Epidemiology and Molecular Detection of HAV, HBV, and HCV in Patients with Acute Hepatitis Symptoms in Ahvaz

Author(s):
Maryam TabasiMaryam Tabasi1,*, Manoochehr MakvandiManoochehr MakvandiManoochehr Makvandi ORCID1, Ali TeimooriAli Teimoori1, Maryam DastoorpoorMaryam DastoorpoorMaryam Dastoorpoor ORCID2, Hamid MoradzadeganHamid Moradzadegan3, Mahdi ParsanahadMahdi Parsanahad1, Roya PirmoradiRoya Pirmoradi1, Chiman KaramiChiman Karami1
1Department of Virology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Department of Epidemiology and Biostatistics, Faculty of Public Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3Pasteur Laboratory, Ahvaz, Iran
*Corresponding Author: Corresponding author: Maryam Tabasi, Department of Virology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Tel: +98-9126977137, E-mail: Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 11, issue 5; e63317
Published online:May 07, 2018
Article type:Research Article
Received:Oct 27, 2017
Accepted:Apr 04, 2018
How to Cite:Tabasi M, Makvandi M, Teimoori A, Dastoorpoor M, Moradzadegan H, et al. Epidemiology and Molecular Detection of HAV, HBV, and HCV in Patients with Acute Hepatitis Symptoms in Ahvaz. Jundishapur J Microbiol. 2018;11(5):e63317. doi: https://doi.org/10.5812/jjm.63317

Abstract

Background:

Viral hepatitis has emerged as a major public health problem leading to disproportionate degrees of morbidity and mortality worldwide.

Objectives:

This study describes epidemiology of hepatitis A virus (HAV), hepatitis B virus (HBV), and hepatitis C virus (HCV), and associated risk factors in patients with acute hepatitis symptoms in southwest of Iran (Ahvaz).

Methods:

A total of 150 serum samples from patients with elevated serum aminotransferase levels were subjected to serological and molecular assays.

Results:

The sero-prevalence of HAV, HBV, and HCV was 79.3%. Furthermore, HAV, HBV, and HCV nucleic acids were detected in 28%, 18.7%, and 22.7% of samples, respectively. All HAV cases were categorized in the IB genotype and HBV isolates belonged to genotype D. Hepatitis C virus RNA-positive samples were clustered in genotypes 1a (38.3%) and 3a (61.7%). The authors found that some risk factors, such tattooing and traveling to endemic areas, had a crucial role in rising of viral hepatitis frequency in Ahvaz city.

Conclusions:

These results document the prevalence of circulating viral hepatitis in Ahvaz city and may draw attention to the necessity for a comprehensive program to control viral hepatitis in this region.

1. Background

Viral hepatitis is a growing global public health concern both in developed and developing countries. In 2013, viral hepatitis was the seventh leading cause of death worldwide (1). There are several unrelated hepatotropic viruses causing wide spectrum of liver diseases ranging from simple steatosis infection to hepatocellular carcinoma (HCC). Hepatitis A virus (HAV), hepatitis B virus (HBV), and hepatitis C virus (HCV) are the major causative agents of acute viral infections. Hepatitis A virus infection occurs mostly in children, and accounts for an estimated 1.5 million cases each year. Unlike HBV and HCV, as the main chronic hepatitis viruses, HAV transmits enterically and the following infection is self-limiting and never leads to a chronic hepatitis (2, 3).
Unfortunately, despite therapeutic advances and effective vaccine for HBV, there are nearly 2 billion infected people and more than 240 million chronic carriers, worldwide (4). In addition, about 170 million people have been infected chronically by HCV and approximately 700000 deaths occur annually due to HCV-related liver disease (5). It must be noted that chronic carriers of HBV and HCV viruses are the source of new infections and serious liver diseases, such as cirrhosis, HCC, fulminant hepatitis failure (FHF), and encephalopathy due to super-infection caused by other hepatitis viruses, such as HAV or HDV (6-10).
Serological methods for detection of HBsAg and anti-HCV are routinely used in diagnostic laboratories. However, because of problems with serological assays, such as window period and occult hepatitis B/C infections among serologically negative patients, nucleic acid tests (NATs) are the gold standard for diagnosing of infections and following the treatments.

2. Objectives

The authors performed a molecular-based epidemiological survey to detect and evaluate HAV, HBV, and HCV infections and associated risk factors among patients with acute hepatitis manifestations.

3. Methods

3.1. Ethics Statement

This work was registered with grant No. GD-94118 and financially supported by infectious and tropical diseases research center, faculty of medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz.

3.2. Patients and Samples

The current study was conducted at the virology department of the Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences. During March to December, 2016, a total of 150 sera were collected from patients with elevated serum aminotransferase levels (at least 2 times greater than the upper reference value). All samples belonged to patients, who attended clinical laboratories in Ahvaz (Pasteur and Jahad Daneshgahi). Patients with fatty liver disease, cirrhosis, hepatocellular carcinoma, and genetic and metabolic disorders were excluded.

3.3. Serological Testing

All sera were tested for anti HAV IgM, HBsAg, and Anti-HCV, using the Enzyme Linked Immunosorbent Assay (ELISA) kit (Diapro, Italy), then stored at -70°C until used for DNA extraction and polymerase chain reaction (PCR).

3.4. Primers

5’-untranslated regions (5’-UTR) of HAV/HCV and X region of HBV (the highly conserved regions) were targeted to PCR detection. VP1/2A junction, S, and core regions of HAV, HBV, and HCV, respectively, were considered in genotype determination assays. By using NCBI Primer BLAST, it was proved that the primers did not attach to any other sequences except HAV, HBV, and HCV. The sequences of all used primers for detection and genotyping were picked from previous studies and shown in Table 1.
Table 1.The Sequences of Used Primers for Detection and Phylogenetic Analysis
VirusPrimerSequence (5’ - 3’)Amplicon SizeTarget AgeneReference
HAVForwardTTGGAACGTCACCTTGCAGTG3695’-UTR(11)
Reverse (outer)CTGAGTACCTCAGAGGCAAAC5’-UTR
Reverse (inner)GAACAGTCCAGCTGTCAATGG3305’-UTR
BR-5a (outer)TTGTCTGTCACAGAACAATCAG361VP1/2A junction(12)
BR-9a (outer)AGTCACACCTCTCCAGGAAAACTTVP1/2A junction
RJ-3b (inner)TCCCAGAGCTCCATTGAA234VP1/2A junction
BR-6a (inner)AGGAGGTGGAAGCACTTCATTTGAVP1/2A junction
HBVForwardGTCCCCTTCTTCATCTGCCGT139X gene(13)
Reverse (outer)GTTCACGGTGGTCTCCATGX gene
Reverse (inner)ACGTGCAGAGGTGAAGCGAAG118X gene
ForwardCGTGGTGGACTTCTCTCAATTTTC417S gene(14)
ReverseGCCARGAGAAACGGRCTGAGGCCCS gene
HCVForward (outer)CACTCCCCTGTGAGGAACTACTGTC3065’-UTR(15)
Reverse (outer)ATGGTGCACGGTCTACGAGACCTCC5’-UTR
Forward (inner)TTCACGCAGAAAGCGTCTAGCCATG2765’-UTR(16)
Reverse (inner)GCGCACTCGCAAGCACCCTATCAGG5’-UTR
Forward (SC2)GGGAGGTCTCGTAGACCGTGCACCATG440Core gene
Reverse (AC2)GAGMGGKATRTACCCATGAGRTCGGCCore gene
Forward (S7)AGACCGTGCACCATGAGCAC416Core gene
Reverse (584)CCCATGAGGTCGGCRAARCCore gene

3.5. Nucleic Acid Extraction

All sera were subjected to nucleic acid extraction using the high pure viral nucleic acid kit (Roche, Germany), according to the manufacturer’s protocol.

3.6. Assay Optimization

After optimizing of primer concentrations and MgCl2 in a final reaction volume of 50 µL, PCR detection of HAV, HBV, and HCV was performed. To determine the optimum annealing temperature, gradient PCR was set at 55°C to 65°C. The best condition for each virus was obtained and then samples along with negative (water) and positive controls (previously known PCR-positive samples of HAV, HBV, and HCV) were amplified.

3.7. HAV and HCV Genome Amplification

The reverse transcription polymerase chain reaction (RT-PCR) with the use of QIAGEN One-Step RT-PCR kit for HAV and HCV was set as follows: RT step 50°C/30 minutes, initial activation at 95°C/15 minutes, 40 cycles of 94°C/30 seconds, 58°C/30 seconds, 72°C/30 seconds, and a final extension step of 72°C/10 minutes. Nested PCR step using 5 µL of RT-PCR step products and inner primer sets of HAV and HCV was performed as follows: initial activation at 95°C/5 minutes, 40 cycles of 94°C/30 seconds, 58°C/30 seconds, 72°C/30 seconds, and a final extension step of 72°C/10 minutes. All reactions were performed at least twice and in the presence of negative and positive controls. The final products were detected by electrophoresis on 2% agarose gel containing DNA Safestain (Sinagene, Iran) under UV transilluminator (VILBERANT LUMART, France). The sizes of the PCR products were estimated according to the migration pattern of a 100-bp DNA ladder (Sinagene, Iran) (Figure 1).
Electrophoresis pattern of PCR products of HAV, HBV, and HCV at the detection step. The products length were 330 bp for HAV (lane 1), 118 bp for HBV (lane 2, 3) and 276 bp for HCV (lane 4, 5). Lane 6: positive controls, lane 7: 100 bp DNA ladder.
Figure 1.

Electrophoresis pattern of PCR products of HAV, HBV, and HCV at the detection step. The products length were 330 bp for HAV (lane 1), 118 bp for HBV (lane 2, 3) and 276 bp for HCV (lane 4, 5). Lane 6: positive controls, lane 7: 100 bp DNA ladder.

3.8. HAV and HCV Genotyping Assay

Polymerase Chain Reaction-positive samples at the detection step were considered for genotype determination assays. The RT-PCR and nested PCR reactions were carried out like the previous step but this time with specific primers for HAV VP1/2A junction and HCV core region.

3.9. HBV PCR Detection and Genotyping

Molecular detection of HBV DNA was set as follows: initial activation at 95°C/5 minutes, 40 cycles at 94°C/30 seconds, 56°C/30 seconds, 72°C/30 seconds, and a final extension step of 72°C/10 minutes. Semi-nest PCR amplifications were performed similar to the first step with different reverse primers. Hepatitis B virus genotyping was carried out with the same conditions, but using other primer pairs which targeted the S gene on HBV DNA-positive samples. All reactions were performed in duplicate and in the presence of negative and positive controls. The final products were detected by electrophoresis on 2% agarose gel and the size of the PCR products were estimated by the migration pattern of a 100-bp DNA ladder (Figure 1).

3.10. Sequencing Analysis

Positive results from the second rounds of PCR amplifications were sequenced in both directions with the use of big dye terminator v3.1 cycle sequencing kit (Applied Biosystems), according to the manufacturer’s instructions. Forward and reverse sequences were aligned by BioEdit sequence alignment editor version 7.0.5.3 and consensus sequences were obtained. The sequences were deposited at GenBank under the accession numbers KX657751-KX657763 and MF673435-MF673437.

3.11. Phylogenetic Study

The MEGA6.06 software was used for phylogenetic analysis. The multiple sequences alignment of retrieved sequences from GenBank and the sequences of this study were achieved by CLUSTAL W. The bootstrap neighbor joining method with 1000 replicates was performed to determine the evolutionary distances.

3.12. Statistical Analysis

Data are reported as frequency and mean ± standard deviation (SD). The univariate and multiple logistic regression models (backward method) were used for analysis of risk factors. For analysis, SPSS software 22 was used and to test the hypotheses, the significance level was less than 0.05.

4. Results

4.1. Study Population

The study was carried out with 150 serum samples from patients with symptoms of acute hepatitis. All patients had high levels of alanine aminotransferase (ALT) and aspartate transaminase (AST). The group included 54 (36%) females and 96 (64%) males with a mean age of 34.25 ± 9.167 years, ranging from 8 to 65 years. The mean ALT and AST levels were 184.77 ± 120.12 and 90.86 ± 15.738, respectively. Distribution of risk factors among the 150 patients is shown in Figure 2.
Risk factors distribution among 150 cases with acute hepatitis symptoms
Figure 2.

Risk factors distribution among 150 cases with acute hepatitis symptoms

4.2. Serological Findings

Out of 150 samples, 49 (32.6%), 32 (21.3%), and 38 (25.3%) were positive for anti-HAV, HBsAg, and anti-HCV, respectively. The characteristics of acute hepatitis infection are illustrated in Table 2.
Table 2.Characteristics of the Different Acute Viral Hepatitis Infectionsa
VariableHAV RNAHBV DNAHCV RNA
Patients42 (28)28 (18.7)34 (22.7)
Male22 (52.4)19 (68)27 (79.4)
Age, y24.3 ± 5.937 ± 4.940 ± 5.6
Mean value of ALT, IU/L229.74 ± 143.6165.9 ± 101.01173.3 ± 137.6
Mean value of AST, IU/L98.5 ± 22.183.8 ± 9.290.5 ± 14.4

aValues are expressed as No. (%) or mean ± SD.

4.3. HAV Molecular Detection and Genotyping

Forty-two of 150 samples (28%) were HAV RNA-positive by RT-PCR. All positive samples were HAV IgM positive as well. The mean range of ALT and AST of these patients were 229.74 IU/L and 98.48 IU/M, respectively. Genotyping via specific primers for VP1/2A region as well as data analysis suggested that all HAV isolates belonged to genotype IB (Figure 3).
Neighbor-joining phylogenetic tree of HAV VP1-2A regions. The sequence from this study is marked and all sequences are defined by accession number / year/origin of the strain, respectively.
Figure 3.

Neighbor-joining phylogenetic tree of HAV VP1-2A regions. The sequence from this study is marked and all sequences are defined by accession number / year/origin of the strain, respectively.

4.4. HBV Detection and Genotyping

Hepatitis B virus DNA was detected in 28 (18.7 %) of 150 samples, using semi nested PCR. All cases were HBsAg-positive and the mean ALT and AST levels for these patients were 165.9 IU/L and 83.8 IU/L, respectively. These positive samples were subjected to additional PCR amplification on the S gene for genotype determination. The multiple alignments of obtained HBV sequences from this study and those retrieved from GenBank database (representing all 8 genotypes) indicated that all sequences were consistent with genotype D (Figure 4).
A phylogenetic tree based on 393 nt of the HBV S region. The bootstrap neighbor joining method with 1000 replicates was performed to determine the evolutionary distances. HBV genotype C was utilized as an out-group. Sequences are defined by accession number/year/origin of the strain, respectively. The sequences related to this study are marked.
Figure 4.

A phylogenetic tree based on 393 nt of the HBV S region. The bootstrap neighbor joining method with 1000 replicates was performed to determine the evolutionary distances. HBV genotype C was utilized as an out-group. Sequences are defined by accession number/year/origin of the strain, respectively. The sequences related to this study are marked.

4.5. HCV Detection and Genotyping

Overall, 34 of 150 (22.7%) samples were positive using RT-PCR, aimed at the HCV 5’-UTR. The mean value of ALT and AST levels in HCV RNA-positive patients were 173.3 IU/L and 90.5 IU/L, respectively. For genotype detection, core region was amplified and comparison between acquired sequences and previously reported sequences indicated that HCV RNA-positive samples could be classified to genotypes 1a (13/34, 38.2%) and 3a (21/34, 61.7%) (Figure 5).
Neighbor-joining phylogenetic tree for core region of HCV genotype 1 (A) and HCV genotype 3 (B). Bootstrap values for 1000 replicates are given on the branches as percentages. HCV genotype 6 was utilized as an out-group. All sequences are defined by accession number / year / origin of the strain, respectively. The obtained strains from this study are marked.
Figure 5.

Neighbor-joining phylogenetic tree for core region of HCV genotype 1 (A) and HCV genotype 3 (B). Bootstrap values for 1000 replicates are given on the branches as percentages. HCV genotype 6 was utilized as an out-group. All sequences are defined by accession number / year / origin of the strain, respectively. The obtained strains from this study are marked.

5. Discussion

This research conducted a molecular-based epidemiological survey to detect viral hepatitis in patients with acute hepatitis. In the current study, the total seroprevalence of HAV, HBV, and HCV was found to be 79.3% (119/150). There was not any difference in the prevalence of acute viral hepatitis among the patients, when stratified according to gender. As indicated, in the present study, nearly 20% of sera were negative for HAV, HBV, and HCV. It should be noticed that there are also other viruses causing acute hepatitis, such as HDV, HEV, GB virus C, EBV, B19, herpes simplex virus, etc., which were not considered in this survey (17-21). Therefore, in the current study, HAV, HBV, and HCV-negative cases might be infected with other hepatitis viruses. Thus, further investigation is required for better understanding of the role and epidemiology of viral hepatitis in extension and transmission of liver diseases.
According to the data from the centers for disease control and prevention (CDC), Iran is an endemic region for HAV infection and there is no significant difference in genders (2, 22, 23). In the current study, the overall seroprevalence of anti-HAV and HAV RNA was 32.6% and 28%, respectively, and phylogenetic analysis suggested that all HAV isolates belonged to genotype IB. The mean age of patients with acute HAV infection was lower than those with acute hepatitis B or C (Table 2). The mean of ALT and AST levels in HAV-infected cases were higher than those with HBV and HCV infections (Table 2). Considering several studies, the prevalence of HAV in the country was about 51% to 66% and as Nejati et al. published in 2012, the predominant circulating genotype was IB (12, 23). However, further epidemiological studies are needed to clarify HAV diversity in other regions of Iran. In this study, the associated risk factor for HAV infections was found to be in touch or close contact with an infected relative, but after multivariate analysis using logistic regression, no significant difference was found (Tables 3 and 4). Hepatitis A Virus is transmitted primarily by the fecal-oral route, and vaccination along with health education for improving the sanitation, is the most successful way to control the infection in endemic areas.
Table 3.Univariate Logistic Regression for Associated Risk Factors with Viral Hepatitisa
Risk FactorHAVHBVHCV
Neg.Pos.P ValueORNeg.Pos.P ValueORNeg.Pos.P ValueOR
Infected relative0.0423.430.9660.960.2870.32
No103 (95.4)36 (85.7)113 (92.6)26 (92.9)106 (91.4)33 (97.1)
Yes5 (4.6)6 (14.3)9 (7.4)2 (7.1)10 (8.6)1 (2.9)
Dental care0.6951.210.9031.070.4100.68
No21 (19.4)7 (16.7)23 (18.9)5 (17.9)20 (17.2)8 (23.5)
Yes87 (80.6)35 (83.3)99 (81.1)23 (82.1)96 (82.8)26 (76.5)
Surgery0.0010.030.0960.410.0092.87
No62 (57.4)41 (97.6)80 (65.6)23 (82.1)86 (74.1)17 (50)
Yes46 (42.6)1 (2.4)42 (34.4)5 (17.9)30 (25.9)17 (50)
Blood transfusion0.2440.400.270.310.4380.54
No96 (88.9)40 (95.2)109 (89.3)27 (96.4)104 (89.7)32 (94.1)
Yes12 (11.1)2 (4.8)13 (10.7)1 (3.6)1210.32 (5.9)
Tattooing0.0030.050.1371.96< 0.0014.80
No72 (66.7)41 (97.6)95 (77.9)18 (64.3)96 (82.8)17 (50.0)
Yes36 (33.3)1 (2.4)27 (22.1)10 (35.7)20 (17.2)17 (50)
Travelling to endemic area0.0020.10< 0.0014.970.8621.08
No72 (66.7)40 (95.2)99 (81.1)13 (46.4)87 (75)25 (73.5)
Yes36 (33.3)2 (4.8)23 (18.9)15 (53.6)29 (25)9 (26.5)
IV drug0.9980.000.6600.700.0582.89
No94 (87)42 (100)110 (90.2)26 (92.9)108 (93.1)28 (82.4)
Yes14 (13)0 (0.0)12 (9.8)2 (7.1)8 (6.9)6 (17.6)

aValues are expressed as No. (%).

Table 4.Multiple Logistic Regression for Associated Risk Factors with Viral Hepatitis
VirusRisk FactorBS.EWalddfP ValueOR
HAVAge-0.3360.06625.70610.0010.72
AST0.0500.0312.59310.1071.05
Tattooing-4.8153.6131.77610.1830.01
IV drug-19.5068556.3130.00010.9980.00
Constant5.4843.4872.47310.116240.74
HBVAST-0.0650.0238.04610.0050.94
Surgery-1.2630.5734.86510.0270.28
Travelling to endemic area1.5940.47711.16910.0014.92
Constant3.9781.9884.00310.04553.41
HCVAge0.0990.03011.12310.0011.10
Tattooing1.2740.4468.17910.0043.58
Constant-5.2381.14221.02410.0010.01
Iran is classified as an area with low to intermediate prevalence of HBV. The estimated rate of HBV infection in this country is about 3%, and is higher in males than females (2.55% versus 2.03%, respectively). Previous epidemiological studies indicated that HBV genotype D is the most prevalent genotype in Iran (24-28). In the current study, the S region was analyzed to determine HBV genotypes and data revealed that all HBV sequences had molecular characteristics of genotype D. Compared with the RefSeq and original GenBank resources, five substitutions were found at the nucleotide level, G362T, C391G, A543C, T562C, and C584G, all of which were missense (C121F, R131G, Q181H, S188P and S195W). In the current study, the multivariable analysis showed that the risk of acute hepatitis B infection increased nearly 5 times by traveling to the endemic area (Table 3 and 4). Hepatitis B Virus transmits by contact with contaminated body fluids, such as blood, blood products, and semen. The national HBV vaccination program for newborn and healthcare workers in Iran was started since 1993. However, a major proportion of community is unvaccinated and susceptible to the infection. Therefore, HBV vaccination as well as consultation services about the serious risks of blood-borne pathogens among unvaccinated people traveling to areas with intermediate or high prevalence of HBV infection is essential.
In the present study, HCV prevalence rate was estimated through the amplification of 5’-UTR, a highly conserved region among all genotypes, especially genotypes 1 to 6. Since the study of sequence diversity among different isolates is crucial, especially for analyzing response to therapy, sequencing of other regions, such as core and NS5B, is recommended for achieving high accuracy of virus dynamics and genotyping (29-32). Iran is categorized as a low-HCV prevalence region and HCV seroprevalence can vary from 0.08% to 1.6% in different provinces (32-34). Like many European countries, the predominant HCV genotypes among Iranian patients are 1 and 3, while in other Middle East countries, the main genotype is 4. During the recent years, the pattern of HCV genotypes has changed in the country and a shift in prevalent subtype from 1a to 3a was noticed.
The current results are in line with this observation and genotype 3a was found as the most prevalent HCV genotype (61.7%). This is probably associated with the increase of Intravenous Drug Users (IDUs) and needle sharing, since genotype 3 is commonly found in IDUs. According to the reports of CDC, Intravenous (IV) drugs and needle sharing are the most common risk factors for infection with HCV in many countries. However, the current results indicated that tattooing has a significant relationship with HCV infection in Ahvaz city and can increase the risk of infection by 3.5 times (Table 4). It has been declared that the risk of HCV infection rises with increasing of covered areas and the number of tattoos (35). Since tattooing is especially popular among young people, a comprehensive educational program should be performed about the important risk of blood borne infections for the youth community.

6. Conclusions

The current study showed the molecular epidemiology of circulating viral hepatitis in the country and may contribute to the information on the genetic diversity of viral hepatitis worldwide. It can also underlines the necessity of further studies and evaluation of preventive programs, such as rigorous screening and treatment, vaccination in high risk groups, social services like the needle exchange program (NEP) and consultation among young people to reduce risk factors in the country.

Acknowledgments

Footnotes

  • Conflicts of Interest:There was no conflict of interest.

References

  • 1.
    Stanaway JD, Flaxman AD, Naghavi M, Fitzmaurice C, Vos T, Abubakar I, et al. The global burden of viral hepatitis from 1990 to 2013: findings from the Global Burden of Disease Study 2013. Lancet. 2016;388(10049):1081-8. [PubMed ID: 27394647]. https://doi.org/10.1016/S0140-6736(16)30579-7.
  • 2.
    Campagna M, Maria Mereu N, Mulas L, Pilia R, Francesca Piazza M, Spada L, et al. Pattern of Hepatitis A Virus Epidemiology in Nursing Students and Adherence to Preventive Measures at Two Training Wards of a University Hospital. Hepat Mon. 2016;16(2). e34219. [PubMed ID: 27195012]. https://doi.org/10.5812/hepatmon.34219.
  • 3.
    Abd El-Kader SM, El-Den Ashmawy EM. Non-alcoholic fatty liver disease: The diagnosis and management. World J Hepatol. 2015;7(6):846-58. [PubMed ID: 25937862]. https://doi.org/10.4254/wjh.v7.i6.846.
  • 4.
    Lavanchy D, Kane M. Global Epidemiology of Hepatitis B Virus Infection. Hepatitis B Virus in Human Diseases. 1 ed. 2016. p. 187-203. https://doi.org/10.1007/978-3-319-22330-8_9.
  • 5.
    Etienne L, Blanchard E, Boyer A, Desvignes V, Gaillard J, Meunier JC, et al. The Replacement of 10 Non-Conserved Residues in the Core Protein of JFH-1 Hepatitis C Virus Improves Its Assembly and Secretion. PLoS One. 2015;10(9). e0137182. [PubMed ID: 26339783]. https://doi.org/10.1371/journal.pone.0137182.
  • 6.
    Lee K, Smith PT. Fulminant liver failure from acute HCV superinfection in a patient with HIV, HBV, and HDV coinfections. AIDS Read. 2000;10(7):398. 401. [PubMed ID: 10932838].
  • 7.
    Irshad M, Gupta P, Mankotia DS, Ansari MA. Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review. World J Gastroenterol. 2016;22(20):4824-34. [PubMed ID: 27239109]. https://doi.org/10.3748/wjg.v22.i20.4824.
  • 8.
    Costa EG, Ghersetti M, Grazioli S, Casarin P. Prolonged and biphasic acute hepatitis A in hepatitis B virus carrier. Ital J Med. 2016;10:571. https://doi.org/10.4081/itjm.2016.571.
  • 9.
    Thomas E, Yoneda M, Schiff ER. Viral hepatitis: past and future of HBV and HDV. Cold Spring Harb Perspect Med. 2015;5(2). a021345. [PubMed ID: 25646383]. https://doi.org/10.1101/cshperspect.a021345.
  • 10.
    Vento S, Garofano T, Renzini C, Cainelli F, Casali F, Ghironzi G, et al. Fulminant hepatitis associated with hepatitis A virus superinfection in patients with chronic hepatitis C. N Engl J Med. 1998;338(5):286-90. [PubMed ID: 9445408]. https://doi.org/10.1056/NEJM199801293380503.
  • 11.
    Pina S, Buti M, Jardi R, Clemente-Casares P, Jofre J, Girones R. Genetic analysis of hepatitis A virus strains recovered from the environment and from patients with acute hepatitis. J Gen Virol. 2001;82(Pt 12):2955-63. [PubMed ID: 11714971]. https://doi.org/10.1099/0022-1317-82-12-2955.
  • 12.
    Nejati A, Makvandi M, Samarbafzadeh A, Neisi N, Moradzadegan H. Molecular epidemiology of hepatitis A virus in patients in the Ahwaz region of Iran. J Med Virol. 2012;84(4):582-6. [PubMed ID: 22337296]. https://doi.org/10.1002/jmv.23238.
  • 13.
    Ding X, Gu H, Zhong ZH, Zilong X, Tran HT, Iwaki Y, et al. Molecular epidemiology of hepatitis viruses and genotypic distribution of hepatitis B and C viruses in Harbin, China. Jpn J Infect Dis. 2003;56(1):19-22. [PubMed ID: 12711821].
  • 14.
    Italiano CM, Speers DJ, Chidlow GR, Dowse GK, Robertson AG, Flexman JP. Hepatitis B outbreak following a mass-casualty incident, Australia. J Infect Dis. 2011;204(3):400-7. [PubMed ID: 21742838]. https://doi.org/10.1093/infdis/jir269.
  • 15.
    Matsumori A, Yutani C, Ikeda Y, Kawai S, Sasayama S. Hepatitis C virus from the hearts of patients with myocarditis and cardiomyopathy. Lab Invest. 2000;80(7):1137-42. [PubMed ID: 10908160]. https://doi.org/10.1038/labinvest.3780120.
  • 16.
    Makvandi M, Khalafkhany D, Rasti M, Neisi N, Omidvarinia A, Mirghaed AT, et al. Detection of Hepatitis C virus RNA in peripheral blood mononuclear cells of patients with abnormal alanine transaminase in Ahvaz. Indian J Med Microbiol. 2014;32(3):251-5. [PubMed ID: 25008816]. https://doi.org/10.4103/0255-0857.136553.
  • 17.
    Abe K, Hayakawa E, Sminov AV, Rossina AL, Ding X, Huy TT, et al. Molecular epidemiology of hepatitis B, C, D and E viruses among children in Moscow, Russia. J Clin Virol. 2004;30(1):57-61. [PubMed ID: 15072755]. https://doi.org/10.1016/j.jcv.2003.08.009.
  • 18.
    Blackard JT, Ma G, Welge JA, King CC, Taylor LE, Mayer KH, et al. GB Virus C (GBV-C) Infection in Hepatitis C Virus (HCV) Seropositive Women with or at Risk for HIV Infection. PLoS One. 2014;9(12). e114467. [PubMed ID: 25493916]. https://doi.org/10.1371/journal.pone.0114467.
  • 19.
    Yoto Y, Kudoh T, Haseyama K, Suzuki N, Chiba S. Human parvovirus B19 infection associated with acute hepatitis. Lancet. 1996;347(9005):868-9. [PubMed ID: 8622394]. https://doi.org/10.1016/S0140-6736(96)91348-3.
  • 20.
    Drebber U, Kasper HU, Krupacz J, Haferkamp K, Kern MA, Steffen HM, et al. The role of Epstein-Barr virus in acute and chronic hepatitis. J Hepatol. 2006;44(5):879-85. [PubMed ID: 16554102]. https://doi.org/10.1016/j.jhep.2006.02.006.
  • 21.
    Kusne S, Schwartz M, Breinig MK, Dummer JS, Lee RE, Selby R, et al. Herpes simplex virus hepatitis after solid organ transplantation in adults. J Infect Dis. 1991;163(5):1001-7. [PubMed ID: 1850439]. https://doi.org/10.1093/infdis/163.5.1001.
  • 22.
    Hesamizadeh K, Sharafi H, Keyvani H, Alavian SM, Najafi-Tireh Shabankareh A, Sharifi Olyaie R, et al. Hepatitis A Virus and Hepatitis E Virus Seroprevalence Among Blood Donors in Tehran, Iran. Hepat Mon. 2016;16(1). e32215. [PubMed ID: 27110256]. https://doi.org/10.5812/hepatmon.32215.
  • 23.
    Farajzadegan Z, Hoseini SG, Kelishadi R, Jamshidi F, Nokhodian Z, Noori R, et al. Systematic review and meta-analysis on the age-specific seroprevalence of hepatitis A in Iran. J Res Med Sci. 2014;19(Suppl 1):S56-63. [PubMed ID: 25002897].
  • 24.
    Kumar K, Kumar M, Rahaman SH, Singh TB, Patel SK, Nath G. Distribution of Hepatitis B virus genotypes among healthy blood donors in eastern part of North India. Asian J Transfus Sci. 2011;5(2):144-9. [PubMed ID: 21897593]. https://doi.org/10.4103/0973-6247.83240.
  • 25.
    Pourkarim MR, Sharifi Z, Soleimani A, Amini-Bavil-Olyaee S, Elsadek Fakhr A, Sijmons S, et al. Evolutionary analysis of HBV "S" antigen genetic diversity in Iranian blood donors: a nationwide study. J Med Virol. 2014;86(1):144-55. [PubMed ID: 24150816]. https://doi.org/10.1002/jmv.23798.
  • 26.
    Ramezani F, Alavian SM, Sadeghi A, Khedive A, Ghalichi L, Norouzi M, et al. Evolution of hepatitis B virus surface gene and protein among Iranian chronic carriers from different provinces. Iran J Microbiol. 2015;7(4):214-20. [PubMed ID: 26697161].
  • 27.
    Mousavi T, Haghshenas MR, Rafiei A, Navaei RA, Khah ZH. Hepatitis B Virus Genotypes Distribution with HBsAg Positive in the North of Iran (Mazandaran) During 2011-2014. Med Arch. 2014;68(6):376-80. [PubMed ID: 25648402]. https://doi.org/10.5455/medarh.2014.68.376-380.
  • 28.
    Mohammadi Z, Keshtkar A, Eghtesad S, Jeddian A, Pourfatholah AA, Maghsudlu M, et al. Epidemiological Profile of Hepatitis B Virus Infection in Iran in the Past 25 years; A Systematic Review and Meta-analysis of General Population Studies. Middle East J Dig Dis. 2016;8(1):5-18. [PubMed ID: 26933476]. https://doi.org/10.15171/mejdd.2016.01.
  • 29.
    Zein NN. Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev. 2000;13(2):223-35. [PubMed ID: 10755999]. https://doi.org/10.1128/CMR.13.2.223-235.2000.
  • 30.
    Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, et al. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology. 2005;42(4):962-73. [PubMed ID: 16149085]. https://doi.org/10.1002/hep.20819.
  • 31.
    Kleter GE, van Doorn LJ, Brouwer JT, Schalm SW, Heijtink RA, Quint WG. Sequence analysis of the 5' untranslated region in isolates of at least four genotypes of hepatitis C virus in The Netherlands. J Clin Microbiol. 1994;32(2):306-10. [PubMed ID: 8150939].
  • 32.
    Taherkhani R, Farshadpour F. Epidemiology of hepatitis C virus in Iran. World J Gastroenterol. 2015;21(38):10790-810. [PubMed ID: 26478671]. https://doi.org/10.3748/wjg.v21.i38.10790.
  • 33.
    Hajarizadeh B, Razavi-Shearer D, Merat S, Alavian SM, Malekzadeh R, Razavi H. Liver Disease Burden of Hepatitis C Virus Infection in Iran and the Potential Impact of Various Treatment Strategies on the Disease Burden. Hepat Mon. 2016;16(7). e37234. [PubMed ID: 27642346]. https://doi.org/10.5812/hepatmon.37234.
  • 34.
    Mirminachi B, Mohammadi Z, Merat S, Neishabouri A, Sharifi AH, Alavian SH, et al. Update on the prevalence of hepatitis c virus infection among Iranian general population: A systematic review and meta-analysis. Hepat Mon. 2017;17(2). https://doi.org/10.5812/hepatmon.42291.
  • 35.
    Jafari S, Copes R, Baharlou S, Etminan M, Buxton J. Tattooing and the risk of transmission of hepatitis C: a systematic review and meta-analysis. Int J Infect Dis. 2010;14(11):e928-40. [PubMed ID: 20678951]. https://doi.org/10.1016/j.ijid.2010.03.019.

Copyright

Copyright © 2018, Jundishapur Journal of Microbiology. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

Similar Articles

22
Oct
2025
Hepat Mon

The Incidence of Hepatitis A and the Variables Influencing the Outbreak in Southwest Iran Over Ten Years (2013 - 2023)

Homayoun Amiri,
Mohammad Javad Mohammadi,
Majid Farhadi,
Narges Zahiri,
Saeed Ghanbari,
Fatemeh Kiani
,et al.

Amiri H, Mohammadi MJ, Farhadi M, Zahiri N, Ghanbari S, et al. The Incidence of Hepatitis A and the Variables Influencing the Outbreak in Southwest Iran Over Ten Years (2013 - 2023). Hepat Mon. 2025;25(1):e165205. doi: https://doi.org/10.5812/hepatmon-165205

7
Dec
2013

Prevalence and Risk Factors of Hepatitis C Virus Infection in Amol City, North of Iran: A Population-Based Study (2008-2011)

Farhad Zamani,
Masoudreza Sohrabi,
Hossein Poustchi,
Hossein Keyvani,
Fatemeh Sima Saeedian,
Hossein Ajdarkosh
,et al.

Zamani F, Sohrabi M, Poustchi H, Keyvani H, Saeedian FS, et al. Prevalence and Risk Factors of Hepatitis C Virus Infection in Amol City, North of Iran: A Population-Based Study (2008-2011). Hepat Mon. 2013;13(12):e13313. doi: https://doi.org/10.5812/hepatmon.13313

31
Jan
2010

Viral Hepatitis in Patients Hospitalized in Two Teaching Hospitals, Tehran , Iran

Mahshid Talebi Taher,
Mohammad Mohit,
Thelma Boghous Avanessians

Talebi Taher M, Mohit M, Boghous Avanessians T. Viral Hepatitis in Patients Hospitalized in Two Teaching Hospitals, Tehran , Iran. Arch Clin Infect Dis. 2010;5(1):. doi:

31
Dec
2009

Seroprevalence of Delta Hepatitis in Patients with Chronic Hepatitis B and its Clinical Impact in Khuzestan Province, Southwest Iran

Seyed Hashemi,
Fariba Jalali,
Eskandar Hajiani

Hashemi S, Jalali F, Hajiani E. Seroprevalence of Delta Hepatitis in Patients with Chronic Hepatitis B and its Clinical Impact in Khuzestan Province, Southwest Iran. Hepat Mon. 2009;9(4):. doi:

29
May
2014

Prevalence of hepatitis C genotypes in patients with hepatitis C in Lorestan province (2009-2013)

Mohammad Reza Nazer,
Behrouz Beiranvand,
Zia Obeidavi,
Omid Beiki

Nazer MR, Beiranvand B, Obeidavi Z, Beiki O. Prevalence of hepatitis C genotypes in patients with hepatitis C in Lorestan province (2009-2013). J Kermanshah Univ Med Sci. 2014;18(2):e74169. doi: https://doi.org/10.22110/jkums.v18i2.1358

Download PDF1023.91 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles