Emergence of Extensively Drug Resistant Acinetobacter baumannii-Encoding Integrons and Extended-Spectrum Beta-Lactamase Genes Isolated from Ventilator-Associated Pneumonia Patients

Author(s):
Mohammad Sadegh RezaiMohammad Sadegh RezaiMohammad Sadegh Rezai ORCID1, Alireza RafieiAlireza RafieiAlireza Rafiei ORCID2, Fatemeh AhangarkaniFatemeh AhangarkaniFatemeh Ahangarkani ORCID3, Masoumeh Bagheri-NesamiMasoumeh Bagheri-NesamiMasoumeh Bagheri-Nesami ORCID1,*, Attieh NikkhahAttieh Nikkhah1, Khaironesa ShafahiKhaironesa Shafahi4, Gohar EslamiGohar Eslami5, Azin HajalibeigAzin Hajalibeig1, Rezvan KhajaviRezvan Khajavi2
1Infectious Diseases Research Center with Focus on Nosocomial Infection, Mazandaran University of Medical Sciences, Sari, Iran
2Molecular and Cell Biology Research Center, Department of Immunology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
3Antimicrobial Resistance Research Center, Student Research Committee, Mazandaran University of Medical Sciences, Sari, Iran
4Fatemeh Zahra Hospital, Mazandaran University of Medical Sciences, Sari, Iran
5Department of Clinical Pharmacy, Faculty of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran
*Corresponding Author: Corresponding author: Masoumeh Bagheri-Nesami, Infectious Diseases Research Center with Focus on Nosocomial Infection, Mazandaran University of Medical Sciences, Sari, Iran. Tel/Fax: +98-33342334, E-mail: Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 10, issue 7; e14377
Published online:Jun 18, 2017
Article type:Research Article
Received:Nov 30, 2016
Accepted:May 08, 2017
How to Cite:Rezai MS, Rafiei A, Ahangarkani F, Bagheri-Nesami M, Nikkhah A, et al. Emergence of Extensively Drug Resistant Acinetobacter baumannii-Encoding Integrons and Extended-Spectrum Beta-Lactamase Genes Isolated from Ventilator-Associated Pneumonia Patients. Jundishapur J Microbiol. 2017;10(7):e14377. doi: https://doi.org/10.5812/jjm.14377

Abstract

Background:

Acinetobacter baumannii has increasingly become one of the most common pathogens causing ventilator-associated pneumonia (VAP).

Objectives:

In the present study, we aimed to assess the presence of extended-spectrum beta-lactamase (ESBL) and integron genes in A. baumannii isolates from VAP patients in the intensive care units (ICUs) of 18 hospitals in North of Iran.

Methods:

All patients, who were ventilated for at least 48 hours, were assessed daily for VAP. The minimum inhibitory concentrations were determined according to the standard protocol by the clinical and laboratory standards institute (CLSI). ESBL-producing A. baumannii was detected, using the double-disk synergy test. ESBL-positive A. baumannii isolates were screened for CTX, VEB, GES, SHV, int1, and int2 genes, using polymerase chain reaction (PCR) amplification.

Results:

In total, 29 out of 205 patients with nosocomial infections, admitted to ICUs during 2014 - 2015, showed VAP caused by ESBL-producing A. baumannii. A total of 19 (65.51%) strains were extensively drug resistant (XDR). As the findings revealed, the rates of imipenem and colistin resistance were 55.2% and 34.5%, respectively. The prevalence of CTX, VEB, and SHV genes in ESBL-producing A. baumannii was 34.5%, 17.2%, and 96.6%, respectively. Also, 79.3% of the isolates had class 1 integrons, while 10.3% contained class 2 integrons.

Conclusions:

Presence of integrons in A. baumannii has been considerably associated with ESBL genes. The high rate of SHV and int1 genes highlights the necessity of avoiding aminoglycosides for empirical therapy. Although colistin was the most sensitive antibiotic in XDR strains in our region, due to the presence of patients with A. baumannii in ICUs, colistin resistance screening should be performed before empirical therapy for VAP, even for those without prior exposure to this antibiotic.

1. Background

Ventilator-associated pneumonia (VAP) is a common nosocomial infection (NI) in critically ill patients. It is associated with a high mortality rate, reaching up to 33% - 50% in high-risk hospital wards, such as intensive care units (ICUs) (1). Acinetobacter baumannii constitutes the ninth most common nosocomial pathogen, reported by the national healthcare safety network (2). It is a bacterium characterized by rapid development of resistance to the majority of antimicrobials and is associated with lower respiratory tract infections in critically ill patients (1, 3-5). This pathogen is responsible for nearly 5% - 10% of VAP cases in ICUs and 61% of VAP-associated mortality in these settings (1, 6). The most common concern among clinicians is the intrinsic resistance of A. baumannii isolates to common antibiotics used for pneumonia treatment (7). Although several outbreaks have been reported in European countries, A. baumannii is known to be endemic to North Africa and Middle East countries including Iran (1, 8). The mechanism of drug resistance acquisition in A. baumannii includes acquisition of mobile genetic elements, such as plasmids, transposons, and integrons from the surroundings (4, 9).
Extended-spectrum beta-lactamase (ESBL)-producing Acinetobacter‎ species are recognized as a major health problem worldwide, considering the limited antibiotic treatment options. ESBL genes are often associated with carbapenem and aminoglycoside resistance genes (10). In addition, integrons may contribute to beta-lactamase overproduction and dissemination (11); also, carrying integrons facilitate the spread of resistance genes among bacteria (12). Epidemiological studies are one of the basic strategies to manage and quickly respond to outbreaks through reducing mortality, changing infection-control settings, and decreasing the incidence of infections and healthcare costs.
There is a significant gap in knowledge about device-associated infections in Iran, especially VAP caused by A. baumannii. Therefore, knowledge about local resistance patterns is essential for exploring feasible alternatives for the management of A. baumannii-associated VAP in developing countries such as Iran with limited resources.

2. Objectives

In the present study, we aimed to assess the presence of ESBL and integron genes in A. baumannii isolates from patients with VAP admitted to the ICUs of 18 hospitals in North of Iran.

3. Methods

3.1. Bacterial Isolation

In this cross sectional study initiated in 2014, nonrepetitive A. baumannii isolates were collected from patients with microbiologically confirmed VAP. This study was approved by the ethics committee of Mazandaran University of Medical Sciences (code, 879; date, July 9, 2014). Ventilator-associated pneumonia was indicated in a mechanically ventilated patient, with chest radiograph showing new or progressive infiltrates, cavitation, consolidation, or pleural effusion at 48 hours after hospitalization.
The inclusion criteria were as follows: 1) onset of purulent sputum or changes in the sputum; and 2) cultured organisms from blood samples or specimens obtained via tracheal aspirate analysis, bronchoalveolar lavage, or biopsy (13). Sampling was carried out over 1 year. All patients with ventilation for at least 48 hours were assessed daily for evidence of ventilator-associated NIs. On the other hand, patients with chronic mechanical ventilation were excluded. The isolates were identified at species level, using standard biochemical tests and microbiological methods (14, 15).

3.2. Antimicrobial Susceptibility Test

Antimicrobial susceptibility testing was performed, using broth microdilution method. The minimum inhibitory concentrations (MICs) were determined according to the standard protocol of the clinical and laboratory standards institute (CLSI). The antimicrobials included amikacin, ciprofloxacin, imipenem, gentamicin, ceftazidime, tobramycin, piperacillin/tazobactam, cefepime, colistin, and cotrimoxazole. The antibiotics were purchased from Sigma Co. (Germany) (16). The XDR Acinetobacter species were defined as isolates resistant to 3 classes of antimicrobials and insensitive to carbapenem (17).

3.3. Phenotypic ESBL Detection

ESBL-producing A. baumannii was detected, using the double-disk synergy test. The presence of ESBL was assayed, using the following antibiotic disks: cefotaxime (30 μg), cefotaxime/clavulanic acid (30/10 μg), ceftazidime (30 μg), and ceftazidime/clavulanic acid (30/10 μg) (MAST, UK). Escherichia coli ATCC 25922 strains served as the positive controls (18).

3.4. DNA Extraction and Polymerase Chain Reaction (PCR) Assay

DNA extraction was carried out, using a commercial standard kit (DNA Zist, Iran). ESBL-positive A. baumannii isolates were screened for CTX, VEB, GES, SHV, int1, and int2 genes via PCR amplification. The PCR primers and annealing temperature are presented in Table 1. After PCR reactions, the PCR products were subjected to 2% gel electrophoresis for 50 minutes (voltage, 70). The results were evaluated under UV light on a UV transilluminator. Also, Klebsiella pneumoniae 7881 (CTXM), K. pneumoniae 7881 (containing SHV), Pseudomonas aeruginosa ATCC 27853 (VEB-1), and K. pneumoniae (GES) were used as the positive controls for ESBL-producing genes. In addition, E. coli 96K062 was used as the positive control for class 1 and 2 integrons (int1 and int2). A non-ESBL-producing strain (E. coli ATCC 25922) was used as the negative control.
Table 1.PCR Primers and Annealing Temperature
Target GenePrimer Sequences (5’ - 3’)Annealing Temperature, °CAmplicon Size, bpReference
CTXTTTGCGATGTGCAGTACCAGTAA53.1593(19)
CGATATCGTTGGTGGCATA
VEBCGACTTCCATTTCCCGATGC54.9585(20)
GGACTCTGCAACAAATACGC
GESATGCGCTTCATTCACGCAC55846(21)
CTATTTGTCCGTGCTCAGG
SHVAAGATCCACTATCGCCAGCAG60231(22)
ATTCAGTTCCGTTTCCCAGCGG
INT1CAGTGGACATAAGCCTGTTC55160(23)
CCCGAGGCATAGACTGTA
INT2TTGCGAGTATCCATAACCTG58288(24)
TTACCTGCACTGGATTAAGC

3.5. Statistical Analysis

For statistical analysis, descriptive tests were calculated using SPSS version 16.

4. Results

Out of 205 patients with NI admitted to the ICUs of 18 hospitals, 29 had VAP caused by ESBL-producing A. baumannii. In total, 19 (65.5%) patients were male and 10 (34.5%) were female. The average age of the participants was 62.16 ± 17.76 years. The susceptibility patterns of ESBL-producing A. baumannii to different categories of antibiotics are presented in Table 2.
Table 2.Antibiotic Susceptibility Patterns of ESBL-Producing A. baumannii Isolates from Patients with VAP
AntibioticsResistantIntermediateSensitive
Aminoglycosides
Amikacin23 (79)2 (6.9)4 (13.8)
Gentamicin27 (93.1)2 (6.9)0
Tobramycin18 (62.1)7 (24.1)4 (13.8)
Fluoroquinolones
Ciprofloxacin24 (82.8)3 (10.3)2 (6.9)
Carbapenems
Imipenem16 (55.2)7 (24.1)6 (20.7)
Penicillin + β-lactamase inhibitors
Piperacillin/tazobactam28 (96.6)1 (3.4)0
Cephalosporins
Ceftazidime26 (89.7)2 (6.9)1 (3.4)
Cefepime26 (89.7)2 (6.9)1 (3.4)
Polypeptides
Colistin10 (34.5)13 (44.8)6 (20.7)
Sulfonamide + trimethoprim
Cotrimoxazole26 (89.7)1 (3.4)2 (6.9)
Based on the findings, 19 (65.51%) strains were susceptible to only 1 or 2 antibiotic categories. The prevalence of CTX, VEB, and SHV genes in ESBL-producing A. baumannii was 34.5%, 17.2%, and 96.6%, respectively; however, none of the isolates contained GES genes. PCR detection of integrase genes showed that 79.3% of the isolates had class 1 integrons, while 10.3% had class 2 integrons. Figure 1 illustrates Agarose gel electrophoresis of strains containing VEB, SHV, CTX, int1, and int2 genes.
Gel Electrophoresis of ESBL-Related Genes and Class 1 and Class 2 Integron Amplification. Well No. 1 Shows the Positive Isolates for Genes and Well M Represents the Marker
Figure 1.

Gel Electrophoresis of ESBL-Related Genes and Class 1 and Class 2 Integron Amplification. Well No. 1 Shows the Positive Isolates for Genes and Well M Represents the Marker

The antibiotic susceptibility pattern of A. baumannii, containing ESBL-producing genes and integrons, is shown in Table 3. The coincidence of isolates with different ESBL gene types and class 1 integrons is presented in Table 4. One strain contained 3 ESBL genes (VEB, CTX, and SHV), while 14 strains had 2 ESBL genes (10 strains, CTX and SHV; 4 strains, VEB and SHV). Based on the findings, 14 strains had only 1 ESBL gene (SHV). The coincidence of isolates containing different types of ESBL genes and class 1 integrons was approximately 72% - 100%, which is statistically significant (P >  0.05).
Table 3.Antibiotic Susceptibility Patterns of A. baumannii Containing ESBL and Integron Genes
AntibioticsSHVVEBCTXINT1INT2
NEG (N = 1)POS (N = 28)NEG (N = 24)POS (N = 5)NEG (N = 19)POS (N = 10)NEG (N = 6)POS (N = 23)NEG (N = 26)POS (N = 3)
Amikacin
R1 (100)22 (78.57)19 (79.16)4 (80)14 (73.68)9 (90)6 (100)17 (73.91)20 (76.92)3 (100)
I02 (7.14)1 (4.16)1 (20)2 (10.52)002 (8.69)2 (7.69)0
S04 (14.28)4 (16.66)03 (15.78)1 (10)04 (17.39)4 (15.38)0
Ciprofloxacin
R‎1 (100)‎23 (82.14)19 (79.16)5 (100)15 (78.94)9 (90)5 (83.3)1922 (84.61)2 (66.6)
I03 (10.71)3 (12.5)03 (15.78)01 (16.6)2 (8.69)2 (7.69)1 (33.3)
S02 (7.14)2 (8.33)01 (5.26)1 (10)02 (8.69)2 (7..69)0
Imipenem
R1 (100)15 (53.57)14 (58.33)2 (40)13 (68.42)3 (30)5 (83.3)11 (47.82)14 (53.84)2 (66.6)
I07 (25)6 (25)1 (20)3 (15.78)4 (40)07 (30.43)6 (23.07)1 (33.3)
S06 (21.42)4 (16.66)2 (40)3 (15.78)3 (30)1 (16.6)5 (21.73)6 (23.07)0
Gentamicin
R1 (100)26 (92.85)23 (95.83)4 (80)17 (89.47)10 (100)6 (100)21 (911.3)24 (92.30)3 (100)
I000000002 (7.69)0
S02 (7.14)1 (4.16)1 (20)2 (10.52)002 (8.69)0
Ceftazidime
R1 (100)25 (89.28)23 (95.83)3 (60)16 (84.21)10 (100)6 (100)20 (86.95)23 (88.46)3 (100)
I02 (7.14)1 (4.16)1 (20)2 (10.52)002 (8.69)2 (7.69)0
S01 (3.57)01 (20)1 (5.26)001 (4.34)1 (3.84)0
Tobramycin
R1 (100)17 (60.71)17 (70.83)1 (20)13 (68.42)5 (50)5 (83.3)13 (56.52)17 (65.38)1 (33.3)
I07 (25)3 (12.5)4 (80)5 (26.31)2 (20)1 (16.6)6 (26.08)5 (19.23)2 (66.6)
S04 (14.28)4 (16.66)01 (5.26)3 (30)09 (39.13)4 (15.38)0
Piperacillin/tazobactam
R1 (100)27 (96.42)23 (95.83)5 (100)18 (94.73)10 (100)6 (100)22 (95.65)25 (96.15)3 (100)
I01 (3.57)1 (4.16)01 (5.26)001 (4.34)1 (3.84)0
S0000000000
Cefepime
R1 (100)25 (89.28)21 (87.5)5 (100)16 (84.21)10 (100)6 (100)20 (86.95)24 (92.3)2 (66.6)
I02 (7.14)2 (8.33)02 (10.52)002 (8.69)1 (3.84)1 (33.3)
S01 (3.57)1 (4.16)01 (5.26)001 (4.34)1 (3.84)0
Colistin
R1 (100)9 (32.14)9 (37.5)1 (20)6 (31.57)4 (40)2 (33.3)8 (34.78)9 (34.6)1 (33.3)
I013 (46.42)11 (45.83)2 (40)9 (47.36)4 (40)4 (66.6)9 (39.13)11 (42.3)2 (66.6)
S06 (21.42)4 (16.66)2 (40)4 (21.05)2 (20)06 (26.08)6 (23.07)0
Cotrimoxazole
R1 (100)25 (89.28)22 (91.66)4 (80)17 (89.47)9 (90)6 (100)20 (86.95)23 (88.46)3 (100)
I01 (3.57)01 (20)1 (5.26)001 (4.34)1 (3.84)0
S02 (7.14)2 (8.33)01 (5.26)1 (10)02 (8.69)2 (7.69)0

Abbreviations: NEG, Negative; POS, Positive.

Table 4.The Coincidence of Isolates with Different ESBL Gene Types and Class 1 Integrons Among A. baumannii Isolates
ESBL TypeNumber (N = 29)Coincidence with Class 1 Integrons (N = 23)P ValueNumber (N = 3)Coincidence with Class 2 Integrons (N = 2)P Value
VEB, CTX, and SHV1 (3.4)1 (100)≤ 0.000100-
CTX and SHV10 (34.48)8 (80)0.041 (33)1 (100)≤ 0.0001
VEB and SHV4 (13.79)4 (100)0.00200-
SHV14 (48.27)10 (71.42)0.12 (66)1 (50)1

5. Discussion

Based on the findings, ESBL-producing A. baumannii was responsible for 14.15% of VAP cases in our region. Also, XDR ESBL-producing A. baumannii was a major cause of VAP with an incidence of 65.51%. During the study, the outbreak of multidrug-resistant (MDR) A. baumannii was reported in the ICU of Imam Sajjad hospital, Ramsar, Iran and was reserved for patients requiring intensive care (e.g., mechanical ventilation). A total of 13 nonduplicate A. baumannii isolates were collected from the clinical specimens in less than 6 months. All the samples were isolated from VAP patients at the hospital. In total, 84.6% of A. baumannii isolates from the outbreak contained class 1 integrons. The occurrence of 2 this outbreak in Mazandaran Province is consistent with several reports on the extensive spread of MDR A. baumannii, causing multicenter outbreaks in European countries and USA (25-27).
The most remarkable finding of the present study was the high rate of class 1 integrons (79.3%) among ESBL-producing A. baumannii isolates from VAP patients. In this study, class 1 integrons were associated with various ESBL-related genes and played an important role in the development of antibiotic resistance. In this regard, in a study by Rahimzadeh et al., the prevalence of class 1 integrons in ESBL-producing A. baumannii was 73%, which is close to the present finding (28). Moreover, Farajnia et al. reported the prevalence of integrons to be 74% among ESBL-producing A. baumannii isolates (12). The rate of integron positive strains in these studies was close to the present findings. However, it should be noted that in the present study, all ESBL-producing A. baumannii isolates were collected from VAP patients, whereas in studies by Rahimizadeh et al. and Farajnia et al., only 37% and 54% of A. baumannii isolates were from VAP patients, respectively.
Recently, colistin resistance has emerged worldwide due to colistin therapy and nosocomial transmission of resistant strains. Nevertheless, colistin is rarely prescribed or used in our region. The possible reasons for the presence of colistin-resistant pathogens in humans without prior exposure to colistin include cross-resistance between colistin and human cationic antimicrobials (e.g., LL-37 and lysozyme) and acquisition of colistin-resistant bacteria from animal food (this antibiotic is heavily used in veterinary medicine).
Another possibility is the involvement of plasmid-mediated colistin resistance, reported in E. coli and K. pneumoniae. The mcr-1 gene, encoded for phosphoethanolamine transferase, was borne on a mobile plasmid in E. coli and K. pneumoniae and could transfer to Enterobacteriaceae and P. aeruginosa (29-31). Therefore, timely detection and isolation of patients harboring colistin resistance and prevention of treatment failure depend on colistin resistance screening in patients, even those without a history of colistin use is necessary.
Today, imipenem therapy is the gold standard for pneumonia due to A. baumannii. Polymyxins remain an exception with regard to the emergence of resistance to the available antibiotics (32). Colistin and imipenem were found to be more effective antibiotics for the treatment of infections caused by resistant isolates. ESBL-producing A. baumannii showed coresistance to different categories of antibiotics, such as quinolones and aminoglycosides. About 70% of A. baumannii isolates in the present study were resistant to aminoglycosides (33, 34). Although CTX gene is more common in some countries, the most prevalent ESBL gene detected in our study was blaSHV (96.6%). The high rate of SHV genes in the present study could be explained by high resistance to aminoglycosides. Based on the findings, resistance to aminoglycosides among A. baumannii strains was 63% - 93%. The association of blaSHV with aminoglycoside resistance genes, such as aacC1, aphA6, aadA1, and aadB, has been established in the literature.
The incidence of aminoglycoside resistance among SHV-encoding A. baumannii isolates was 60% - 92%. In this regard, Safari et al. and Sharif et al. reported prevalence rates of 58% and 63% for SHV gene, respectively, whereas Alyamani et al. could not detect any SHV genes. Moreover, Huang et al. reported a prevalence of 30%, and Hussain et al. showed that in Pakistan, 40% of A. baumannii isolates carried beta-lactamase-resistant SHV genes (35-38); blaSHV genes could be carried by both chromosomes and plasmids. Consequently, clonal dissemination and horizontal gene transfer by integrons (96% in strains with class 1 integrons vs. 100% in strains with class 2 integrons in the present study) both contribute to the overwhelming prevalence of blaSHV genes in A. baumannii isolates.
CTX β-lactamase, produced by A. baumannii strains, is plasmid-mediated, considering the long duration of survival in hospital settings. The prevalence of blaCTX gene in the present study was 34.5%; also, 34.7% of class 1 integron-positive strains contained blaCTX genes. Also, in this study, resistance among strains with blaCTX genes ranged from 30% to 100%. In this regard, Hakemi et al. reported the prevalence of CTX genes to be 10.7% among A. baumannii isolates from wound samples. On the other hand, Alyamani et al. showed that 81% of A. baumannii isolates from the clinical samples of ICU patients contained CTX genes (36, 39). In consistence with the present findings, Ahanjan et al. reported a prevalence of 31.5% in A. baumannii isolates from patients with wound infections (40); this consistency might be explained by the similarities in study settings.
Moreover, we found that 17.2% of the strains contained VEB genes. According to the literature, A. baumannii, harboring integron-borne VEB-1 (an ESBL), had caused outbreaks in French and Belgian hospitals (20, 41). The prevalence of this gene was reported to be 10% in a study by Farajnia et al., 39.5% in a study by Fallah et al., 26.6% in a study by Fazeli et al. in Iran, and 47.61% in the Unites States (12, 42, 43). The coincidence of different ESBL types, containing VEB genes and class 1 integrons, was significant (P < 0.05). In the present study, the high rate of CTX, SHV, and VEB genes in A. baumannii might have been influenced by mobile genetic elements such as integrons (P < 0.05). According to our researches, in recent years the incidence of antibiotic resistance tragically has exponentially increased in north of Iran (44-52)

5.1. Conclusion

Presence of class 1 and class 2 integrons in A. baumannii has been considerably associated with ESBL strains. The high rate of SHV genes and class 1 integrons highlights the necessity of avoiding aminoglycosides for empirical therapy. Although colistin was the most sensitive antibiotic in XDR strains in our region, due to the presence of patients with A. baumannii in ICUs, colistin resistance screening should be performed before empirical therapy for VAP, even for those without prior exposure to this antibiotic.

Acknowledgments

Footnotes

  • Authors’ Contribution:Mohammad Sadegh Rezai and Masoumeh Bagheri-Nesami designed the project, collected the data, and wrote the manuscript. Fatemeh Ahangarkani, Gohar Eslami, Azin Hajalibeig, Khaironesa Shafahi, Rezvan Khajavi, and Attieh Nikkhah collected the data. Alireza Rafiei carried out the laboratory examinations. All authors read and approved the final manuscript.

  • Financial Disclosure:There is no financial disclosure.

  • Funding/Support:This research was supported by a research grant from the Vice-Chancellor for Research at Mazandaran University of Medical Sciences (grant No., 879).

References

  • 1.
    Chaari A, Mnif B, Bahloul M, Mahjoubi F, Chtara K, Turki O, et al. Acinetobacter baumannii ventilator-associated pneumonia: epidemiology, clinical characteristics, and prognosis factors. Int J Infect Dis. 2013;17(12):e1225-8. [PubMed ID: 24094525]. https://doi.org/10.1016/j.ijid.2013.07.014.
  • 2.
    Hidron AI, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA, et al. NHSN annual update: antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006-2007. Infect Control Hosp Epidemiol. 2008;29(11):996-1011. [PubMed ID: 18947320]. https://doi.org/10.1086/591861.
  • 3.
    Hartzell JD, Kim AS, Kortepeter MG, Moran KA. Acinetobacter pneumonia: a review. MedGenMed. 2007;9(3):4. [PubMed ID: 18092011].
  • 4.
    Lin CY, Chen YM, Lin MC, Chang YP, Chao TY, Wang CC, et al. Risk factors of multidrug-resistant Acinetobacter baumannii recurrence after successful eradication in ventilated patients. Biomed J. 2016;39(2):130-8. [PubMed ID: 27372168]. https://doi.org/10.1016/j.bj.2015.07.001.
  • 5.
    Aliakbarzade K, Farajnia S, Karimi Nik A, Zarei F, Tanomand A. Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates. Jundishapur J Microbiol. 2014;7(10). e11924. [PubMed ID: 25632323]. https://doi.org/10.5812/jjm.11924.
  • 6.
    Kempf M, Rolain JM. Emergence of resistance to carbapenems in Acinetobacter baumannii in Europe: clinical impact and therapeutic options. Int J Antimicrob Agents. 2012;39(2):105-14. [PubMed ID: 22113193]. https://doi.org/10.1016/j.ijantimicag.2011.10.004.
  • 7.
    Grgurich PE, Hudcova J, Lei Y, Sarwar A, Craven DE. Management and prevention of ventilator-associated pneumonia caused by multidrug-resistant pathogens. Expert Rev Respir Med. 2012;6(5):533-55. [PubMed ID: 23134248]. https://doi.org/10.1586/ers.12.45.
  • 8.
    Scott P, Deye G, Srinivasan A, Murray C, Moran K, Hulten E, et al. An outbreak of multidrug-resistant Acinetobacter baumannii-calcoaceticus complex infection in the US military health care system associated with military operations in Iraq. Clin Infect Dis. 2007;44(12):1577-84. [PubMed ID: 17516401]. https://doi.org/10.1086/518170.
  • 9.
    Lei J, Han S, Wu W, Wang X, Xu J, Han L. Extensively drug-resistant Acinetobacter baumannii outbreak cross-transmitted in an intensive care unit and respiratory intensive care unit. Am J Infect Control. 2016;44(11):1280-4. [PubMed ID: 27217347]. https://doi.org/10.1016/j.ajic.2016.03.041.
  • 10.
    Poirel L, Bonnin RA, Nordmann P. Genetic basis of antibiotic resistance in pathogenic Acinetobacter species. IUBMB Life. 2011;63(12):1061-7. [PubMed ID: 21990280]. https://doi.org/10.1002/iub.532.
  • 11.
    Huang LY, Lu PL, Chen TL, Chang FY, Fung CP, Siu LK. Molecular characterization of beta-lactamase genes and their genetic structures in Acinetobacter genospecies 3 isolates in Taiwan. Antimicrob Agents Chemother. 2010;54(6):2699-703. [PubMed ID: 20368407]. https://doi.org/10.1128/AAC.01624-09.
  • 12.
    Farajnia S, Azhari F, Alikhani MY, Hosseini MK, Peymani A, Sohrabi N. Prevalence of PER and VEB Type Extended Spectrum Betalactamases among Multidrug Resistant Acinetobacter baumannii Isolates in North-West of Iran. Iran J Basic Med Sci. 2013;16(6):751-5. [PubMed ID: 23997900].
  • 13.
    Bagheri-Nesami M, Rafiei A, Eslami G, Ahangarkani F, Rezai MS, Nikkhah A, et al. Assessment of extended-spectrum beta-lactamases and integrons among Enterobacteriaceae in device-associated infections: multicenter study in north of Iran. Antimicrob Resist Infect Control. 2016;5:52. [PubMed ID: 27980729]. https://doi.org/10.1186/s13756-016-0143-2.
  • 14.
    Collee J, Miles R, Watt B. Tests for identification of bacteria. In: Collee JG, Fraser AG, Marmion BP, editors. Practical medical microbiology. 14th ed. Edinburgh: Churchill Livingstone; 1996. p. 131-50.
  • 15.
    Koneman EW, Allen SD, Janda WM, Schreckenberger R, Winn WC. Introduction to microbiology. Part II: Guidelines for the collection, transport, processing, analysis, and reporting of cultures from specific specimen sources. In: Koneman EW, Alien SD, Janda WM, Schreckenberger RC, Winn W, editors. Color atlasand textbook of diagnostic microbiology. 5th ed. Philadelphia: Lippincot; 1997. p. 121-70.
  • 16.
    ClSI. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. M100-S23. Clinical & Laboratory Standards Institute; 2013.
  • 17.
    Manchanda V, Sanchaita S, Singh N. Multidrug resistant acinetobacter. J Glob Infect Dis. 2010;2(3):291-304. [PubMed ID: 20927292]. https://doi.org/10.4103/0974-777X.68538.
  • 18.
    Rezai MS, Pourmousa R, Dadashzadeh R, Ahangarkani F. Multidrug resistance pattern of bacterial agents isolated from patient with chronic sinusitis. Caspian J Intern Med. 2016;7(2):114-9. [PubMed ID: 27386063].
  • 19.
    Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto CA, et al. Molecular epidemiology of CTX-M-producing Escherichia coli isolates at a tertiary medical center in western Pennsylvania. Antimicrob Agents Chemother. 2009;53(11):4733-9. [PubMed ID: 19687234]. https://doi.org/10.1128/AAC.00533-09.
  • 20.
    Naas T, Bogaerts P, Bauraing C, Degheldre Y, Glupczynski Y, Nordmann P. Emergence of PER and VEB extended-spectrum beta-lactamases in Acinetobacter baumannii in Belgium. J Antimicrob Chemother. 2006;58(1):178-82. [PubMed ID: 16670107]. https://doi.org/10.1093/jac/dkl178.
  • 21.
    Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008;52(8):2818-24. [PubMed ID: 18505851]. https://doi.org/10.1128/AAC.00171-08.
  • 22.
    Weldhagen GF, Poirel L, Nordmann P. Ambler class A extended-spectrum beta-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob Agents Chemother. 2003;47(8):2385-92. [PubMed ID: 12878494]. https://doi.org/10.1128/AAC.47.8.2385-2392.2003.
  • 23.
    Chen CH, Huang CC. Risk factor analysis for extended-spectrum beta-lactamase-producing Enterobacter cloacae bloodstream infections in central Taiwan. BMC Infect Dis. 2013;13:417. [PubMed ID: 24010678]. https://doi.org/10.1186/1471-2334-13-417.
  • 24.
    Correa FE, Dantas FG, Grisolia AB, Crispim Bdo A, Oliveira KM. Identification of class 1 and 2 integrons from clinical and environmental Salmonella isolates. J Infect Dev Ctries. 2014;8(12):1518-24. [PubMed ID: 25500649]. https://doi.org/10.3855/jidc.4734.
  • 25.
    Turton JF, Kaufmann ME, Warner M, Coelho J, Dijkshoorn L, van der Reijden T, et al. A prevalent, multiresistant clone of Acinetobacter baumannii in Southeast England. J Hosp Infect. 2004;58(3):170-9. [PubMed ID: 15501330]. https://doi.org/10.1016/j.jhin.2004.05.011.
  • 26.
    Landman D, Quale JM, Mayorga D, Adedeji A, Vangala K, Ravishankar J, et al. Citywide clonal outbreak of multiresistant Acinetobacter baumannii and Pseudomonas aeruginosa in Brooklyn, NY: the preantibiotic era has returned. Arch Intern Med. 2002;162(13):1515-20. [PubMed ID: 12090889]. https://doi.org/10.1001/archinte.162.13.1515.
  • 27.
    van den Broek PJ, Arends J, Bernards AT, De Brauwer E, Mascini EM, van der Reijden TJ, et al. Epidemiology of multiple Acinetobacter outbreaks in The Netherlands during the period 1999-2001. Clin Microbiol Infect. 2006;12(9):837-43. [PubMed ID: 16882288]. https://doi.org/10.1111/j.1469-0691.2006.01510.x.
  • 28.
    Rahimzadeh A, Farajnia S, POURBABAEE AA, Ansarin KH, ZOLFAGHARI MR, MASOUDI N. Detection of Prevalence of OXA-2 and OXA-10 Type ESBL and Class I integron among acinetobacter bumanii strains isolated from patients of Tabriz city (Iran) by PCR technique [In Persian]. J Babol Univ Med Sci. 2012;14(5):56-63.
  • 29.
    Kempf I, Fleury MA, Drider D, Bruneau M, Sanders P, Chauvin C, et al. What do we know about resistance to colistin in Enterobacteriaceae in avian and pig production in Europe? Int J Antimicrob Agents. 2013;42(5):379-83. [PubMed ID: 24076115]. https://doi.org/10.1016/j.ijantimicag.2013.06.012.
  • 30.
    Napier BA, Burd EM, Satola SW, Cagle SM, Ray SM, McGann P, et al. Clinical use of colistin induces cross-resistance to host antimicrobials in Acinetobacter baumannii. MBio. 2013;4(3):e00021-13. [PubMed ID: 23695834]. https://doi.org/10.1128/mBio.00021-13.
  • 31.
    Prim N, Rivera A, Espanol M, Mirelis B, Coll P. In Vivo Adaptive Resistance to Colistin in Escherichia coli Isolates. Clin Infect Dis. 2015;61(10):1628-9. [PubMed ID: 26318913]. https://doi.org/10.1093/cid/civ645.
  • 32.
    Garnacho-Montero J, Ortiz-Leyba C, Jimenez-Jimenez FJ, Barrero-Almodovar AE, Garcia-Garmendia JL, Bernabeu-Wittel IM, et al. Treatment of multidrug-resistant Acinetobacter baumannii ventilator-associated pneumonia (VAP) with intravenous colistin: a comparison with imipenem-susceptible VAP. Clin Infect Dis. 2003;36(9):1111-8. [PubMed ID: 12715304]. https://doi.org/10.1086/374337.
  • 33.
    Almasaudi SB. Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance features. Saudi Biol Sci. 2016. https://doi.org/10.1016/j.sjbs.2016.02.009.
  • 34.
    Yadav R, Landersdorfer CB, Nation RL, Boyce JD, Bulitta JB. Novel approach to optimize synergistic carbapenem-aminoglycoside combinations against carbapenem-resistant Acinetobacter baumannii. Antimicrob Agents Chemother. 2015;59(4):2286-98. [PubMed ID: 25645842]. https://doi.org/10.1128/AAC.04379-14.
  • 35.
    Safari M, Mozaffari Nejad AS, Bahador A, Jafari R, Alikhani MY. Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU). Saudi J Biol Sci. 2015;22(4):424-9. [PubMed ID: 26150748]. https://doi.org/10.1016/j.sjbs.2015.01.004.
  • 36.
    Alyamani EJ, Khiyami MA, Booq RY, Alnafjan BM, Altammami MA, Bahwerth FS. Molecular characterization of extended-spectrum beta-lactamases (ESBLs) produced by clinical isolates of Acinetobacter baumannii in Saudi Arabia. Ann Clin Microbiol Antimicrob. 2015;14:38. [PubMed ID: 26290183]. https://doi.org/10.1186/s12941-015-0098-9.
  • 37.
    Sharif M, Mirnejad R, Amirmozafari N. Molecular identification of TEM and SHV extended spectrum beta-lactamase in clinical isolates of Acinetobacter baumannii from Tehran hospitals. J Genes Microb Immun. 2014;2014:1-9. https://doi.org/10.5899/2014/jgmi-00020.
  • 38.
    Huang ZM, Mao PH, Chen Y, Wu L, Wu J. [Study on the molecular epidemiology of SHV type beta-lactamase-encoding genes of multiple-drug-resistant acinetobacter baumannii]. Zhonghua Liu Xing Bing Xue Za Zhi. 2004;25(5):425-7. [PubMed ID: 15231171].
  • 39.
    Hakemi Vala M, Hallajzadeh M, Hashemi A, Goudarzi H, Tarhani M, Sattarzadeh Tabrizi M, et al. Detection of Ambler class A, B and D ss-lactamases among Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014;27(1):8-13. [PubMed ID: 25249841].
  • 40.
    Ahanjan M, Kholdi S, Rafiei A. Antibiotic-resistance patterns and frequency of TEM and CTX type extended-spectrum β-lactamases in acinetobacter clinical isolates [In Persian]. J Mazandaran Univ Med Sci. 2014;24(116):32-40.
  • 41.
    Poirel L, Menuteau O, Agoli N, Cattoen C, Nordmann P. Outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a French hospital. J Clin Microbiol. 2003;41(8):3542-7. [PubMed ID: 12904353]. https://doi.org/10.1128/JCM.41.8.3542-3547.2003.
  • 42.
    Pasteran F, Rapoport M, Petroni A, Faccone D, Corso A, Galas M, et al. Emergence of PER-2 and VEB-1a in Acinetobacter baumannii Strains in the Americas. Antimicrob Agents Chemother. 2006;50(9):3222-4. [PubMed ID: 16940137]. https://doi.org/10.1128/AAC.00284-06.
  • 43.
    Fazeli H, Taraghian A, Poursina F, Kamali R. Molecular identification of Esbl Genes Bla-Shv, Bla-Veb, and Bla-Per, in acinetobacter Baumannii isolated from patients admitted in a university hospital in Isfahan. Iran J Public Health. 2014;43(2):39.
  • 44.
    Behzadnia S, Davoudi A, Rezai MS, Ahangarkani F. Nosocomial infections in pediatric population and antibiotic resistance of the causative organisms in north of iran. Iran Red Crescent Med J. 2014;16. [PubMed ID: 24719744].
  • 45.
    Saffar MJ, Enayti AA, Abdolla IA, Razai MS, Saffar H. Antibacterial susceptibility uropathogens in 3 hospitals, Sari, Islamic Republic of Iran, 2002-2003. East Mediterr Health J. 2018;14(3):556-63. [PubMed ID: 18720619].
  • 46.
    Eslami G, Rezaie MS, Salehifar E, Rafiei A, Langaie T, Rafati MR, et al. Epidemiology of Extended Spectrum Beta Lactamases Producing E. coli Genes in Strains Isolated from Children with Urinary Tract Infection in North of Iran. J Mazandaran Univ Med Sci. 2016;25(132):270-9.
  • 47.
    Yazdani Cherati J, Shojaee J, Chaharkameh A, Rezai MS, Khosravi F, Rezai F, et al. Incidence of nosocomial infection in selected cities according NISS software in Mazandaran province. J Mazandaran Univ Med Sci. 2015;24(122):64-72.
  • 48.
    Rezai MS, Bagheri-nesami M, Hajalibeig A, Ahangarkani F. Multidrug and Cross-resistance Pattern of ESBL-producing Enterobacteriaceae Agents of Nosocomial Infections in Intensive Care Units. J Mazandaran Univ Med Sci. 2017;26(144):39-49.
  • 49.
    Rezai MS, Salehifar E, Rafiei A, Langaee T, Rafati M, Shafahi K, Eslami G. Characterization of multidrug resistant extended-spectrum beta-lactamase-producing Escherichia coli among uropathogens of pediatrics in North of Iran. Biomed Res Int. 2015. [PubMed ID: 26064896]. https://doi.org/10.1155/2015/309478.
  • 50.
    Eslami G, Salehifar E, Behbudi M, Rezai MS. Rational Use of Amikacin in Buali-Sina Hospital in Sari 2011. J Mazandaran Univ Med Sci. 2013;23(100):2-9.
  • 51.
    Fahimzad A, Eydian Z, Karimi A, Shiva F, Sayyahfar S, Kahbazi M, et al. Surveillance of antibiotic consumption point prevalence survey 2014: Antimicrobial prescribing in pediatrics wards of 16 Iranian hospitals. Arch Iran Med. 2016;19(3):204-9. [PubMed ID: 26923893].
  • 52.
    Rezai M, Bagheri-Nesami M, Nikkhah A. Catheter-related urinary nosocomial infections in intensive care units: An epidemiologic study in North of Iran. Caspian J Intern Med. 2017;8(2):76-82. https://doi.org/10.22088/acadpub.BUMS.8.2.76.

Copyright

Copyright © 2017, Jundishapur Journal of Microbiology. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

20
Nov
2017

Phenotypic and Genotypic Detection of Extended Spectrum β-lactamase and Carbapenemases Production Including bla TEM, bla PER and bla NDM-1 Genes Among Acinetobacter baumannii Clinical Isolates

Mojtaba Moosavian,
Mehrandokht Sirous,
Nasim Shams

Moosavian M, Sirous M, Shams N. Phenotypic and Genotypic Detection of Extended Spectrum β-lactamase and Carbapenemases Production Including bla TEM, bla PER and bla NDM-1 Genes Among Acinetobacter baumannii Clinical Isolates. Jundishapur J Microbiol. 2017;10(12):e58206. doi: https://doi.org/10.5812/jjm.58206

5
Aug
2018
Extended-Spectrum Beta-Lactamases Producing <i>Pseudomonas aeruginosa</i> Isolated From Patients With Ventilator Associated Nosocomial Infection

Extended-Spectrum Beta-Lactamases Producing Pseudomonas aeruginosa Isolated From Patients With Ventilator Associated Nosocomial Infection

Mohammad Sadegh Rezai,
Fatemeh Ahangarkani,
Alireza Rafiei,
Azin Hajalibeig,
Masoumeh Bagheri-Nesami

Rezai MS, Ahangarkani F, Rafiei A, Hajalibeig A, Bagheri-Nesami M. Extended-Spectrum Beta-Lactamases Producing Pseudomonas aeruginosa Isolated From Patients With Ventilator Associated Nosocomial Infection. Arch Clin Infect Dis. 2018;13(4):e13974. doi: https://doi.org/10.5812/archcid.13974

14
May
2022
Jundishapur J Microbiol

Prevalence of Extended-Spectrum β-Lactamase Genes and Antibiotic Resistance Pattern in Clinical Isolates of Acinetobacter baumannii from Patients Hospitalized in Mashhad, Iran

Hasan Ghali Abdulhasan Alshami,
Maryam Abbasi Shaye,
Masoumeh Bahreini,
Mohammad Reza Sharifmoghadam

Alshami HGA, Abbasi Shaye M, Bahreini M, Sharifmoghadam MR. Prevalence of Extended-Spectrum β-Lactamase Genes and Antibiotic Resistance Pattern in Clinical Isolates of Acinetobacter baumannii from Patients Hospitalized in Mashhad, Iran. Jundishapur J Microbiol. 2022;15(3):e118944. doi: https://doi.org/10.5812/jjm-118944

15
Dec
2021
J Clin Res Paramed Sci

Antibiotic Resistance Pattern and Prevalence of blaOXA-51, blaNDM, blaVIM, blaPER, blaVEB, blaCTX, tetA and tetB Genes in Acinetobacter baumannii Isolated from Clinical Specimens of Hospitals in Tabriz city, Iran

Abolfazl Jafari Sales,
Sara Naebi,
Hossein Bannazadeh-Baghi,
Morteza Saki

Jafari Sales A, Naebi S, Bannazadeh-Baghi H, Saki M. Antibiotic Resistance Pattern and Prevalence of blaOXA-51, blaNDM, blaVIM, blaPER, blaVEB, blaCTX, tetA and tetB Genes in Acinetobacter baumannii Isolated from Clinical Specimens of Hospitals in Tabriz city, Iran. J Clin Res Paramed Sci. 2021;10(2):e118521. doi: https://doi.org/10.5812/jcrps.118521

21
Nov
2017

Prevalence of Extended-Spectrum β-Lactamases and Antibiotic Resistance Patterns in Acinetobacter baumannii Isolated from Clinical Samples in Kermanshah, Iran

Mohsen Azizi,
Seyed Hamidreza Mortazavi,
Misagh Etemadimajed,
Simin Gheini,
Siavash Vaziri,
Amirhooshang Alvandi
,et al.

Azizi M, Mortazavi SH, Etemadimajed M, Gheini S, Vaziri S, et al. Prevalence of Extended-Spectrum β-Lactamases and Antibiotic Resistance Patterns in Acinetobacter baumannii Isolated from Clinical Samples in Kermanshah, Iran. Jundishapur J Microbiol. 2017;10(12):e61522. doi: https://doi.org/10.5812/jjm.61522

Download PDF462.30 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles