were performed from the central-tumoral core and peripheral-peritumoral tissue (from the area that corresponds to the hardest part on the SWE images) of the lesions separately. Specimens were collected into Eppendorf tubes, immediately frozen, and kept in -80°C refrigerators until ribonucleotide acid (RNA) extraction for gene expression analysis. In addition, simultaneously taken specimens sent to pathological examination were placed in formalin. Materials were taken from the perilesional area and the center of the lesions, were sent separately to both the genetics and pathology laboratories.

3.4. cDNA Synthesis and Gene Expression Analysis

Total RNA was extracted from equal amounts of tissue materials obtained from participants using “TRIzol” (Invitrogen, United States) reagent in accordance with the manufacturer’s instructions. The purities and concentrations of RNA samples were evaluated spectrophotometrically using NanoDrop ND-2000c (Thermo Fisher Scientific, Wilmington, DE). 1000 ng RNA from each sample was reverse transcribed into complementary DNA (cDNA) using “Transcriptor High Fidelity cDNA synthesis kit” (Roche, Switzerland), following the manufacturer’s instructions. SYBR Green Master Mix of Roche in a LightCycler480-II real-time thermal cycler (Roche) was used for quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Reactions were performed using the following primer pairs; LOX forward 5'- CGTACGTGCAGAAGATGTCC -3', LOX reverse 5'- AAATCTGAGCAGCACCCTGT -3', LOXL1 forward 5'- GTGTACCGGCCCAACCAG -3', LOXL1 reverse 5'- CTGGCCAGACACTTCTCCTC -3', LOXL2 forward 5'- TGAATATCCAGGTGGAGGACA -3', LOXL2 reverse 5'- CAGGGAAGCCAAACATGC -3'. The reactions were performed as follows; 1 cycle of 95°C for 5 minutes followed by 40 cycles of 95°C for 10 seconds, 60°C for 20 seconds and 72°C for 25 seconds. LOX, LOXL1, and LOXL2 gene expressions were normalized to ß-actin. Each reaction was performed in duplicate. The relative quantification analysis was done by the d-delta-Ct method, as described previously (17).

3.5. Histopathologic Examination

Specimens were examined for histological type, grade (according to the Scarff-Bloom-Richardson criteria), estrogen receptors (ER), progesterone receptors (PR), human epidermal growth factor receptor-2 (HER-2) expressions in Pathology Department.

3.6. Statistical Analysis

The normality of data was checked before analysis (Kolmogorov-Smirnov) and appropriate tests were selected accordingly. Number cruncher statistical system (NCSS) 2007 software (NCSS, Kaysville, UT, USA) was used for all statistical analyses. We employed either the Mann-Whitney U-test or the Kruskal-Wallis test to seek statistically significant differences between SWE values, histological data, and LOX expression levels. We used Spearman correlation analysis to evaluate relationships among variables. A P value < 0.05 was considered to reflect statistical significance.

4. Results

Thirty lesions were diagnosed as BC (the patient group) and 17 lesions were diagnosed as fibroadenoma (the control group). The histopathological, clinical, and elastographic features of the patients were summarized in Table 1.
Table 1.Sonoelastographic and Histopathological Features of the Lesionsa
Measure
Average tumor size, mm49.57 ± 9.59
SWE values of the patient group (n = 30)
Average Emean kPa146.80 ± 49.73
Average SWE-SD26.12 ± 18.35
SWE values of the control group (n = 17)
Average Emean kPa39.06 ± 14.1
Average SWE-SD2.5 ± 0.5
Histological features of the patient group
Type of carcinoma
In-situ ductal carcinoma2 (6.7)
Tubular carcinoma1 (3.3)
Invasive ductal carcinoma24 (80)
Invasive lobular carcinoma1 (3.3)
Mixed type2 (6.7)
Grade
11 (3.3)
219 (63.3)
310 (33.3)
ER (+)20 (66.7)
PR (+)17 (56.7)
HER 2 (+)13 (43.3)
ER (-), PR (-), HER-2 (-)8 (26)
Axillary node metastasis17 (56.7)
Distant metastasis5 (16.7)
Histological features of the control group
Fibroadenoma17 (100)

Abbreviations: Emean, mean stiffness; ER, estrogen receptors; HER-2, human epidermal growth factor receptor-2; PR, progesterone receptors; SWE, shear wave elastography; SWE-SD, SWE-standard deviation

aValues are expressed as No. (%) unless otherwise indicated.

Stiff rim sign was presented in all BC lesions and none of the control group. The average Emean was 146.80 ± 49.73 kPa from the perilesional hardest area with the stiff rim sign for the patient group and the average Emean was 39.02 ± 14.1 kPa from the central stiffest area for the control group. The elastography values of the patient group were statistically significantly higher than the control group (P < 0.05). The mean depth of the lesions was 24.78 ± 13.5 mm. None of our lesions was located deep enough to be affected by rigid structures such as the thoracic wall.
The mean LOXL1 levels were significantly elevated in central parts of the patient group compared to control group samples (P = 0.022). Although a slight increase was evident in peripheral parts of the patient group compared to control group samples, this was not significant (P = 0.136). No significant difference between central and peripheral materials for both groups was apparent in terms of LOX expression (Figure 1). There was no statistically significant relationship between LOX, LOXL1, LOXL2 expressions and SWE parameters and histopathological findings (P > 0.05) both for patient and control groups (Tables 2 and 3). The LOXL2 level correlated significantly with tumor grade. Also, the E-mean value was significantly associated with distant metastasis; as well as the SWE-SD and SWE-ratio with axillary node metastasis (Table 3). Examples of images were shown in Figures 2 and 3.
Table 2.Statistical Analysis of the Correlation Between LOX Expression Levels and SWEa
E meanE maxSWE-SDSWE-ratio
rP valuerP valuerP valuerP value
LOX central-0.1160.540-0.1990.2910.1890.318-0.1300.494
LOXL1 central-0.1810.347-0.1300.502-0.0180.927-0.0850.663
LOXL2 central-0.0120.9480.0160.9340.1850.327-0.0830.663
LOX peripheral0.1690.3900.0390.844-0.0410.8350.0890.651
LOXL1 peripheral-0.0040.985-0.2080.2890.1150.562-0.2430.213
LOXL2 peripheral0.2930.1230.0750.6970.2820.138-0.2540.184

Abbreviations: Emean, mean stiffness; Emax, maximum stiffness; E-ratio, lesion-to-fat elasticity ratio; LOX, lysyl oxidase; LOXL, lysyl oxidase-like protein; SWE-SD, shear wave elastography-standard deviation

ar, spearman correlation coefficient.

Table 3.P Values of Correlation Analysis Between LOX Expression Levels, SWE Parameters and Histopathological Features of the Patient Groupa
ParameterLOX centralLOXL1 centralLOXL2 centralLOX peripheralLOXL1 peripheralLOXL2 peripheralE-meanE-maxSWE-SDSWE-ratio
Tumor size0.5230.7400.2970.8380.0930.3590.8530.9140.5900.826
Tumor grade0.3080.0760.5420.3070.4630.0270.4840.9460.4030.804
Axillary node metastasis0.4570.8790.8690.8370.8370.6500.6530.5920.0140.048
Distant metastasis0.6660.8890.7060.8250.9080.9780.0220.1360.2080.122

Abbreviations: Emean, mean stiffness; Emax, maximum stiffness; SWE-ratio, lesion-to-fat elasticity ratio; LOX, lysyl oxidase; LOXL, lysyl oxidase-like protein; SWE-SD, shear wave elastography-standard deviation

aP values for axillary and distant metastases were calculated by Mann Whitney U test; for grade and size, P values were calculated by Spearman’s correlation.

Relative expression levels of LOX (A), LOXL1 (B), and LOXL2 (C) in control and BC patient tissue samples. Data are shown as mean ± standard error of the mean of mRNA levels based on log-transformed values. N: control group, C: samples from central part of the lesions, P: samples from peripheral part of the lesions, C + P: samples from central and peripheral parts together, *P &lt; 0.05; **P &lt; 0.005; ***P &lt; 0.001.(BC, breast cancer; LOX, Lysyl oxidase; LOXL, lysyl oxidase-like).
Figure 1.

Relative expression levels of LOX (A), LOXL1 (B), and LOXL2 (C) in control and BC patient tissue samples. Data are shown as mean ± standard error of the mean of mRNA levels based on log-transformed values. N: control group, C: samples from central part of the lesions, P: samples from peripheral part of the lesions, C + P: samples from central and peripheral parts together, *P < 0.05; **P < 0.005; ***P < 0.001.(BC, breast cancer; LOX, Lysyl oxidase; LOXL, lysyl oxidase-like).

A 40-year-old patient presented with a mass in the upper outer quadrant of the left breast. Shear wave elastography evaluation of the mass showed peritumoral stiffness and central “blind areas”. Regions of interest (ROIs) were placed to the stiffest peritumoral area and perilesional fat tissue (Emean = 183 kPa, Emax = 192 kPa). Gray-scale images showed ill defined, hypoechoic mass with acoustic shadow which is suggestive for malignancy. Histopathological diagnosis was grade 2, ER (+), PR (-) and HER-2 (-) invasive ductal carcinoma. Axillary metastasis was negative.
Figure 2.

A 40-year-old patient presented with a mass in the upper outer quadrant of the left breast. Shear wave elastography evaluation of the mass showed peritumoral stiffness and central “blind areas”. Regions of interest (ROIs) were placed to the stiffest peritumoral area and perilesional fat tissue (Emean = 183 kPa, Emax = 192 kPa). Gray-scale images showed ill defined, hypoechoic mass with acoustic shadow which is suggestive for malignancy. Histopathological diagnosis was grade 2, ER (+), PR (-) and HER-2 (-) invasive ductal carcinoma. Axillary metastasis was negative.

A 39-year-old patient presented with a mass in the upper inner quadrant of the left breast. Shear wave elastography evaluation of the mass showed peritumoral stiffness and central “blind areas”. Regions of interest (ROIs) were placed to the stiffest peritumoral area and perilesional fat tissue (Emean = 141 kPa, Emax = 192 kPa). Gray-scale images showed ill defined, hypoechoic mass with acoustic shadow which is suggestive for malignancy. Histopathological diagnosis was grade 2, ER (-), PR (-), and HER-2 (-) invasive lobular carcinoma. Axillary metastasis was positive.
Figure 3.

A 39-year-old patient presented with a mass in the upper inner quadrant of the left breast. Shear wave elastography evaluation of the mass showed peritumoral stiffness and central “blind areas”. Regions of interest (ROIs) were placed to the stiffest peritumoral area and perilesional fat tissue (Emean = 141 kPa, Emax = 192 kPa). Gray-scale images showed ill defined, hypoechoic mass with acoustic shadow which is suggestive for malignancy. Histopathological diagnosis was grade 2, ER (-), PR (-), and HER-2 (-) invasive lobular carcinoma. Axillary metastasis was positive.

5. Discussion

In this study, SWE and LOX gene expression values detected in malignant tissues were consistent with the literature and LOXL1 gene expression values were higher in the central regions of the cancerous tissues (9-15). E-max values with distant metastases, SWE ratio and SWE-SD values with axillary metastases were in good correlation. We found no direct correlation between peritumoral elevated elasticity values and LOX gene activity.
Many explanations have been reported in the formation of stiff sign. Peri-tumoral stromal stiffness stemming from abnormal tumor-associated collagen accumulation and lymphangiogenesis has been suggested as the reason for high SWE values measured at the peripheral part of BCs and the amount of collagen was reported to be positively correlated with E-max values (9, 14, 18). Before our study, Hayashi et al. reported a positive correlation between strain elastography and the LOX mRNA expression levels of BC lesions. However, in this study, all data were obtained from entire lesions, not from the peripheries. In addition, they studied only BC cases and LOX values of benign breast lesions were not evaluated (19, 20). Actually, the higher LOX activity detected in the central parts of the cancerous tissues in our study is correlated with the findings of Hayashi et al. Our study is the first research that investigates the correlation between SWE features and LOX genes expression levels, which might be considered as a reason for tumor niche formation, and indirectly for the characteristic stiff-rim sign of SWE.
On the other hand, it is known that increased amount of collagen and desmoid reaction are not the only reasons of the highest elasticity values at peripheral parts of BC lesion. Increased precompression by radiologist, reflection of the shear waves by the corners of the lesion, big size, increased inflammation, patient age, depth of the lesion, Doppler flow signal and hard structures beside the lesion as like thoracic wall are other suggested reasons of this increased local stiffness (15, 21, 22).
We have some hypotheses about our results. Firstly, during biopsy, we were careful of obtaining samples from the stiffest points and avoiding precompression but maybe the stiffest points were not the optimal regions of highest LOX expression. Park et al. used multiple ROIs along the stiff rim sign and reported that the stiffness was higher at the borders of the lesion (23). Excisional biopsy instead of core-biopsy and investigation of LOX activity from tumor borders could change the results. Secondly, according to some publications, LOX activity in benign breast lesions and normal parenchyma was found to be higher than that in malignant tissues (24). Not comparing the tumor-bearing and non-tumorous areas of the same patient for LOX activity could be another point that might have affected our results. However, we couldn’t get approval from our ethics committee about this point. Thirdly, Peyrol et al. and, Patani et al. suggested that the high-level LOX expression in the peritumoral stroma of in-situ ductal carcinoma reflected activation of a host tissue defense (5, 25). As tumor invasion progressed, the LOX expression levels decreased, non-crosslinked collagen deposits increased in number, and the peritumoral stroma became looser. Finally, the tumor overcame the defense mechanism; local invasion triggered angiogenesis and metastasis (5, 25). All but one of the lesions that we studied were invasive and the theory outlined above may explain our finding of high elasticity values associated with low peripheral LOX levels. Both biological and radiological characteristics of peritumoral stroma still remain unclear. Therefore, prospective studies with large number of samples including both in-situ and invasive BC types are needed to point out this relationship in the future.
Chang et al. and Au et al. suggested that tumor size was the most important factor influencing SWE data; larger tumors exhibit a higher-level, peripheral desmoplastic reaction; increased cellularity; and more angiogenesis and edema than do smaller lesions (26, 27). We found no significant correlation between tumor size and any SWE parameter (P > 0.05). However, larger tumors tended to have higher Emean values.
Evans et al. had found strong correlations between tumor type (especially invasive lobular carcinoma) and SWE parameters (28) However, the others disagreed about this. Youk et al. and Ganau et al. found no significant difference in any SWE parameter by the type of lobular cancer studied (29, 30). However, Brkljacic et al. found that invasive lobular carcinomas were stiffer than invasive ductal carcinomas < 1.5 cm in diameter (31). The pathological diagnoses of our patients were: 6.7% (n = 2) ductal carcinoma in situ, 3.3% (n = 1) tubular carcinoma, 80.0% (n = 24) invasive ductal carcinoma, 3.3% (n = 1) invasive lobular carcinoma, and 6.7% (n = 2) mixed. Most lesions were invasive ductal carcinomas; thus, we could not seek correlations between SWE data and histological type.
In our study, we found that patients with axillary metastases have significantly higher SWE-ratio values (P = 0.048) and SWE-SD (0.014). Also, Emean values were significantly higher (P = 0.022) with distant metastases (liver, bone, and/or cranial metastases) compared to the patients with no-metastases.
Our study had several limitations. Although we did not look for inter- and intra-observer reliability in our study, previous studies have shown that reproducibility of SWE technique is high (9, 32). The work was performed in a single center and our patient number was small. The number of lesions we could examine was limited. We did not compare the depths of the lesions. Therefore, prospective studies with larger numbers of both in-situ and invasive BCs are needed.
In conclusion, stiff rim sign is a feature that enhances the diagnostic and prognostic properties of SWE and in our study, we evaluated LOX values with stiff rim sign for the first time. The results of this study showed that, a statistically significant correlation between SWE parameters and LOX, LOXL-1 and LOXL-2 expression might not be present. Prospective studies with a large number of patients and large lesion profiles including in-situ lesions and different histopathological subtypes are needed to be conducted in the future to validate this relationship.

Footnotes

References

  • 1.
    Helleman J, Jansen MP, Ruigrok-Ritstier K, van Staveren IL, Look MP, Meijer-van Gelder ME, et al. Association of an extracellular matrix gene cluster with breast cancer prognosis and endocrine therapy response. Clin Cancer Res. 2008;14(17):5555-64. [PubMed ID: 18765548]. https://doi.org/10.1158/1078-0432.CCR-08-0555.
  • 2.
    Tilghman RW, Cowan CR, Mih JD, Koryakina Y, Gioeli D, Slack-Davis JK, et al. Matrix rigidity regulates cancer cell growth and cellular phenotype. PLoS One. 2010;5(9). e12905. [PubMed ID: 20886123]. [PubMed Central ID: PMC2944843]. https://doi.org/10.1371/journal.pone.0012905.
  • 3.
    Smith-Mungo LI, Kagan HM. Lysyl oxidase: Properties, regulation and multiple functions in biology. Matrix Biol. 1998;16(7):387-98. [PubMed ID: 9524359]. https://doi.org/10.1016/S0945-053X(98)90012-9.
  • 4.
    Nishioka T, Eustace A, West C. Lysyl oxidase: From basic science to future cancer treatment. Cell Struct Funct. 2012;37(1):75-80. [PubMed ID: 22453058]. https://doi.org/10.1247/csf.11015.
  • 5.
    Peyrol S, Raccurt M, Gerard F, Gleyzal C, Grimaud JA, Sommer P. Lysyl oxidase gene expression in the stromal reaction to in situ and invasive ductal breast carcinoma. Am J Pathol. 1997;150(2):497-507. [PubMed ID: 9033266]. [PubMed Central ID: PMC1858268].
  • 6.
    Decitre M, Gleyzal C, Raccurt M, Peyrol S, Aubert-Foucher E, Csiszar K, et al. Lysyl oxidase-like protein localizes to sites of de novo fibrinogenesis in fibrosis and in the early stromal reaction of ductal breast carcinomas. Lab Invest. 1998;78(2):143-51. [PubMed ID: 9484712].
  • 7.
    Bondareva A, Downey CM, Ayres F, Liu W, Boyd SK, Hallgrimsson B, et al. The lysyl oxidase inhibitor, beta-aminopropionitrile, diminishes the metastatic colonization potential of circulating breast cancer cells. PLoS One. 2009;4(5). e5620. [PubMed ID: 19440335]. [PubMed Central ID: PMC2680032]. https://doi.org/10.1371/journal.pone.0005620.
  • 8.
    Barr RG. Breast elastograph. New York: Thieme Publishers; 2015. https://doi.org/10.1055/b-0035-121483.
  • 9.
    Zhou J, Zhan W, Chang C, Zhang X, Jia Y, Dong Y, et al. Breast lesions: Evaluation with shear wave elastography, with special emphasis on the "stiff rim" sign. Radiology. 2014;272(1):63-72. [PubMed ID: 24661245]. https://doi.org/10.1148/radiol.14130818.
  • 10.
    Itoh A, Ueno E, Tohno E, Kamma H, Takahashi H, Shiina T, et al. Breast disease: Clinical application of US elastography for diagnosis. Radiology. 2006;239(2):341-50. [PubMed ID: 16484352]. https://doi.org/10.1148/radiol.2391041676.
  • 11.
    Liu B, Zheng Y, Huang G, Lin M, Shan Q, Lu Y, et al. Breast lesions: Quantitative diagnosis using ultrasound shear wave elastography-A systematic review and meta--analysis. Ultrasound Med Biol. 2016;42(4):835-47. [PubMed ID: 26778289]. https://doi.org/10.1016/j.ultrasmedbio.2015.10.024.
  • 12.
    Barr RG. Shear wave imaging of the breast: Still on the learning curve. J Ultrasound Med. 2012;31(3):347-50. [PubMed ID: 22368124]. https://doi.org/10.7863/jum.2012.31.3.347.
  • 13.
    Evans A, Rauchhaus P, Whelehan P, Thomson K, Purdie CA, Jordan LB, et al. Does shear wave ultrasound independently predict axillary lymph node metastasis in women with invasive breast cancer? Breast Cancer Res Treat. 2014;143(1):153-7. [PubMed ID: 24305976]. [PubMed Central ID: PMC4363519]. https://doi.org/10.1007/s10549-013-2747-z.
  • 14.
    Wang ZL, Sun L, Li Y, Li N. Relationship between elasticity and collagen fiber content in breast disease: A preliminary report. Ultrasonics. 2015;57:44-9. [PubMed ID: 25465961]. https://doi.org/10.1016/j.ultras.2014.10.016.
  • 15.
    Barr RG, Zhang Z. Effects of precompression on elasticity imaging of the breast: Development of a clinically useful semiquantitative method of precompression assessment. J Ultrasound Med. 2012;31(6):895-902. [PubMed ID: 22644686]. https://doi.org/10.7863/jum.2012.31.6.895.
  • 16.
    Skerl K, Vinnicombe S, Giannotti E, Thomson K, Evans A. Influence of region of interest size and ultrasound lesion size on the performance of 2D shear wave elastography (SWE) in solid breast masses. Clin Radiol. 2015;70(12):1421-7. [PubMed ID: 26455652]. https://doi.org/10.1016/j.crad.2015.08.010.
  • 17.
    Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods. 2001;25(4):402-8. [PubMed ID: 11846609]. https://doi.org/10.1006/meth.2001.1262.
  • 18.
    Tozaki M, Fukuma E. Pattern classification of shear wave elastography images for differential diagnosis between benign and malignant solid breast masses. Acta Radiol. 2011;52(10):1069-75. [PubMed ID: 22013011]. https://doi.org/10.1258/ar.2011.110276.
  • 19.
    Hayashi M, Yamamoto Y, Ibusuki M, Fujiwara S, Yamamoto S, Tomita S, et al. Evaluation of tumor stiffness by elastography is predictive for pathologic complete response to neoadjuvant chemotherapy in patients with breast cancer. Ann Surg Oncol. 2012;19(9):3042-9. [PubMed ID: 22476757]. https://doi.org/10.1245/s10434-012-2343-1.
  • 20.
    Hayashi M, Yamamoto Y, Sueta A, Tomiguchi M, Yamamoto-Ibusuki M, Kawasoe T, et al. Associations between elastography findings and clinicopathological factors in breast cancer. Medicine (Baltimore). 2015;94(50). e2290. [PubMed ID: 26683963]. [PubMed Central ID: PMC5058935]. https://doi.org/10.1097/MD.0000000000002290.
  • 21.
    Xiao Y, Yu Y, Niu L, Qian M, Deng Z, Qiu W, et al. Quantitative evaluation of peripheral tissue elasticity for ultrasound-detected breast lesions. Clin Radiol. 2016;71(9):896-904. [PubMed ID: 27349474]. https://doi.org/10.1016/j.crad.2016.06.104.
  • 22.
    Xiang L, Ma F, Yao M, Xu G, Pu H, Liu H, et al. Benign lesion evaluation: Factors causing the "stiff rim" sign in breast tissues using shear-wave elastography. Br J Radiol. 2019;92(1094):20180602. [PubMed ID: 30303694]. [PubMed Central ID: PMC6404811]. https://doi.org/10.1259/bjr.20180602.
  • 23.
    Park HS, Shin HJ, Shin KC, Cha JH, Chae EY, Choi WJ, et al. Comparison of peritumoral stromal tissue stiffness obtained by shear wave elastography between benign and malignant breast lesions. Acta Radiol. 2018;59(10):1168-75. [PubMed ID: 29359949]. https://doi.org/10.1177/0284185117753728.
  • 24.
    Chen LC, Tu SH, Huang CS, Chen CS, Ho CT, Lin HW, et al. Human breast cancer cell metastasis is attenuated by lysyl oxidase inhibitors through down-regulation of focal adhesion kinase and the paxillin-signaling pathway. Breast Cancer Res Treat. 2012;134(3):989-1004. [PubMed ID: 22434522]. https://doi.org/10.1007/s10549-012-1986-8.
  • 25.
    Patani N, Jiang W, Newbold R, Mokbel K. Prognostic implications of carboxyl-terminus of Hsc70 interacting protein and lysyl-oxidase expression in human breast cancer. J Carcinog. 2010;9:9. [PubMed ID: 21139993]. [PubMed Central ID: PMC2997236]. https://doi.org/10.4103/1477-3163.72505.
  • 26.
    Chang JM, Moon WK, Cho N, Kim SJ. Breast mass evaluation: Factors influencing the quality of US elastography. Radiology. 2011;259(1):59-64. [PubMed ID: 21330569]. https://doi.org/10.1148/radiol.10101414.
  • 27.
    Au FW, Ghai S, Lu FI, Moshonov H, Crystal P. Quantitative shear wave elastography: Correlation with prognostic histologic features and immunohistochemical biomarkers of breast cancer. Acad Radiol. 2015;22(3):269-77. [PubMed ID: 25666048]. https://doi.org/10.1016/j.acra.2014.10.007.
  • 28.
    Evans A, Whelehan P, Thomson K, McLean D, Brauer K, Purdie C, et al. Invasive breast cancer: Relationship between shear-wave elastographic findings and histologic prognostic factors. Radiology. 2012;263(3):673-7. [PubMed ID: 22523322]. https://doi.org/10.1148/radiol.12111317.
  • 29.
    Youk JH, Gweon HM, Son EJ, Kim JA, Jeong J. Shear-wave elastography of invasive breast cancer: Correlation between quantitative mean elasticity value and immunohistochemical profile. Breast Cancer Res Treat. 2013;138(1):119-26. [PubMed ID: 23324903]. https://doi.org/10.1007/s10549-013-2407-3.
  • 30.
    Ganau S, Andreu FJ, Escribano F, Martin A, Tortajada L, Villajos M, et al. Shear-wave elastography and immunohistochemical profiles in invasive breast cancer: Evaluation of maximum and mean elasticity values. Eur J Radiol. 2015;84(4):617-22. [PubMed ID: 25619502]. https://doi.org/10.1016/j.ejrad.2014.12.020.
  • 31.
    Brkljacic B, Divjak E, Tomasovic-Loncaric C, Tesic V, Ivanac G. Shear-wave sonoelastographic features of invasive lobular breast cancers. Croat Med J. 2016;57(1):42-50. [PubMed ID: 26935613]. [PubMed Central ID: PMC4800323]. https://doi.org/10.3325/cmj.2016.57.42.
  • 32.
    Evans A, Whelehan P, Thomson K, Brauer K, Jordan L, Purdie C, et al. Differentiating benign from malignant solid breast masses: value of shear wave elastography according to lesion stiffness combined with greyscale ultrasound according to BI-RADS classification. Br J Cancer. 2012;107(2):224-9. [PubMed ID: 22691969]. [PubMed Central ID: PMC3394981]. https://doi.org/10.1038/bjc.2012.253.

Similar Articles

4
Sep
2016

Clinical Application of Shear Wave Elastography in Breast Masses

Jin Young Chang,
Jin Hee Moon,
Sung Hye Koh,
Sun-Young Park,
Kwan Seop Lee

Chang JY, Moon JH, Hye Koh S, Park S, Seop Lee K. Clinical Application of Shear Wave Elastography in Breast Masses. I J Radiol. 2017;14(1):e13486. doi: https://doi.org/10.5812/iranjradiol.39585

10
Dec
2019

A Deep Learning-Based Approach for Breast BI-RADS Prediction on Shear Wave Elastography Images

Ali Shabanzadeh,
Shakiba Moradi,
Parvaneh (Masoumeh) Gity,
Mostafa Ghelich Oghli

Shabanzadeh A, Moradi S, Gity P(, Ghelich Oghli M. A Deep Learning-Based Approach for Breast BI-RADS Prediction on Shear Wave Elastography Images. I J Radiol. 2019;16(Special Issue):e99141. doi: https://doi.org/10.5812/iranjradiol.99141

20
Nov
2017
Sonoelastographic Features of Major Salivary Gland Tumors and Pathology Correlation

Sonoelastographic Features of Major Salivary Gland Tumors and Pathology Correlation

Mustafa Farasat,
Gulgun Yilmaz Ovali,
Fatih Duzgun,
Gorkem Eskiizmir,
Serdar Tarhan,
Ayca Tan

Farasat M, Yilmaz Ovali G, Duzgun F, Eskiizmir G, Tarhan S, et al. Sonoelastographic Features of Major Salivary Gland Tumors and Pathology Correlation. I J Radiol. 2018;15(1):e64039. doi: https://doi.org/10.5812/iranjradiol.64039

11
Nov
2024
J Kermanshah Univ Med Sci

Correlation of Liver Fibroscan Results with Liver Elastographyand Liver Enzymes in Patients with Fatty Liver

Pegah Jahani,
Mohammad Reza Fattahi,
Mojtaba Neydavoodi,
Zeinab Gholami

Jahani P, Fattahi MR, Neydavoodi M, Gholami Z. Correlation of Liver Fibroscan Results with Liver Elastographyand Liver Enzymes in Patients with Fatty Liver. J Kermanshah Univ Med Sci. 2025;29(1):e142386. doi: https://doi.org/10.5812/jkums-142386

29
Sep
2024
I J Radiol

Shear Wave Elastography in Evaluating the Efficacy of Liver Microwave Ablation: An Experimental Study

Dandan Xu,
Chao Tian,
Shan Wei

Xu D, Tian C, Wei S. Shear Wave Elastography in Evaluating the Efficacy of Liver Microwave Ablation: An Experimental Study. I J Radiol. 2024;21(2):e143996. doi: https://doi.org/10.5812/iranjradiol-143996


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles